Review



confluency  (Mirus Bio)


Bioz Verified Symbol Mirus Bio is a verified supplier
Bioz Manufacturer Symbol Mirus Bio manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    Mirus Bio confluency
    ( A ) Expression profiles of indicated cell-cycle genes across cell-cycle pseudotime determined by tricycle. ( B ) Percentage of cells in each cell-cycle phase in Tfam , Opa1 , Polg KO cells, post-Mixscape, compared to non-targeting gRNA cells. Chi-squared tests with multiple testing correction (Bonferroni); ns, not significant. ( C ) Schematic showing the expression patterns of the PIP-FUCCI fluorescent reporters Cdt1-mVenus and Geminin-mCherry across the cell-cycle. ( D,E ) Gating strategies used to isolate cells for mtDNA CN measurements based on cell-cycle phase for both inter-phase ( D ) and intra-phase ( E ) comparisons. ( F,G ) Western blot ( F ) and ddPCR measurements ( G ) showing KD of TFAM protein ( F ) and reduced mtDNA CN ( G ) in HeLa cells transduced with two independent TFAM gRNAs. Vinculin is shown as a loading control ( F ). Number of individual cells per group is indicated in ( G ), data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test, **** p < 0.0001. ( H ) Map of the human mtDNA, highlighting the 7.5 Kb deletion present in the DeltaH2.1 cybrid cell line. ( I,J ) mtDNA CN ( I ) and heteroplasmy ( J ) of eight clonal populations isolated from the DeltaH2.1 cybrid cell line. Cell numbers per group indicated on graphs. Data presented as mean values +/- SD. One-way ANOVA of the mtDNA CN distributions was significant (p = 0.015); pairwise comparisons of all heteroplasmic clones to Clone 25 (0% heteroplasmy) using Tukey’s post-hoc test; ns, not significant. ( K ) Respirometry of DeltaH2.1 cybrid cells with increasing heteroplasmy levels, using Oroboros, showing baseline respiration (BR), proton-leak (PL), ATP-linked respiration (AR) and maximal respiratory capacity (MC). Three separate assays per clone. Data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test performed for each tested parameter, all significant pairwise comparisons are shown. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. ( L,M ) Growth curves of DeltaH2.1 cybrid clones carrying different levels of heteroplasmy in high ( L ) and low ( M ) glucose culture medium. <t>Confluency</t> values averaged over 8 individual images per timepoint for each clone in each condition, data presented as mean values ± SEM. Figure created in BioRender. Van den Ameele, J. (2026) https://BioRender.com/j3ro7vq .
    Confluency, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 97/100, based on 2907 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/confluency/TransIT+-293/pmc13095666-271-7-12
    Average 97 stars, based on 2907 article reviews
    confluency - by Bioz Stars, 2026-11
    97/100 stars

    Images

    1) Product Images from "MitoPerturb-Seq identifies gene-specific single-cell responses to mitochondrial DNA depletion and heteroplasmy"

    Article Title: MitoPerturb-Seq identifies gene-specific single-cell responses to mitochondrial DNA depletion and heteroplasmy

    Journal: Nature Structural & Molecular Biology

    doi: 10.1038/s41594-026-01779-7

    ( A ) Expression profiles of indicated cell-cycle genes across cell-cycle pseudotime determined by tricycle. ( B ) Percentage of cells in each cell-cycle phase in Tfam , Opa1 , Polg KO cells, post-Mixscape, compared to non-targeting gRNA cells. Chi-squared tests with multiple testing correction (Bonferroni); ns, not significant. ( C ) Schematic showing the expression patterns of the PIP-FUCCI fluorescent reporters Cdt1-mVenus and Geminin-mCherry across the cell-cycle. ( D,E ) Gating strategies used to isolate cells for mtDNA CN measurements based on cell-cycle phase for both inter-phase ( D ) and intra-phase ( E ) comparisons. ( F,G ) Western blot ( F ) and ddPCR measurements ( G ) showing KD of TFAM protein ( F ) and reduced mtDNA CN ( G ) in HeLa cells transduced with two independent TFAM gRNAs. Vinculin is shown as a loading control ( F ). Number of individual cells per group is indicated in ( G ), data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test, **** p < 0.0001. ( H ) Map of the human mtDNA, highlighting the 7.5 Kb deletion present in the DeltaH2.1 cybrid cell line. ( I,J ) mtDNA CN ( I ) and heteroplasmy ( J ) of eight clonal populations isolated from the DeltaH2.1 cybrid cell line. Cell numbers per group indicated on graphs. Data presented as mean values +/- SD. One-way ANOVA of the mtDNA CN distributions was significant (p = 0.015); pairwise comparisons of all heteroplasmic clones to Clone 25 (0% heteroplasmy) using Tukey’s post-hoc test; ns, not significant. ( K ) Respirometry of DeltaH2.1 cybrid cells with increasing heteroplasmy levels, using Oroboros, showing baseline respiration (BR), proton-leak (PL), ATP-linked respiration (AR) and maximal respiratory capacity (MC). Three separate assays per clone. Data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test performed for each tested parameter, all significant pairwise comparisons are shown. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. ( L,M ) Growth curves of DeltaH2.1 cybrid clones carrying different levels of heteroplasmy in high ( L ) and low ( M ) glucose culture medium. Confluency values averaged over 8 individual images per timepoint for each clone in each condition, data presented as mean values ± SEM. Figure created in BioRender. Van den Ameele, J. (2026) https://BioRender.com/j3ro7vq .
    Figure Legend Snippet: ( A ) Expression profiles of indicated cell-cycle genes across cell-cycle pseudotime determined by tricycle. ( B ) Percentage of cells in each cell-cycle phase in Tfam , Opa1 , Polg KO cells, post-Mixscape, compared to non-targeting gRNA cells. Chi-squared tests with multiple testing correction (Bonferroni); ns, not significant. ( C ) Schematic showing the expression patterns of the PIP-FUCCI fluorescent reporters Cdt1-mVenus and Geminin-mCherry across the cell-cycle. ( D,E ) Gating strategies used to isolate cells for mtDNA CN measurements based on cell-cycle phase for both inter-phase ( D ) and intra-phase ( E ) comparisons. ( F,G ) Western blot ( F ) and ddPCR measurements ( G ) showing KD of TFAM protein ( F ) and reduced mtDNA CN ( G ) in HeLa cells transduced with two independent TFAM gRNAs. Vinculin is shown as a loading control ( F ). Number of individual cells per group is indicated in ( G ), data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test, **** p < 0.0001. ( H ) Map of the human mtDNA, highlighting the 7.5 Kb deletion present in the DeltaH2.1 cybrid cell line. ( I,J ) mtDNA CN ( I ) and heteroplasmy ( J ) of eight clonal populations isolated from the DeltaH2.1 cybrid cell line. Cell numbers per group indicated on graphs. Data presented as mean values +/- SD. One-way ANOVA of the mtDNA CN distributions was significant (p = 0.015); pairwise comparisons of all heteroplasmic clones to Clone 25 (0% heteroplasmy) using Tukey’s post-hoc test; ns, not significant. ( K ) Respirometry of DeltaH2.1 cybrid cells with increasing heteroplasmy levels, using Oroboros, showing baseline respiration (BR), proton-leak (PL), ATP-linked respiration (AR) and maximal respiratory capacity (MC). Three separate assays per clone. Data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test performed for each tested parameter, all significant pairwise comparisons are shown. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. ( L,M ) Growth curves of DeltaH2.1 cybrid clones carrying different levels of heteroplasmy in high ( L ) and low ( M ) glucose culture medium. Confluency values averaged over 8 individual images per timepoint for each clone in each condition, data presented as mean values ± SEM. Figure created in BioRender. Van den Ameele, J. (2026) https://BioRender.com/j3ro7vq .

    Techniques Used: Expressing, Western Blot, Transduction, Control, Isolation, Clone Assay

    Related Articles

    Clone Assay:

    Article Title: Targeting CD28 on T lineage malignancies with chimeric antigen receptor T cells.
    Article Snippet: .. CAR molecules cloned into pMP71 were transfected into 293Vec-Galv cells (kindly provided by BioVec Pharma Inc) using TransIT-293 Transfection Reagent (Mirus Bio) according to the supplier’s informationwith 2.5 μg of plasmid DNA. .. Retroviral supernatant was used for transduction of 293Vec-RD114 cells (kindly provided by BioVec Pharma Inc) to create a stable producer system, which were subsequently FACS-sorted for myc-positive cells.

    Transfection:

    Article Title: Targeting CD28 on T lineage malignancies with chimeric antigen receptor T cells.
    Article Snippet: .. CAR molecules cloned into pMP71 were transfected into 293Vec-Galv cells (kindly provided by BioVec Pharma Inc) using TransIT-293 Transfection Reagent (Mirus Bio) according to the supplier’s informationwith 2.5 μg of plasmid DNA. .. Retroviral supernatant was used for transduction of 293Vec-RD114 cells (kindly provided by BioVec Pharma Inc) to create a stable producer system, which were subsequently FACS-sorted for myc-positive cells.

    Article Title: TET2 loss triggers ssDNA gap accumulation and heightened PARP inhibitor sensitivity.
    Article Snippet: Silencer select negative control #1 siRNA (Ambion, 4390843) was used as control (siCTRL) at the same concentration of the highest concentration of siRNA used in the experiment97. .. HEK-293T cells were transfected using Mirus Transit 293 reagent with lentiviral packaging vectors pMD2.G (Addgene, #12259) and psPAX2 (Addgene, #12260) along with the construct of interest. .. CRISPR guide constructs targeting TET1 (5′CCCGAAGGCATCGTACAGTG 3′) or TET3 (5′ TCGAGAAGGTCATCTACACG 3′) were cloned into lentiCRISPR v2blast (#83480, Addgene) or lentiCRISPR v2-puro (Addgene, #52961).

