gfp aav control construct serotype 2 1 (Addgene inc)
Addgene inc is a verified supplier 
95
Structured Review
Addgene inc
gfp aav control construct serotype 2 1
Gfp Aav Control Construct Serotype 2 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 64 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+aav+construct/AAV+GFP+(Plasmid+%2349055)/pm29150673-213-14-22
Average 95 stars, based on 64 article reviews
Gfp Aav Control Construct Serotype 2 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 64 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+aav+construct/AAV+GFP+(Plasmid+%2349055)/pm29150673-213-14-22
Average 95 stars, based on 64 article reviews
gfp aav control construct serotype 2 1 - by Bioz Stars,
2026-10
95/100 stars
Images
Related Articles
Bioprocessing:Article Title: Regulation of Glypican 6-mediated Wnt activation maintains TDP-43 nuclear localization in neurons Article Snippet: .. All Article Title: Locus coeruleus norepinephrine neurons facilitate orbitofrontal cortex remapping and behavioral flexibility. Article Snippet: For rabies tracing experiments, AAV8-hSyn-FLEx loxP -TVA-mCherry and AAV8-hSyn-FLEx loxP -H2B-P2A-N2cG-WPRE were mixed at a 1:1 ratio prior to injecting 200 nL into the left OFC of Emx1 Cre (The Jackson Laboratory, 005628) and Gad2 Cre (The Jackson Laboratory, 010802) mice. .. Additional Dbh Cre KI (The Jackson Laboratory, 033951) mice (n = 2) were injected with Cre-dependent Article Title: GCGR agonism requires GABAergic signaling in the medial basal hypothalamus to promote weight loss in obese mice Article Snippet: .. AAV-hSyn-Cre-GFP (3.1 × 10 13 GC/ml), Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice. Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into Article Title: ConSeqUMI, an error-free nanopore sequencing pipeline to identify and extract individual nucleic acid molecules from heterogeneous samples. Article Snippet: .. After profiling our recombinant AAV samples, we next isolated genomes harboring a GFP expression cassette from an Article Title: Protocol for targeted gene manipulation and thermogenic evaluation in mouse brown adipocytes Article Snippet: pAAV-CA-FLEX , Addgene , 38042. .. Article Title: Regulation of glypican 6-mediated Wnt activation maintains TDP-43 nuclear localization in neurons. Article Snippet: .. All Article Title: Regulation of glypican 6-mediated Wnt activation maintains TDP-43 nuclear localization in neurons Article Snippet: .. All Plasmid Preparation:Article Title: Regulation of Glypican 6-mediated Wnt activation maintains TDP-43 nuclear localization in neurons Article Snippet: .. All Article Title: GCGR agonism requires GABAergic signaling in the medial basal hypothalamus to promote weight loss in obese mice Article Snippet: .. AAV-hSyn-Cre-GFP (3.1 × 10 13 GC/ml), Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice. Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into Article Title: Protocol for targeted gene manipulation and thermogenic evaluation in mouse brown adipocytes Article Snippet: pAAV-CA-FLEX , Addgene , 38042. .. Article Title: Regulation of glypican 6-mediated Wnt activation maintains TDP-43 nuclear localization in neurons. Article Snippet: .. All Article Title: Regulation of glypican 6-mediated Wnt activation maintains TDP-43 nuclear localization in neurons Article Snippet: .. All Injection:Article Title: Locus coeruleus norepinephrine neurons facilitate orbitofrontal cortex remapping and behavioral flexibility. Article Snippet: For rabies tracing experiments, AAV8-hSyn-FLEx loxP -TVA-mCherry and AAV8-hSyn-FLEx loxP -H2B-P2A-N2cG-WPRE were mixed at a 1:1 ratio prior to injecting 200 nL into the left OFC of Emx1 Cre (The Jackson Laboratory, 005628) and Gad2 Cre (The Jackson Laboratory, 010802) mice. .. Additional Dbh Cre KI (The Jackson Laboratory, 033951) mice (n = 2) were injected with Cre-dependent Knockdown:Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice. Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into shRNA:Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice. Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into Sequencing:Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice. Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into Clone Assay:Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice. Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into Virus:Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice. Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into Control:Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice. Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into Recombinant:Article Title: ConSeqUMI, an error-free nanopore sequencing pipeline to identify and extract individual nucleic acid molecules from heterogeneous samples. Article Snippet: .. After profiling our recombinant AAV samples, we next isolated genomes harboring a GFP expression cassette from an Isolation:Article Title: ConSeqUMI, an error-free nanopore sequencing pipeline to identify and extract individual nucleic acid molecules from heterogeneous samples. Article Snippet: .. After profiling our recombinant AAV samples, we next isolated genomes harboring a GFP expression cassette from an Expressing:Article Title: ConSeqUMI, an error-free nanopore sequencing pipeline to identify and extract individual nucleic acid molecules from heterogeneous samples. Article Snippet: .. After profiling our recombinant AAV samples, we next isolated genomes harboring a GFP expression cassette from an Nanopore Sequencing:Article Title: ConSeqUMI, an error-free nanopore sequencing pipeline to identify and extract individual nucleic acid molecules from heterogeneous samples. Article Snippet: .. After profiling our recombinant AAV samples, we next isolated genomes harboring a GFP expression cassette from an |