    Article Title: NicheSphere reveals an Spp1-centered multicellular niche in myeloproliferative neoplasm-associated fibrosis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER anti-CD45.2, PE Biolegend BioLegend Cat# 109808, RRID:AB_313445 anti-CD150 (SLAM), PeCy7 Biolegend BioLegend Cat# 115914, RRID:AB_439797 anti-CD11b, APC Biolegend BioLegend Cat# 101212, RRID:AB_312795 anti-Ly6G/Ly-6C (Gr1), Alexa Fluor 700 Biolegend BioLegend Cat# 108422, RRID:AB_2137487 anti-CD3, PE Biolegend BioLegend Cat# 100206, RRID:AB_312663 anti-B220, eFluor450 eBioscience Thermo Fisher Scientific Cat# 48-0452-82, RRID:AB_1548761 anti-CD45.1, BV605 Biolegend BioLegend Cat# 110738, RRID:AB_2562565 anti-CD45.2, PerCp/Cy5.5 Biolegend BioLegend Cat# 109828, RRID:AB_893350 Hoechst solution 33342 BD Biosciences BD Biosciences Cat# 561908, RRID:AB_2869394 Calcein Green Invitrogen Cat# C34852 Anti-CD34-PE BD Biosciences Cat# 555822 Anti-CD45-APC BD Biosciences Cat# 555485 Anti-CD3-PerCpCy5.5 BD Biosciences Cat# 560835 Anti-CD19-BB700 BD Biosciences Cat# 566396 Anti-HLA-DR-PeCy7 BD Biosciences Cat# 560651 Anti-CD235a-Pacific Blue Biolegend Cat# 306612 Bacterial and virus strains Lentivirus: TPO-GFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-GFP (empty vector control) This paper N/A Lentivirus: TPO-BFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-BFP (empty vector control) This paper N/A pMIG William Hahn Addgene plasmid #9044 pRRL.PPT.SFFV.IRES2.EGFP.WPRE Axels Schambach, Dirk Heckl N/A MSCV-MPL-IRES-EGFP Ross L. Levine N/A pMSCV_ERHBD_Hoxb8 This paper N/A Biological samples Human bone marrow trephine biopsies, MF patients (pre-allo-HSCT) RWTH Aachen University N/A Human femoral heads, healthy donors (total hip arthroplasty) RWTH Aachen University N/A Chemicals, peptides, and recombinant proteins Liberase TL Roche Cat# 05401020001 DNase I Sigma-Aldrich Cat# DN25 Tween 20 Thermo Fisher Scientific Cat# 28360 BD PharmLyse BD Biosciences Cat#555899; RRID: AB_2869057 Recombinant human TGF-β1 PeproTech Cat# 100-21-10 Recombinant murine SCF (m-Scf) PeproTech Cat# 250-03 Recombinant murine TPO (m-Tpo) PeproTech Cat# 351-14 Recombinant murine mM-CSF PeproTech Cat# 300-25 Recombinant murine IL-6 PeproTech Cat# 216-16 Recombinant murine IL-1α PeproTech Cat# 211-11A Recombinant murine IL-1β PeproTech Cat# 211-11B Recombinant murine S100A8 Abnova Cat# P4345 (Continued on next page) e2 Cell Press Blue 2, 100146, January 25, 2027 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant murine SPP1 R&D Systems Cat# 441-OP Polybrene Merck Millipore Cat# TR-1003-G TransIT transfection reagent Mirus Bio Cat# MIR2700 DAB substrate Vector Laboratories Cat# SK-4100 Antibody storage buffer CANDOR Bioscience Cat# 131125 Eosin solution Sigma-Aldrich Cat#HT110116 Hematoxylin solution, Gill No. 2 Sigma-Aldrich Cat#GHS232 16% Paraformaldehyde, methanol free Thermo Fisher Scientific Cat#043368.9M StemSpan culture medium (SFEM) Stem Cell Technologies Cat# 09650 β-Estradiol Sigma-Aldrich Cat#5150-64-1 Fluoromount-6 ITK Diagnostics Cat#F3724 Enrofloxacin (Baytril), 25mg/mL oral solution Elanco N/A Iscove’s modified Dulbecco’s medium (IMDM, Gibco) Sigma-Aldrich Cat#12440053 Critical commercial assays Single Cell 3′ Library & Gel Bead Kit v3.1 10× Genomics Cat#PN-1000268 Chromium Next GEM Chip G Single Cell Kit v3.1 10× Genomics Cat#PN-1000127 Dual Index Kit TT Set A 10× Genomics Cat#PN-100215 Chromium Single Cell 3′ Reagent Kits User Guide 10× Genomics Manual part no. CG000315, revision D Avidin/Biotin Blocking Kit Vector Laboratories Cat# SP-2001 Reticulin silver plating kit (Gordon & Sweets) Merck Cat# 1002510001 Murine CD117 (c-Kit) MicroBeads Miltenyi Biotec Cat# 130-091-224 Fast SYBR Green Master Mix Applied Biosystems Cat#4385616 High-Capacity cDNA Reverse Transcription Kits Thermo Fisher Scientific Cat#4368814 Peroxidase substrate kit Vector Laboratories Cat#SK-4100 ABC-kit Vector Laboratories Cat#PK-6100 Mouse IL-1beta DuoSet ELISA R&D Systems Cat#DY401 Deposited data Human single-cell RNA-seq data Benabid et al., 2026 DOI: https://doi.org/10.5281/zenodo. .. 22688208 Human reference genome GRCh38/ GRCh38-2020-A 10× Genomics/Ensembl N/A UK Biobank cohort data UK Biobank https://www.ukbiobank.ac.uk/ Genome Reference Consortium Mouse Build 39 Genome Reference Consortium https://www.ncbi.nlm.nih.gov/datasets/ genome/GCF_000001635.27/ scRNAseq bone marrow ZsGreen in Gli1tdtomato recipient TPO mouse model singlets and doublets This paper GEO accession number: GSE347294 (https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSE347294) DOI: https://doi.org/10.5281/zenodo.

    Article Title: Cell-type-specific repression reveals MC4R neurons as a site of action for ciliary obesity genes.
    Article Snippet: AAV DJ preparation AAV DJ used in adult stereotaxic injections was produced in AAVpro cells (Takara, 632273, passage number less than 10) maintained in complete DMEM [DMEM (Gibco, 11995065) supplemented with 10% FBS (Gibco, A5670801) and 1% penicillin– streptomycin (Sigma-Aldrich, P4333)]. .. Cells were seeded at 2.5 × 107 cells per 15-cm dish (two dishes per virus) and transfected 24 h later with 20 μg each of pHelper (Takara), pRC DJ [88], and AAV sgRNA plasmids using 120 μl TransIT-293 reagent (Mirus, 2700) in 4 mL Opti-MEM (Gibco, 31985-070). ..

    Article Title: A massively parallel reporter assay of MECP2cis-regulatory elements reveals genetic candidates for male-biased autism.
    Article Snippet: .. After 24 h, transfection was performed using 0.063 pmol firefly construct, 0.063 4 The American Journal of Human Genetics 113, 1–18, November 5, 2026 pmol Renilla control (Addgene 106292), 108 ng pMD2.G (Addgene 12259), and 325 ng psPAX2 (Addgene 12260), with TransIT293 Transfection Reagent (Mirus Bio 2704) and OptiMEM (Thermo Fisher Scientific 31985062). .. After 48 h, 400 μL supernatant was collected and centrifuged at room temperature for 10 min at 500 × g. 300 μL supernatant was then combined with 100 μL Lenti-X Concentrator (Takara 631231) and chilled at 4◦C overnight.

    Plasmid Preparation:

    Article Title: Targeting CD28 on T lineage malignancies with chimeric antigen receptor T cells.
    Article Snippet: .. CAR molecules cloned into pMP71 were transfected into 293Vec-Galv cells (kindly provided by BioVec Pharma Inc) using TransIT-293 Transfection Reagent (Mirus Bio) according to the supplier’s informationwith 2.5 μg of plasmid DNA. .. Retroviral supernatant was used for transduction of 293Vec-RD114 cells (kindly provided by BioVec Pharma Inc) to create a stable producer system, which were subsequently FACS-sorted for myc-positive cells.

    Generated:

    Article Title: DNA replication stress redistributes the histone methyltransferase G9a and activates lineage-specific gene expression
    Article Snippet: .. For all lentiviral transductions, lentiviral particles were generated by transfecting 293T cells (ATCC, CRL-3216) with a 4:2:1:1 ratio of the TARGET : pMDLg : pMD2.G : pRSV-REV plasmids using Transit 293T reagent (Mirus Bio, MIR 2700). ..

    Construct:

    Article Title: TET2 loss triggers ssDNA gap accumulation and heightened PARP inhibitor sensitivity.
    Article Snippet: Silencer select negative control #1 siRNA (Ambion, 4390843) was used as control (siCTRL) at the same concentration of the highest concentration of siRNA used in the experiment97. .. HEK-293T cells were transfected using Mirus Transit 293 reagent with lentiviral packaging vectors pMD2.G (Addgene, #12259) and psPAX2 (Addgene, #12260) along with the construct of interest. .. CRISPR guide constructs targeting TET1 (5′CCCGAAGGCATCGTACAGTG 3′) or TET3 (5′ TCGAGAAGGTCATCTACACG 3′) were cloned into lentiCRISPR v2blast (#83480, Addgene) or lentiCRISPR v2-puro (Addgene, #52961).

    Article Title: A massively parallel reporter assay of MECP2cis-regulatory elements reveals genetic candidates for male-biased autism.
    Article Snippet: .. After 24 h, transfection was performed using 0.063 pmol firefly construct, 0.063 4 The American Journal of Human Genetics 113, 1–18, November 5, 2026 pmol Renilla control (Addgene 106292), 108 ng pMD2.G (Addgene 12259), and 325 ng psPAX2 (Addgene 12260), with TransIT293 Transfection Reagent (Mirus Bio 2704) and OptiMEM (Thermo Fisher Scientific 31985062). .. After 48 h, 400 μL supernatant was collected and centrifuged at room temperature for 10 min at 500 × g. 300 μL supernatant was then combined with 100 μL Lenti-X Concentrator (Takara 631231) and chilled at 4◦C overnight.

    Recombinant:

    Article Title: NicheSphere reveals an Spp1-centered multicellular niche in myeloproliferative neoplasm-associated fibrosis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER anti-CD45.2, PE Biolegend BioLegend Cat# 109808, RRID:AB_313445 anti-CD150 (SLAM), PeCy7 Biolegend BioLegend Cat# 115914, RRID:AB_439797 anti-CD11b, APC Biolegend BioLegend Cat# 101212, RRID:AB_312795 anti-Ly6G/Ly-6C (Gr1), Alexa Fluor 700 Biolegend BioLegend Cat# 108422, RRID:AB_2137487 anti-CD3, PE Biolegend BioLegend Cat# 100206, RRID:AB_312663 anti-B220, eFluor450 eBioscience Thermo Fisher Scientific Cat# 48-0452-82, RRID:AB_1548761 anti-CD45.1, BV605 Biolegend BioLegend Cat# 110738, RRID:AB_2562565 anti-CD45.2, PerCp/Cy5.5 Biolegend BioLegend Cat# 109828, RRID:AB_893350 Hoechst solution 33342 BD Biosciences BD Biosciences Cat# 561908, RRID:AB_2869394 Calcein Green Invitrogen Cat# C34852 Anti-CD34-PE BD Biosciences Cat# 555822 Anti-CD45-APC BD Biosciences Cat# 555485 Anti-CD3-PerCpCy5.5 BD Biosciences Cat# 560835 Anti-CD19-BB700 BD Biosciences Cat# 566396 Anti-HLA-DR-PeCy7 BD Biosciences Cat# 560651 Anti-CD235a-Pacific Blue Biolegend Cat# 306612 Bacterial and virus strains Lentivirus: TPO-GFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-GFP (empty vector control) This paper N/A Lentivirus: TPO-BFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-BFP (empty vector control) This paper N/A pMIG William Hahn Addgene plasmid #9044 pRRL.PPT.SFFV.IRES2.EGFP.WPRE Axels Schambach, Dirk Heckl N/A MSCV-MPL-IRES-EGFP Ross L. Levine N/A pMSCV_ERHBD_Hoxb8 This paper N/A Biological samples Human bone marrow trephine biopsies, MF patients (pre-allo-HSCT) RWTH Aachen University N/A Human femoral heads, healthy donors (total hip arthroplasty) RWTH Aachen University N/A Chemicals, peptides, and recombinant proteins Liberase TL Roche Cat# 05401020001 DNase I Sigma-Aldrich Cat# DN25 Tween 20 Thermo Fisher Scientific Cat# 28360 BD PharmLyse BD Biosciences Cat#555899; RRID: AB_2869057 Recombinant human TGF-β1 PeproTech Cat# 100-21-10 Recombinant murine SCF (m-Scf) PeproTech Cat# 250-03 Recombinant murine TPO (m-Tpo) PeproTech Cat# 351-14 Recombinant murine mM-CSF PeproTech Cat# 300-25 Recombinant murine IL-6 PeproTech Cat# 216-16 Recombinant murine IL-1α PeproTech Cat# 211-11A Recombinant murine IL-1β PeproTech Cat# 211-11B Recombinant murine S100A8 Abnova Cat# P4345 (Continued on next page) e2 Cell Press Blue 2, 100146, January 25, 2027 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant murine SPP1 R&D Systems Cat# 441-OP Polybrene Merck Millipore Cat# TR-1003-G TransIT transfection reagent Mirus Bio Cat# MIR2700 DAB substrate Vector Laboratories Cat# SK-4100 Antibody storage buffer CANDOR Bioscience Cat# 131125 Eosin solution Sigma-Aldrich Cat#HT110116 Hematoxylin solution, Gill No. 2 Sigma-Aldrich Cat#GHS232 16% Paraformaldehyde, methanol free Thermo Fisher Scientific Cat#043368.9M StemSpan culture medium (SFEM) Stem Cell Technologies Cat# 09650 β-Estradiol Sigma-Aldrich Cat#5150-64-1 Fluoromount-6 ITK Diagnostics Cat#F3724 Enrofloxacin (Baytril), 25mg/mL oral solution Elanco N/A Iscove’s modified Dulbecco’s medium (IMDM, Gibco) Sigma-Aldrich Cat#12440053 Critical commercial assays Single Cell 3′ Library & Gel Bead Kit v3.1 10× Genomics Cat#PN-1000268 Chromium Next GEM Chip G Single Cell Kit v3.1 10× Genomics Cat#PN-1000127 Dual Index Kit TT Set A 10× Genomics Cat#PN-100215 Chromium Single Cell 3′ Reagent Kits User Guide 10× Genomics Manual part no. CG000315, revision D Avidin/Biotin Blocking Kit Vector Laboratories Cat# SP-2001 Reticulin silver plating kit (Gordon & Sweets) Merck Cat# 1002510001 Murine CD117 (c-Kit) MicroBeads Miltenyi Biotec Cat# 130-091-224 Fast SYBR Green Master Mix Applied Biosystems Cat#4385616 High-Capacity cDNA Reverse Transcription Kits Thermo Fisher Scientific Cat#4368814 Peroxidase substrate kit Vector Laboratories Cat#SK-4100 ABC-kit Vector Laboratories Cat#PK-6100 Mouse IL-1beta DuoSet ELISA R&D Systems Cat#DY401 Deposited data Human single-cell RNA-seq data Benabid et al., 2026 DOI: https://doi.org/10.5281/zenodo. .. 22688208 Human reference genome GRCh38/ GRCh38-2020-A 10× Genomics/Ensembl N/A UK Biobank cohort data UK Biobank https://www.ukbiobank.ac.uk/ Genome Reference Consortium Mouse Build 39 Genome Reference Consortium https://www.ncbi.nlm.nih.gov/datasets/ genome/GCF_000001635.27/ scRNAseq bone marrow ZsGreen in Gli1tdtomato recipient TPO mouse model singlets and doublets This paper GEO accession number: GSE347294 (https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSE347294) DOI: https://doi.org/10.5281/zenodo.

    Stem Cell:

    Article Title: NicheSphere reveals an Spp1-centered multicellular niche in myeloproliferative neoplasm-associated fibrosis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER anti-CD45.2, PE Biolegend BioLegend Cat# 109808, RRID:AB_313445 anti-CD150 (SLAM), PeCy7 Biolegend BioLegend Cat# 115914, RRID:AB_439797 anti-CD11b, APC Biolegend BioLegend Cat# 101212, RRID:AB_312795 anti-Ly6G/Ly-6C (Gr1), Alexa Fluor 700 Biolegend BioLegend Cat# 108422, RRID:AB_2137487 anti-CD3, PE Biolegend BioLegend Cat# 100206, RRID:AB_312663 anti-B220, eFluor450 eBioscience Thermo Fisher Scientific Cat# 48-0452-82, RRID:AB_1548761 anti-CD45.1, BV605 Biolegend BioLegend Cat# 110738, RRID:AB_2562565 anti-CD45.2, PerCp/Cy5.5 Biolegend BioLegend Cat# 109828, RRID:AB_893350 Hoechst solution 33342 BD Biosciences BD Biosciences Cat# 561908, RRID:AB_2869394 Calcein Green Invitrogen Cat# C34852 Anti-CD34-PE BD Biosciences Cat# 555822 Anti-CD45-APC BD Biosciences Cat# 555485 Anti-CD3-PerCpCy5.5 BD Biosciences Cat# 560835 Anti-CD19-BB700 BD Biosciences Cat# 566396 Anti-HLA-DR-PeCy7 BD Biosciences Cat# 560651 Anti-CD235a-Pacific Blue Biolegend Cat# 306612 Bacterial and virus strains Lentivirus: TPO-GFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-GFP (empty vector control) This paper N/A Lentivirus: TPO-BFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-BFP (empty vector control) This paper N/A pMIG William Hahn Addgene plasmid #9044 pRRL.PPT.SFFV.IRES2.EGFP.WPRE Axels Schambach, Dirk Heckl N/A MSCV-MPL-IRES-EGFP Ross L. Levine N/A pMSCV_ERHBD_Hoxb8 This paper N/A Biological samples Human bone marrow trephine biopsies, MF patients (pre-allo-HSCT) RWTH Aachen University N/A Human femoral heads, healthy donors (total hip arthroplasty) RWTH Aachen University N/A Chemicals, peptides, and recombinant proteins Liberase TL Roche Cat# 05401020001 DNase I Sigma-Aldrich Cat# DN25 Tween 20 Thermo Fisher Scientific Cat# 28360 BD PharmLyse BD Biosciences Cat#555899; RRID: AB_2869057 Recombinant human TGF-β1 PeproTech Cat# 100-21-10 Recombinant murine SCF (m-Scf) PeproTech Cat# 250-03 Recombinant murine TPO (m-Tpo) PeproTech Cat# 351-14 Recombinant murine mM-CSF PeproTech Cat# 300-25 Recombinant murine IL-6 PeproTech Cat# 216-16 Recombinant murine IL-1α PeproTech Cat# 211-11A Recombinant murine IL-1β PeproTech Cat# 211-11B Recombinant murine S100A8 Abnova Cat# P4345 (Continued on next page) e2 Cell Press Blue 2, 100146, January 25, 2027 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant murine SPP1 R&D Systems Cat# 441-OP Polybrene Merck Millipore Cat# TR-1003-G TransIT transfection reagent Mirus Bio Cat# MIR2700 DAB substrate Vector Laboratories Cat# SK-4100 Antibody storage buffer CANDOR Bioscience Cat# 131125 Eosin solution Sigma-Aldrich Cat#HT110116 Hematoxylin solution, Gill No. 2 Sigma-Aldrich Cat#GHS232 16% Paraformaldehyde, methanol free Thermo Fisher Scientific Cat#043368.9M StemSpan culture medium (SFEM) Stem Cell Technologies Cat# 09650 β-Estradiol Sigma-Aldrich Cat#5150-64-1 Fluoromount-6 ITK Diagnostics Cat#F3724 Enrofloxacin (Baytril), 25mg/mL oral solution Elanco N/A Iscove’s modified Dulbecco’s medium (IMDM, Gibco) Sigma-Aldrich Cat#12440053 Critical commercial assays Single Cell 3′ Library & Gel Bead Kit v3.1 10× Genomics Cat#PN-1000268 Chromium Next GEM Chip G Single Cell Kit v3.1 10× Genomics Cat#PN-1000127 Dual Index Kit TT Set A 10× Genomics Cat#PN-100215 Chromium Single Cell 3′ Reagent Kits User Guide 10× Genomics Manual part no. CG000315, revision D Avidin/Biotin Blocking Kit Vector Laboratories Cat# SP-2001 Reticulin silver plating kit (Gordon & Sweets) Merck Cat# 1002510001 Murine CD117 (c-Kit) MicroBeads Miltenyi Biotec Cat# 130-091-224 Fast SYBR Green Master Mix Applied Biosystems Cat#4385616 High-Capacity cDNA Reverse Transcription Kits Thermo Fisher Scientific Cat#4368814 Peroxidase substrate kit Vector Laboratories Cat#SK-4100 ABC-kit Vector Laboratories Cat#PK-6100 Mouse IL-1beta DuoSet ELISA R&D Systems Cat#DY401 Deposited data Human single-cell RNA-seq data Benabid et al., 2026 DOI: https://doi.org/10.5281/zenodo. .. 22688208 Human reference genome GRCh38/ GRCh38-2020-A 10× Genomics/Ensembl N/A UK Biobank cohort data UK Biobank https://www.ukbiobank.ac.uk/ Genome Reference Consortium Mouse Build 39 Genome Reference Consortium https://www.ncbi.nlm.nih.gov/datasets/ genome/GCF_000001635.27/ scRNAseq bone marrow ZsGreen in Gli1tdtomato recipient TPO mouse model singlets and doublets This paper GEO accession number: GSE347294 (https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSE347294) DOI: https://doi.org/10.5281/zenodo.

    Modification:

    Article Title: NicheSphere reveals an Spp1-centered multicellular niche in myeloproliferative neoplasm-associated fibrosis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER anti-CD45.2, PE Biolegend BioLegend Cat# 109808, RRID:AB_313445 anti-CD150 (SLAM), PeCy7 Biolegend BioLegend Cat# 115914, RRID:AB_439797 anti-CD11b, APC Biolegend BioLegend Cat# 101212, RRID:AB_312795 anti-Ly6G/Ly-6C (Gr1), Alexa Fluor 700 Biolegend BioLegend Cat# 108422, RRID:AB_2137487 anti-CD3, PE Biolegend BioLegend Cat# 100206, RRID:AB_312663 anti-B220, eFluor450 eBioscience Thermo Fisher Scientific Cat# 48-0452-82, RRID:AB_1548761 anti-CD45.1, BV605 Biolegend BioLegend Cat# 110738, RRID:AB_2562565 anti-CD45.2, PerCp/Cy5.5 Biolegend BioLegend Cat# 109828, RRID:AB_893350 Hoechst solution 33342 BD Biosciences BD Biosciences Cat# 561908, RRID:AB_2869394 Calcein Green Invitrogen Cat# C34852 Anti-CD34-PE BD Biosciences Cat# 555822 Anti-CD45-APC BD Biosciences Cat# 555485 Anti-CD3-PerCpCy5.5 BD Biosciences Cat# 560835 Anti-CD19-BB700 BD Biosciences Cat# 566396 Anti-HLA-DR-PeCy7 BD Biosciences Cat# 560651 Anti-CD235a-Pacific Blue Biolegend Cat# 306612 Bacterial and virus strains Lentivirus: TPO-GFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-GFP (empty vector control) This paper N/A Lentivirus: TPO-BFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-BFP (empty vector control) This paper N/A pMIG William Hahn Addgene plasmid #9044 pRRL.PPT.SFFV.IRES2.EGFP.WPRE Axels Schambach, Dirk Heckl N/A MSCV-MPL-IRES-EGFP Ross L. Levine N/A pMSCV_ERHBD_Hoxb8 This paper N/A Biological samples Human bone marrow trephine biopsies, MF patients (pre-allo-HSCT) RWTH Aachen University N/A Human femoral heads, healthy donors (total hip arthroplasty) RWTH Aachen University N/A Chemicals, peptides, and recombinant proteins Liberase TL Roche Cat# 05401020001 DNase I Sigma-Aldrich Cat# DN25 Tween 20 Thermo Fisher Scientific Cat# 28360 BD PharmLyse BD Biosciences Cat#555899; RRID: AB_2869057 Recombinant human TGF-β1 PeproTech Cat# 100-21-10 Recombinant murine SCF (m-Scf) PeproTech Cat# 250-03 Recombinant murine TPO (m-Tpo) PeproTech Cat# 351-14 Recombinant murine mM-CSF PeproTech Cat# 300-25 Recombinant murine IL-6 PeproTech Cat# 216-16 Recombinant murine IL-1α PeproTech Cat# 211-11A Recombinant murine IL-1β PeproTech Cat# 211-11B Recombinant murine S100A8 Abnova Cat# P4345 (Continued on next page) e2 Cell Press Blue 2, 100146, January 25, 2027 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant murine SPP1 R&D Systems Cat# 441-OP Polybrene Merck Millipore Cat# TR-1003-G TransIT transfection reagent Mirus Bio Cat# MIR2700 DAB substrate Vector Laboratories Cat# SK-4100 Antibody storage buffer CANDOR Bioscience Cat# 131125 Eosin solution Sigma-Aldrich Cat#HT110116 Hematoxylin solution, Gill No. 2 Sigma-Aldrich Cat#GHS232 16% Paraformaldehyde, methanol free Thermo Fisher Scientific Cat#043368.9M StemSpan culture medium (SFEM) Stem Cell Technologies Cat# 09650 β-Estradiol Sigma-Aldrich Cat#5150-64-1 Fluoromount-6 ITK Diagnostics Cat#F3724 Enrofloxacin (Baytril), 25mg/mL oral solution Elanco N/A Iscove’s modified Dulbecco’s medium (IMDM, Gibco) Sigma-Aldrich Cat#12440053 Critical commercial assays Single Cell 3′ Library & Gel Bead Kit v3.1 10× Genomics Cat#PN-1000268 Chromium Next GEM Chip G Single Cell Kit v3.1 10× Genomics Cat#PN-1000127 Dual Index Kit TT Set A 10× Genomics Cat#PN-100215 Chromium Single Cell 3′ Reagent Kits User Guide 10× Genomics Manual part no. CG000315, revision D Avidin/Biotin Blocking Kit Vector Laboratories Cat# SP-2001 Reticulin silver plating kit (Gordon & Sweets) Merck Cat# 1002510001 Murine CD117 (c-Kit) MicroBeads Miltenyi Biotec Cat# 130-091-224 Fast SYBR Green Master Mix Applied Biosystems Cat#4385616 High-Capacity cDNA Reverse Transcription Kits Thermo Fisher Scientific Cat#4368814 Peroxidase substrate kit Vector Laboratories Cat#SK-4100 ABC-kit Vector Laboratories Cat#PK-6100 Mouse IL-1beta DuoSet ELISA R&D Systems Cat#DY401 Deposited data Human single-cell RNA-seq data Benabid et al., 2026 DOI: https://doi.org/10.5281/zenodo. .. 22688208 Human reference genome GRCh38/ GRCh38-2020-A 10× Genomics/Ensembl N/A UK Biobank cohort data UK Biobank https://www.ukbiobank.ac.uk/ Genome Reference Consortium Mouse Build 39 Genome Reference Consortium https://www.ncbi.nlm.nih.gov/datasets/ genome/GCF_000001635.27/ scRNAseq bone marrow ZsGreen in Gli1tdtomato recipient TPO mouse model singlets and doublets This paper GEO accession number: GSE347294 (https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSE347294) DOI: https://doi.org/10.5281/zenodo.

    Single Cell:

    Article Title: NicheSphere reveals an Spp1-centered multicellular niche in myeloproliferative neoplasm-associated fibrosis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER anti-CD45.2, PE Biolegend BioLegend Cat# 109808, RRID:AB_313445 anti-CD150 (SLAM), PeCy7 Biolegend BioLegend Cat# 115914, RRID:AB_439797 anti-CD11b, APC Biolegend BioLegend Cat# 101212, RRID:AB_312795 anti-Ly6G/Ly-6C (Gr1), Alexa Fluor 700 Biolegend BioLegend Cat# 108422, RRID:AB_2137487 anti-CD3, PE Biolegend BioLegend Cat# 100206, RRID:AB_312663 anti-B220, eFluor450 eBioscience Thermo Fisher Scientific Cat# 48-0452-82, RRID:AB_1548761 anti-CD45.1, BV605 Biolegend BioLegend Cat# 110738, RRID:AB_2562565 anti-CD45.2, PerCp/Cy5.5 Biolegend BioLegend Cat# 109828, RRID:AB_893350 Hoechst solution 33342 BD Biosciences BD Biosciences Cat# 561908, RRID:AB_2869394 Calcein Green Invitrogen Cat# C34852 Anti-CD34-PE BD Biosciences Cat# 555822 Anti-CD45-APC BD Biosciences Cat# 555485 Anti-CD3-PerCpCy5.5 BD Biosciences Cat# 560835 Anti-CD19-BB700 BD Biosciences Cat# 566396 Anti-HLA-DR-PeCy7 BD Biosciences Cat# 560651 Anti-CD235a-Pacific Blue Biolegend Cat# 306612 Bacterial and virus strains Lentivirus: TPO-GFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-GFP (empty vector control) This paper N/A Lentivirus: TPO-BFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-BFP (empty vector control) This paper N/A pMIG William Hahn Addgene plasmid #9044 pRRL.PPT.SFFV.IRES2.EGFP.WPRE Axels Schambach, Dirk Heckl N/A MSCV-MPL-IRES-EGFP Ross L. Levine N/A pMSCV_ERHBD_Hoxb8 This paper N/A Biological samples Human bone marrow trephine biopsies, MF patients (pre-allo-HSCT) RWTH Aachen University N/A Human femoral heads, healthy donors (total hip arthroplasty) RWTH Aachen University N/A Chemicals, peptides, and recombinant proteins Liberase TL Roche Cat# 05401020001 DNase I Sigma-Aldrich Cat# DN25 Tween 20 Thermo Fisher Scientific Cat# 28360 BD PharmLyse BD Biosciences Cat#555899; RRID: AB_2869057 Recombinant human TGF-β1 PeproTech Cat# 100-21-10 Recombinant murine SCF (m-Scf) PeproTech Cat# 250-03 Recombinant murine TPO (m-Tpo) PeproTech Cat# 351-14 Recombinant murine mM-CSF PeproTech Cat# 300-25 Recombinant murine IL-6 PeproTech Cat# 216-16 Recombinant murine IL-1α PeproTech Cat# 211-11A Recombinant murine IL-1β PeproTech Cat# 211-11B Recombinant murine S100A8 Abnova Cat# P4345 (Continued on next page) e2 Cell Press Blue 2, 100146, January 25, 2027 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant murine SPP1 R&D Systems Cat# 441-OP Polybrene Merck Millipore Cat# TR-1003-G TransIT transfection reagent Mirus Bio Cat# MIR2700 DAB substrate Vector Laboratories Cat# SK-4100 Antibody storage buffer CANDOR Bioscience Cat# 131125 Eosin solution Sigma-Aldrich Cat#HT110116 Hematoxylin solution, Gill No. 2 Sigma-Aldrich Cat#GHS232 16% Paraformaldehyde, methanol free Thermo Fisher Scientific Cat#043368.9M StemSpan culture medium (SFEM) Stem Cell Technologies Cat# 09650 β-Estradiol Sigma-Aldrich Cat#5150-64-1 Fluoromount-6 ITK Diagnostics Cat#F3724 Enrofloxacin (Baytril), 25mg/mL oral solution Elanco N/A Iscove’s modified Dulbecco’s medium (IMDM, Gibco) Sigma-Aldrich Cat#12440053 Critical commercial assays Single Cell 3′ Library & Gel Bead Kit v3.1 10× Genomics Cat#PN-1000268 Chromium Next GEM Chip G Single Cell Kit v3.1 10× Genomics Cat#PN-1000127 Dual Index Kit TT Set A 10× Genomics Cat#PN-100215 Chromium Single Cell 3′ Reagent Kits User Guide 10× Genomics Manual part no. CG000315, revision D Avidin/Biotin Blocking Kit Vector Laboratories Cat# SP-2001 Reticulin silver plating kit (Gordon & Sweets) Merck Cat# 1002510001 Murine CD117 (c-Kit) MicroBeads Miltenyi Biotec Cat# 130-091-224 Fast SYBR Green Master Mix Applied Biosystems Cat#4385616 High-Capacity cDNA Reverse Transcription Kits Thermo Fisher Scientific Cat#4368814 Peroxidase substrate kit Vector Laboratories Cat#SK-4100 ABC-kit Vector Laboratories Cat#PK-6100 Mouse IL-1beta DuoSet ELISA R&D Systems Cat#DY401 Deposited data Human single-cell RNA-seq data Benabid et al., 2026 DOI: https://doi.org/10.5281/zenodo. .. 22688208 Human reference genome GRCh38/ GRCh38-2020-A 10× Genomics/Ensembl N/A UK Biobank cohort data UK Biobank https://www.ukbiobank.ac.uk/ Genome Reference Consortium Mouse Build 39 Genome Reference Consortium https://www.ncbi.nlm.nih.gov/datasets/ genome/GCF_000001635.27/ scRNAseq bone marrow ZsGreen in Gli1tdtomato recipient TPO mouse model singlets and doublets This paper GEO accession number: GSE347294 (https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSE347294) DOI: https://doi.org/10.5281/zenodo.

    Avidin-Biotin Assay:

    Article Title: NicheSphere reveals an Spp1-centered multicellular niche in myeloproliferative neoplasm-associated fibrosis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER anti-CD45.2, PE Biolegend BioLegend Cat# 109808, RRID:AB_313445 anti-CD150 (SLAM), PeCy7 Biolegend BioLegend Cat# 115914, RRID:AB_439797 anti-CD11b, APC Biolegend BioLegend Cat# 101212, RRID:AB_312795 anti-Ly6G/Ly-6C (Gr1), Alexa Fluor 700 Biolegend BioLegend Cat# 108422, RRID:AB_2137487 anti-CD3, PE Biolegend BioLegend Cat# 100206, RRID:AB_312663 anti-B220, eFluor450 eBioscience Thermo Fisher Scientific Cat# 48-0452-82, RRID:AB_1548761 anti-CD45.1, BV605 Biolegend BioLegend Cat# 110738, RRID:AB_2562565 anti-CD45.2, PerCp/Cy5.5 Biolegend BioLegend Cat# 109828, RRID:AB_893350 Hoechst solution 33342 BD Biosciences BD Biosciences Cat# 561908, RRID:AB_2869394 Calcein Green Invitrogen Cat# C34852 Anti-CD34-PE BD Biosciences Cat# 555822 Anti-CD45-APC BD Biosciences Cat# 555485 Anti-CD3-PerCpCy5.5 BD Biosciences Cat# 560835 Anti-CD19-BB700 BD Biosciences Cat# 566396 Anti-HLA-DR-PeCy7 BD Biosciences Cat# 560651 Anti-CD235a-Pacific Blue Biolegend Cat# 306612 Bacterial and virus strains Lentivirus: TPO-GFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-GFP (empty vector control) This paper N/A Lentivirus: TPO-BFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-BFP (empty vector control) This paper N/A pMIG William Hahn Addgene plasmid #9044 pRRL.PPT.SFFV.IRES2.EGFP.WPRE Axels Schambach, Dirk Heckl N/A MSCV-MPL-IRES-EGFP Ross L. Levine N/A pMSCV_ERHBD_Hoxb8 This paper N/A Biological samples Human bone marrow trephine biopsies, MF patients (pre-allo-HSCT) RWTH Aachen University N/A Human femoral heads, healthy donors (total hip arthroplasty) RWTH Aachen University N/A Chemicals, peptides, and recombinant proteins Liberase TL Roche Cat# 05401020001 DNase I Sigma-Aldrich Cat# DN25 Tween 20 Thermo Fisher Scientific Cat# 28360 BD PharmLyse BD Biosciences Cat#555899; RRID: AB_2869057 Recombinant human TGF-β1 PeproTech Cat# 100-21-10 Recombinant murine SCF (m-Scf) PeproTech Cat# 250-03 Recombinant murine TPO (m-Tpo) PeproTech Cat# 351-14 Recombinant murine mM-CSF PeproTech Cat# 300-25 Recombinant murine IL-6 PeproTech Cat# 216-16 Recombinant murine IL-1α PeproTech Cat# 211-11A Recombinant murine IL-1β PeproTech Cat# 211-11B Recombinant murine S100A8 Abnova Cat# P4345 (Continued on next page) e2 Cell Press Blue 2, 100146, January 25, 2027 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant murine SPP1 R&D Systems Cat# 441-OP Polybrene Merck Millipore Cat# TR-1003-G TransIT transfection reagent Mirus Bio Cat# MIR2700 DAB substrate Vector Laboratories Cat# SK-4100 Antibody storage buffer CANDOR Bioscience Cat# 131125 Eosin solution Sigma-Aldrich Cat#HT110116 Hematoxylin solution, Gill No. 2 Sigma-Aldrich Cat#GHS232 16% Paraformaldehyde, methanol free Thermo Fisher Scientific Cat#043368.9M StemSpan culture medium (SFEM) Stem Cell Technologies Cat# 09650 β-Estradiol Sigma-Aldrich Cat#5150-64-1 Fluoromount-6 ITK Diagnostics Cat#F3724 Enrofloxacin (Baytril), 25mg/mL oral solution Elanco N/A Iscove’s modified Dulbecco’s medium (IMDM, Gibco) Sigma-Aldrich Cat#12440053 Critical commercial assays Single Cell 3′ Library & Gel Bead Kit v3.1 10× Genomics Cat#PN-1000268 Chromium Next GEM Chip G Single Cell Kit v3.1 10× Genomics Cat#PN-1000127 Dual Index Kit TT Set A 10× Genomics Cat#PN-100215 Chromium Single Cell 3′ Reagent Kits User Guide 10× Genomics Manual part no. CG000315, revision D Avidin/Biotin Blocking Kit Vector Laboratories Cat# SP-2001 Reticulin silver plating kit (Gordon & Sweets) Merck Cat# 1002510001 Murine CD117 (c-Kit) MicroBeads Miltenyi Biotec Cat# 130-091-224 Fast SYBR Green Master Mix Applied Biosystems Cat#4385616 High-Capacity cDNA Reverse Transcription Kits Thermo Fisher Scientific Cat#4368814 Peroxidase substrate kit Vector Laboratories Cat#SK-4100 ABC-kit Vector Laboratories Cat#PK-6100 Mouse IL-1beta DuoSet ELISA R&D Systems Cat#DY401 Deposited data Human single-cell RNA-seq data Benabid et al., 2026 DOI: https://doi.org/10.5281/zenodo. .. 22688208 Human reference genome GRCh38/ GRCh38-2020-A 10× Genomics/Ensembl N/A UK Biobank cohort data UK Biobank https://www.ukbiobank.ac.uk/ Genome Reference Consortium Mouse Build 39 Genome Reference Consortium https://www.ncbi.nlm.nih.gov/datasets/ genome/GCF_000001635.27/ scRNAseq bone marrow ZsGreen in Gli1tdtomato recipient TPO mouse model singlets and doublets This paper GEO accession number: GSE347294 (https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSE347294) DOI: https://doi.org/10.5281/zenodo.

    Blocking Assay:

    Article Title: NicheSphere reveals an Spp1-centered multicellular niche in myeloproliferative neoplasm-associated fibrosis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER anti-CD45.2, PE Biolegend BioLegend Cat# 109808, RRID:AB_313445 anti-CD150 (SLAM), PeCy7 Biolegend BioLegend Cat# 115914, RRID:AB_439797 anti-CD11b, APC Biolegend BioLegend Cat# 101212, RRID:AB_312795 anti-Ly6G/Ly-6C (Gr1), Alexa Fluor 700 Biolegend BioLegend Cat# 108422, RRID:AB_2137487 anti-CD3, PE Biolegend BioLegend Cat# 100206, RRID:AB_312663 anti-B220, eFluor450 eBioscience Thermo Fisher Scientific Cat# 48-0452-82, RRID:AB_1548761 anti-CD45.1, BV605 Biolegend BioLegend Cat# 110738, RRID:AB_2562565 anti-CD45.2, PerCp/Cy5.5 Biolegend BioLegend Cat# 109828, RRID:AB_893350 Hoechst solution 33342 BD Biosciences BD Biosciences Cat# 561908, RRID:AB_2869394 Calcein Green Invitrogen Cat# C34852 Anti-CD34-PE BD Biosciences Cat# 555822 Anti-CD45-APC BD Biosciences Cat# 555485 Anti-CD3-PerCpCy5.5 BD Biosciences Cat# 560835 Anti-CD19-BB700 BD Biosciences Cat# 566396 Anti-HLA-DR-PeCy7 BD Biosciences Cat# 560651 Anti-CD235a-Pacific Blue Biolegend Cat# 306612 Bacterial and virus strains Lentivirus: TPO-GFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-GFP (empty vector control) This paper N/A Lentivirus: TPO-BFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-BFP (empty vector control) This paper N/A pMIG William Hahn Addgene plasmid #9044 pRRL.PPT.SFFV.IRES2.EGFP.WPRE Axels Schambach, Dirk Heckl N/A MSCV-MPL-IRES-EGFP Ross L. Levine N/A pMSCV_ERHBD_Hoxb8 This paper N/A Biological samples Human bone marrow trephine biopsies, MF patients (pre-allo-HSCT) RWTH Aachen University N/A Human femoral heads, healthy donors (total hip arthroplasty) RWTH Aachen University N/A Chemicals, peptides, and recombinant proteins Liberase TL Roche Cat# 05401020001 DNase I Sigma-Aldrich Cat# DN25 Tween 20 Thermo Fisher Scientific Cat# 28360 BD PharmLyse BD Biosciences Cat#555899; RRID: AB_2869057 Recombinant human TGF-β1 PeproTech Cat# 100-21-10 Recombinant murine SCF (m-Scf) PeproTech Cat# 250-03 Recombinant murine TPO (m-Tpo) PeproTech Cat# 351-14 Recombinant murine mM-CSF PeproTech Cat# 300-25 Recombinant murine IL-6 PeproTech Cat# 216-16 Recombinant murine IL-1α PeproTech Cat# 211-11A Recombinant murine IL-1β PeproTech Cat# 211-11B Recombinant murine S100A8 Abnova Cat# P4345 (Continued on next page) e2 Cell Press Blue 2, 100146, January 25, 2027 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant murine SPP1 R&D Systems Cat# 441-OP Polybrene Merck Millipore Cat# TR-1003-G TransIT transfection reagent Mirus Bio Cat# MIR2700 DAB substrate Vector Laboratories Cat# SK-4100 Antibody storage buffer CANDOR Bioscience Cat# 131125 Eosin solution Sigma-Aldrich Cat#HT110116 Hematoxylin solution, Gill No. 2 Sigma-Aldrich Cat#GHS232 16% Paraformaldehyde, methanol free Thermo Fisher Scientific Cat#043368.9M StemSpan culture medium (SFEM) Stem Cell Technologies Cat# 09650 β-Estradiol Sigma-Aldrich Cat#5150-64-1 Fluoromount-6 ITK Diagnostics Cat#F3724 Enrofloxacin (Baytril), 25mg/mL oral solution Elanco N/A Iscove’s modified Dulbecco’s medium (IMDM, Gibco) Sigma-Aldrich Cat#12440053 Critical commercial assays Single Cell 3′ Library & Gel Bead Kit v3.1 10× Genomics Cat#PN-1000268 Chromium Next GEM Chip G Single Cell Kit v3.1 10× Genomics Cat#PN-1000127 Dual Index Kit TT Set A 10× Genomics Cat#PN-100215 Chromium Single Cell 3′ Reagent Kits User Guide 10× Genomics Manual part no. CG000315, revision D Avidin/Biotin Blocking Kit Vector Laboratories Cat# SP-2001 Reticulin silver plating kit (Gordon & Sweets) Merck Cat# 1002510001 Murine CD117 (c-Kit) MicroBeads Miltenyi Biotec Cat# 130-091-224 Fast SYBR Green Master Mix Applied Biosystems Cat#4385616 High-Capacity cDNA Reverse Transcription Kits Thermo Fisher Scientific Cat#4368814 Peroxidase substrate kit Vector Laboratories Cat#SK-4100 ABC-kit Vector Laboratories Cat#PK-6100 Mouse IL-1beta DuoSet ELISA R&D Systems Cat#DY401 Deposited data Human single-cell RNA-seq data Benabid et al., 2026 DOI: https://doi.org/10.5281/zenodo. .. 22688208 Human reference genome GRCh38/ GRCh38-2020-A 10× Genomics/Ensembl N/A UK Biobank cohort data UK Biobank https://www.ukbiobank.ac.uk/ Genome Reference Consortium Mouse Build 39 Genome Reference Consortium https://www.ncbi.nlm.nih.gov/datasets/ genome/GCF_000001635.27/ scRNAseq bone marrow ZsGreen in Gli1tdtomato recipient TPO mouse model singlets and doublets This paper GEO accession number: GSE347294 (https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSE347294) DOI: https://doi.org/10.5281/zenodo.

    SYBR Green Assay:

    Article Title: NicheSphere reveals an Spp1-centered multicellular niche in myeloproliferative neoplasm-associated fibrosis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER anti-CD45.2, PE Biolegend BioLegend Cat# 109808, RRID:AB_313445 anti-CD150 (SLAM), PeCy7 Biolegend BioLegend Cat# 115914, RRID:AB_439797 anti-CD11b, APC Biolegend BioLegend Cat# 101212, RRID:AB_312795 anti-Ly6G/Ly-6C (Gr1), Alexa Fluor 700 Biolegend BioLegend Cat# 108422, RRID:AB_2137487 anti-CD3, PE Biolegend BioLegend Cat# 100206, RRID:AB_312663 anti-B220, eFluor450 eBioscience Thermo Fisher Scientific Cat# 48-0452-82, RRID:AB_1548761 anti-CD45.1, BV605 Biolegend BioLegend Cat# 110738, RRID:AB_2562565 anti-CD45.2, PerCp/Cy5.5 Biolegend BioLegend Cat# 109828, RRID:AB_893350 Hoechst solution 33342 BD Biosciences BD Biosciences Cat# 561908, RRID:AB_2869394 Calcein Green Invitrogen Cat# C34852 Anti-CD34-PE BD Biosciences Cat# 555822 Anti-CD45-APC BD Biosciences Cat# 555485 Anti-CD3-PerCpCy5.5 BD Biosciences Cat# 560835 Anti-CD19-BB700 BD Biosciences Cat# 566396 Anti-HLA-DR-PeCy7 BD Biosciences Cat# 560651 Anti-CD235a-Pacific Blue Biolegend Cat# 306612 Bacterial and virus strains Lentivirus: TPO-GFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-GFP (empty vector control) This paper N/A Lentivirus: TPO-BFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-BFP (empty vector control) This paper N/A pMIG William Hahn Addgene plasmid #9044 pRRL.PPT.SFFV.IRES2.EGFP.WPRE Axels Schambach, Dirk Heckl N/A MSCV-MPL-IRES-EGFP Ross L. Levine N/A pMSCV_ERHBD_Hoxb8 This paper N/A Biological samples Human bone marrow trephine biopsies, MF patients (pre-allo-HSCT) RWTH Aachen University N/A Human femoral heads, healthy donors (total hip arthroplasty) RWTH Aachen University N/A Chemicals, peptides, and recombinant proteins Liberase TL Roche Cat# 05401020001 DNase I Sigma-Aldrich Cat# DN25 Tween 20 Thermo Fisher Scientific Cat# 28360 BD PharmLyse BD Biosciences Cat#555899; RRID: AB_2869057 Recombinant human TGF-β1 PeproTech Cat# 100-21-10 Recombinant murine SCF (m-Scf) PeproTech Cat# 250-03 Recombinant murine TPO (m-Tpo) PeproTech Cat# 351-14 Recombinant murine mM-CSF PeproTech Cat# 300-25 Recombinant murine IL-6 PeproTech Cat# 216-16 Recombinant murine IL-1α PeproTech Cat# 211-11A Recombinant murine IL-1β PeproTech Cat# 211-11B Recombinant murine S100A8 Abnova Cat# P4345 (Continued on next page) e2 Cell Press Blue 2, 100146, January 25, 2027 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant murine SPP1 R&D Systems Cat# 441-OP Polybrene Merck Millipore Cat# TR-1003-G TransIT transfection reagent Mirus Bio Cat# MIR2700 DAB substrate Vector Laboratories Cat# SK-4100 Antibody storage buffer CANDOR Bioscience Cat# 131125 Eosin solution Sigma-Aldrich Cat#HT110116 Hematoxylin solution, Gill No. 2 Sigma-Aldrich Cat#GHS232 16% Paraformaldehyde, methanol free Thermo Fisher Scientific Cat#043368.9M StemSpan culture medium (SFEM) Stem Cell Technologies Cat# 09650 β-Estradiol Sigma-Aldrich Cat#5150-64-1 Fluoromount-6 ITK Diagnostics Cat#F3724 Enrofloxacin (Baytril), 25mg/mL oral solution Elanco N/A Iscove’s modified Dulbecco’s medium (IMDM, Gibco) Sigma-Aldrich Cat#12440053 Critical commercial assays Single Cell 3′ Library & Gel Bead Kit v3.1 10× Genomics Cat#PN-1000268 Chromium Next GEM Chip G Single Cell Kit v3.1 10× Genomics Cat#PN-1000127 Dual Index Kit TT Set A 10× Genomics Cat#PN-100215 Chromium Single Cell 3′ Reagent Kits User Guide 10× Genomics Manual part no. CG000315, revision D Avidin/Biotin Blocking Kit Vector Laboratories Cat# SP-2001 Reticulin silver plating kit (Gordon & Sweets) Merck Cat# 1002510001 Murine CD117 (c-Kit) MicroBeads Miltenyi Biotec Cat# 130-091-224 Fast SYBR Green Master Mix Applied Biosystems Cat#4385616 High-Capacity cDNA Reverse Transcription Kits Thermo Fisher Scientific Cat#4368814 Peroxidase substrate kit Vector Laboratories Cat#SK-4100 ABC-kit Vector Laboratories Cat#PK-6100 Mouse IL-1beta DuoSet ELISA R&D Systems Cat#DY401 Deposited data Human single-cell RNA-seq data Benabid et al., 2026 DOI: https://doi.org/10.5281/zenodo. .. 22688208 Human reference genome GRCh38/ GRCh38-2020-A 10× Genomics/Ensembl N/A UK Biobank cohort data UK Biobank https://www.ukbiobank.ac.uk/ Genome Reference Consortium Mouse Build 39 Genome Reference Consortium https://www.ncbi.nlm.nih.gov/datasets/ genome/GCF_000001635.27/ scRNAseq bone marrow ZsGreen in Gli1tdtomato recipient TPO mouse model singlets and doublets This paper GEO accession number: GSE347294 (https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSE347294) DOI: https://doi.org/10.5281/zenodo.

    Reverse Transcription:

    Article Title: NicheSphere reveals an Spp1-centered multicellular niche in myeloproliferative neoplasm-associated fibrosis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER anti-CD45.2, PE Biolegend BioLegend Cat# 109808, RRID:AB_313445 anti-CD150 (SLAM), PeCy7 Biolegend BioLegend Cat# 115914, RRID:AB_439797 anti-CD11b, APC Biolegend BioLegend Cat# 101212, RRID:AB_312795 anti-Ly6G/Ly-6C (Gr1), Alexa Fluor 700 Biolegend BioLegend Cat# 108422, RRID:AB_2137487 anti-CD3, PE Biolegend BioLegend Cat# 100206, RRID:AB_312663 anti-B220, eFluor450 eBioscience Thermo Fisher Scientific Cat# 48-0452-82, RRID:AB_1548761 anti-CD45.1, BV605 Biolegend BioLegend Cat# 110738, RRID:AB_2562565 anti-CD45.2, PerCp/Cy5.5 Biolegend BioLegend Cat# 109828, RRID:AB_893350 Hoechst solution 33342 BD Biosciences BD Biosciences Cat# 561908, RRID:AB_2869394 Calcein Green Invitrogen Cat# C34852 Anti-CD34-PE BD Biosciences Cat# 555822 Anti-CD45-APC BD Biosciences Cat# 555485 Anti-CD3-PerCpCy5.5 BD Biosciences Cat# 560835 Anti-CD19-BB700 BD Biosciences Cat# 566396 Anti-HLA-DR-PeCy7 BD Biosciences Cat# 560651 Anti-CD235a-Pacific Blue Biolegend Cat# 306612 Bacterial and virus strains Lentivirus: TPO-GFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-GFP (empty vector control) This paper N/A Lentivirus: TPO-BFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-BFP (empty vector control) This paper N/A pMIG William Hahn Addgene plasmid #9044 pRRL.PPT.SFFV.IRES2.EGFP.WPRE Axels Schambach, Dirk Heckl N/A MSCV-MPL-IRES-EGFP Ross L. Levine N/A pMSCV_ERHBD_Hoxb8 This paper N/A Biological samples Human bone marrow trephine biopsies, MF patients (pre-allo-HSCT) RWTH Aachen University N/A Human femoral heads, healthy donors (total hip arthroplasty) RWTH Aachen University N/A Chemicals, peptides, and recombinant proteins Liberase TL Roche Cat# 05401020001 DNase I Sigma-Aldrich Cat# DN25 Tween 20 Thermo Fisher Scientific Cat# 28360 BD PharmLyse BD Biosciences Cat#555899; RRID: AB_2869057 Recombinant human TGF-β1 PeproTech Cat# 100-21-10 Recombinant murine SCF (m-Scf) PeproTech Cat# 250-03 Recombinant murine TPO (m-Tpo) PeproTech Cat# 351-14 Recombinant murine mM-CSF PeproTech Cat# 300-25 Recombinant murine IL-6 PeproTech Cat# 216-16 Recombinant murine IL-1α PeproTech Cat# 211-11A Recombinant murine IL-1β PeproTech Cat# 211-11B Recombinant murine S100A8 Abnova Cat# P4345 (Continued on next page) e2 Cell Press Blue 2, 100146, January 25, 2027 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant murine SPP1 R&D Systems Cat# 441-OP Polybrene Merck Millipore Cat# TR-1003-G TransIT transfection reagent Mirus Bio Cat# MIR2700 DAB substrate Vector Laboratories Cat# SK-4100 Antibody storage buffer CANDOR Bioscience Cat# 131125 Eosin solution Sigma-Aldrich Cat#HT110116 Hematoxylin solution, Gill No. 2 Sigma-Aldrich Cat#GHS232 16% Paraformaldehyde, methanol free Thermo Fisher Scientific Cat#043368.9M StemSpan culture medium (SFEM) Stem Cell Technologies Cat# 09650 β-Estradiol Sigma-Aldrich Cat#5150-64-1 Fluoromount-6 ITK Diagnostics Cat#F3724 Enrofloxacin (Baytril), 25mg/mL oral solution Elanco N/A Iscove’s modified Dulbecco’s medium (IMDM, Gibco) Sigma-Aldrich Cat#12440053 Critical commercial assays Single Cell 3′ Library & Gel Bead Kit v3.1 10× Genomics Cat#PN-1000268 Chromium Next GEM Chip G Single Cell Kit v3.1 10× Genomics Cat#PN-1000127 Dual Index Kit TT Set A 10× Genomics Cat#PN-100215 Chromium Single Cell 3′ Reagent Kits User Guide 10× Genomics Manual part no. CG000315, revision D Avidin/Biotin Blocking Kit Vector Laboratories Cat# SP-2001 Reticulin silver plating kit (Gordon & Sweets) Merck Cat# 1002510001 Murine CD117 (c-Kit) MicroBeads Miltenyi Biotec Cat# 130-091-224 Fast SYBR Green Master Mix Applied Biosystems Cat#4385616 High-Capacity cDNA Reverse Transcription Kits Thermo Fisher Scientific Cat#4368814 Peroxidase substrate kit Vector Laboratories Cat#SK-4100 ABC-kit Vector Laboratories Cat#PK-6100 Mouse IL-1beta DuoSet ELISA R&D Systems Cat#DY401 Deposited data Human single-cell RNA-seq data Benabid et al., 2026 DOI: https://doi.org/10.5281/zenodo. .. 22688208 Human reference genome GRCh38/ GRCh38-2020-A 10× Genomics/Ensembl N/A UK Biobank cohort data UK Biobank https://www.ukbiobank.ac.uk/ Genome Reference Consortium Mouse Build 39 Genome Reference Consortium https://www.ncbi.nlm.nih.gov/datasets/ genome/GCF_000001635.27/ scRNAseq bone marrow ZsGreen in Gli1tdtomato recipient TPO mouse model singlets and doublets This paper GEO accession number: GSE347294 (https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSE347294) DOI: https://doi.org/10.5281/zenodo.

    Enzyme-linked Immunosorbent Assay:

    Article Title: NicheSphere reveals an Spp1-centered multicellular niche in myeloproliferative neoplasm-associated fibrosis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER anti-CD45.2, PE Biolegend BioLegend Cat# 109808, RRID:AB_313445 anti-CD150 (SLAM), PeCy7 Biolegend BioLegend Cat# 115914, RRID:AB_439797 anti-CD11b, APC Biolegend BioLegend Cat# 101212, RRID:AB_312795 anti-Ly6G/Ly-6C (Gr1), Alexa Fluor 700 Biolegend BioLegend Cat# 108422, RRID:AB_2137487 anti-CD3, PE Biolegend BioLegend Cat# 100206, RRID:AB_312663 anti-B220, eFluor450 eBioscience Thermo Fisher Scientific Cat# 48-0452-82, RRID:AB_1548761 anti-CD45.1, BV605 Biolegend BioLegend Cat# 110738, RRID:AB_2562565 anti-CD45.2, PerCp/Cy5.5 Biolegend BioLegend Cat# 109828, RRID:AB_893350 Hoechst solution 33342 BD Biosciences BD Biosciences Cat# 561908, RRID:AB_2869394 Calcein Green Invitrogen Cat# C34852 Anti-CD34-PE BD Biosciences Cat# 555822 Anti-CD45-APC BD Biosciences Cat# 555485 Anti-CD3-PerCpCy5.5 BD Biosciences Cat# 560835 Anti-CD19-BB700 BD Biosciences Cat# 566396 Anti-HLA-DR-PeCy7 BD Biosciences Cat# 560651 Anti-CD235a-Pacific Blue Biolegend Cat# 306612 Bacterial and virus strains Lentivirus: TPO-GFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-GFP (empty vector control) This paper N/A Lentivirus: TPO-BFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-BFP (empty vector control) This paper N/A pMIG William Hahn Addgene plasmid #9044 pRRL.PPT.SFFV.IRES2.EGFP.WPRE Axels Schambach, Dirk Heckl N/A MSCV-MPL-IRES-EGFP Ross L. Levine N/A pMSCV_ERHBD_Hoxb8 This paper N/A Biological samples Human bone marrow trephine biopsies, MF patients (pre-allo-HSCT) RWTH Aachen University N/A Human femoral heads, healthy donors (total hip arthroplasty) RWTH Aachen University N/A Chemicals, peptides, and recombinant proteins Liberase TL Roche Cat# 05401020001 DNase I Sigma-Aldrich Cat# DN25 Tween 20 Thermo Fisher Scientific Cat# 28360 BD PharmLyse BD Biosciences Cat#555899; RRID: AB_2869057 Recombinant human TGF-β1 PeproTech Cat# 100-21-10 Recombinant murine SCF (m-Scf) PeproTech Cat# 250-03 Recombinant murine TPO (m-Tpo) PeproTech Cat# 351-14 Recombinant murine mM-CSF PeproTech Cat# 300-25 Recombinant murine IL-6 PeproTech Cat# 216-16 Recombinant murine IL-1α PeproTech Cat# 211-11A Recombinant murine IL-1β PeproTech Cat# 211-11B Recombinant murine S100A8 Abnova Cat# P4345 (Continued on next page) e2 Cell Press Blue 2, 100146, January 25, 2027 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant murine SPP1 R&D Systems Cat# 441-OP Polybrene Merck Millipore Cat# TR-1003-G TransIT transfection reagent Mirus Bio Cat# MIR2700 DAB substrate Vector Laboratories Cat# SK-4100 Antibody storage buffer CANDOR Bioscience Cat# 131125 Eosin solution Sigma-Aldrich Cat#HT110116 Hematoxylin solution, Gill No. 2 Sigma-Aldrich Cat#GHS232 16% Paraformaldehyde, methanol free Thermo Fisher Scientific Cat#043368.9M StemSpan culture medium (SFEM) Stem Cell Technologies Cat# 09650 β-Estradiol Sigma-Aldrich Cat#5150-64-1 Fluoromount-6 ITK Diagnostics Cat#F3724 Enrofloxacin (Baytril), 25mg/mL oral solution Elanco N/A Iscove’s modified Dulbecco’s medium (IMDM, Gibco) Sigma-Aldrich Cat#12440053 Critical commercial assays Single Cell 3′ Library & Gel Bead Kit v3.1 10× Genomics Cat#PN-1000268 Chromium Next GEM Chip G Single Cell Kit v3.1 10× Genomics Cat#PN-1000127 Dual Index Kit TT Set A 10× Genomics Cat#PN-100215 Chromium Single Cell 3′ Reagent Kits User Guide 10× Genomics Manual part no. CG000315, revision D Avidin/Biotin Blocking Kit Vector Laboratories Cat# SP-2001 Reticulin silver plating kit (Gordon & Sweets) Merck Cat# 1002510001 Murine CD117 (c-Kit) MicroBeads Miltenyi Biotec Cat# 130-091-224 Fast SYBR Green Master Mix Applied Biosystems Cat#4385616 High-Capacity cDNA Reverse Transcription Kits Thermo Fisher Scientific Cat#4368814 Peroxidase substrate kit Vector Laboratories Cat#SK-4100 ABC-kit Vector Laboratories Cat#PK-6100 Mouse IL-1beta DuoSet ELISA R&D Systems Cat#DY401 Deposited data Human single-cell RNA-seq data Benabid et al., 2026 DOI: https://doi.org/10.5281/zenodo. .. 22688208 Human reference genome GRCh38/ GRCh38-2020-A 10× Genomics/Ensembl N/A UK Biobank cohort data UK Biobank https://www.ukbiobank.ac.uk/ Genome Reference Consortium Mouse Build 39 Genome Reference Consortium https://www.ncbi.nlm.nih.gov/datasets/ genome/GCF_000001635.27/ scRNAseq bone marrow ZsGreen in Gli1tdtomato recipient TPO mouse model singlets and doublets This paper GEO accession number: GSE347294 (https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSE347294) DOI: https://doi.org/10.5281/zenodo.

    RNA Sequencing:

    Article Title: NicheSphere reveals an Spp1-centered multicellular niche in myeloproliferative neoplasm-associated fibrosis
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER anti-CD45.2, PE Biolegend BioLegend Cat# 109808, RRID:AB_313445 anti-CD150 (SLAM), PeCy7 Biolegend BioLegend Cat# 115914, RRID:AB_439797 anti-CD11b, APC Biolegend BioLegend Cat# 101212, RRID:AB_312795 anti-Ly6G/Ly-6C (Gr1), Alexa Fluor 700 Biolegend BioLegend Cat# 108422, RRID:AB_2137487 anti-CD3, PE Biolegend BioLegend Cat# 100206, RRID:AB_312663 anti-B220, eFluor450 eBioscience Thermo Fisher Scientific Cat# 48-0452-82, RRID:AB_1548761 anti-CD45.1, BV605 Biolegend BioLegend Cat# 110738, RRID:AB_2562565 anti-CD45.2, PerCp/Cy5.5 Biolegend BioLegend Cat# 109828, RRID:AB_893350 Hoechst solution 33342 BD Biosciences BD Biosciences Cat# 561908, RRID:AB_2869394 Calcein Green Invitrogen Cat# C34852 Anti-CD34-PE BD Biosciences Cat# 555822 Anti-CD45-APC BD Biosciences Cat# 555485 Anti-CD3-PerCpCy5.5 BD Biosciences Cat# 560835 Anti-CD19-BB700 BD Biosciences Cat# 566396 Anti-HLA-DR-PeCy7 BD Biosciences Cat# 560651 Anti-CD235a-Pacific Blue Biolegend Cat# 306612 Bacterial and virus strains Lentivirus: TPO-GFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-GFP (empty vector control) This paper N/A Lentivirus: TPO-BFP (thrombopoietin overexpression) This paper N/A Lentivirus: EV-BFP (empty vector control) This paper N/A pMIG William Hahn Addgene plasmid #9044 pRRL.PPT.SFFV.IRES2.EGFP.WPRE Axels Schambach, Dirk Heckl N/A MSCV-MPL-IRES-EGFP Ross L. Levine N/A pMSCV_ERHBD_Hoxb8 This paper N/A Biological samples Human bone marrow trephine biopsies, MF patients (pre-allo-HSCT) RWTH Aachen University N/A Human femoral heads, healthy donors (total hip arthroplasty) RWTH Aachen University N/A Chemicals, peptides, and recombinant proteins Liberase TL Roche Cat# 05401020001 DNase I Sigma-Aldrich Cat# DN25 Tween 20 Thermo Fisher Scientific Cat# 28360 BD PharmLyse BD Biosciences Cat#555899; RRID: AB_2869057 Recombinant human TGF-β1 PeproTech Cat# 100-21-10 Recombinant murine SCF (m-Scf) PeproTech Cat# 250-03 Recombinant murine TPO (m-Tpo) PeproTech Cat# 351-14 Recombinant murine mM-CSF PeproTech Cat# 300-25 Recombinant murine IL-6 PeproTech Cat# 216-16 Recombinant murine IL-1α PeproTech Cat# 211-11A Recombinant murine IL-1β PeproTech Cat# 211-11B Recombinant murine S100A8 Abnova Cat# P4345 (Continued on next page) e2 Cell Press Blue 2, 100146, January 25, 2027 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant murine SPP1 R&D Systems Cat# 441-OP Polybrene Merck Millipore Cat# TR-1003-G TransIT transfection reagent Mirus Bio Cat# MIR2700 DAB substrate Vector Laboratories Cat# SK-4100 Antibody storage buffer CANDOR Bioscience Cat# 131125 Eosin solution Sigma-Aldrich Cat#HT110116 Hematoxylin solution, Gill No. 2 Sigma-Aldrich Cat#GHS232 16% Paraformaldehyde, methanol free Thermo Fisher Scientific Cat#043368.9M StemSpan culture medium (SFEM) Stem Cell Technologies Cat# 09650 β-Estradiol Sigma-Aldrich Cat#5150-64-1 Fluoromount-6 ITK Diagnostics Cat#F3724 Enrofloxacin (Baytril), 25mg/mL oral solution Elanco N/A Iscove’s modified Dulbecco’s medium (IMDM, Gibco) Sigma-Aldrich Cat#12440053 Critical commercial assays Single Cell 3′ Library & Gel Bead Kit v3.1 10× Genomics Cat#PN-1000268 Chromium Next GEM Chip G Single Cell Kit v3.1 10× Genomics Cat#PN-1000127 Dual Index Kit TT Set A 10× Genomics Cat#PN-100215 Chromium Single Cell 3′ Reagent Kits User Guide 10× Genomics Manual part no. CG000315, revision D Avidin/Biotin Blocking Kit Vector Laboratories Cat# SP-2001 Reticulin silver plating kit (Gordon & Sweets) Merck Cat# 1002510001 Murine CD117 (c-Kit) MicroBeads Miltenyi Biotec Cat# 130-091-224 Fast SYBR Green Master Mix Applied Biosystems Cat#4385616 High-Capacity cDNA Reverse Transcription Kits Thermo Fisher Scientific Cat#4368814 Peroxidase substrate kit Vector Laboratories Cat#SK-4100 ABC-kit Vector Laboratories Cat#PK-6100 Mouse IL-1beta DuoSet ELISA R&D Systems Cat#DY401 Deposited data Human single-cell RNA-seq data Benabid et al., 2026 DOI: https://doi.org/10.5281/zenodo. .. 22688208 Human reference genome GRCh38/ GRCh38-2020-A 10× Genomics/Ensembl N/A UK Biobank cohort data UK Biobank https://www.ukbiobank.ac.uk/ Genome Reference Consortium Mouse Build 39 Genome Reference Consortium https://www.ncbi.nlm.nih.gov/datasets/ genome/GCF_000001635.27/ scRNAseq bone marrow ZsGreen in Gli1tdtomato recipient TPO mouse model singlets and doublets This paper GEO accession number: GSE347294 (https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSE347294) DOI: https://doi.org/10.5281/zenodo.

    Virus:

    Article Title: Cell-type-specific repression reveals MC4R neurons as a site of action for ciliary obesity genes.
    Article Snippet: AAV DJ preparation AAV DJ used in adult stereotaxic injections was produced in AAVpro cells (Takara, 632273, passage number less than 10) maintained in complete DMEM [DMEM (Gibco, 11995065) supplemented with 10% FBS (Gibco, A5670801) and 1% penicillin– streptomycin (Sigma-Aldrich, P4333)]. .. Cells were seeded at 2.5 × 107 cells per 15-cm dish (two dishes per virus) and transfected 24 h later with 20 μg each of pHelper (Takara), pRC DJ [88], and AAV sgRNA plasmids using 120 μl TransIT-293 reagent (Mirus, 2700) in 4 mL Opti-MEM (Gibco, 31985-070). ..

    Bioprocessing:

    Article Title: Cell-type-specific repression reveals MC4R neurons as a site of action for ciliary obesity genes.
    Article Snippet: AAV DJ preparation AAV DJ used in adult stereotaxic injections was produced in AAVpro cells (Takara, 632273, passage number less than 10) maintained in complete DMEM [DMEM (Gibco, 11995065) supplemented with 10% FBS (Gibco, A5670801) and 1% penicillin– streptomycin (Sigma-Aldrich, P4333)]. .. Cells were seeded at 2.5 × 107 cells per 15-cm dish (two dishes per virus) and transfected 24 h later with 20 μg each of pHelper (Takara), pRC DJ [88], and AAV sgRNA plasmids using 120 μl TransIT-293 reagent (Mirus, 2700) in 4 mL Opti-MEM (Gibco, 31985-070). ..

    Control:

    Article Title: A massively parallel reporter assay of MECP2cis-regulatory elements reveals genetic candidates for male-biased autism.
    Article Snippet: .. After 24 h, transfection was performed using 0.063 pmol firefly construct, 0.063 4 The American Journal of Human Genetics 113, 1–18, November 5, 2026 pmol Renilla control (Addgene 106292), 108 ng pMD2.G (Addgene 12259), and 325 ng psPAX2 (Addgene 12260), with TransIT293 Transfection Reagent (Mirus Bio 2704) and OptiMEM (Thermo Fisher Scientific 31985062). .. After 48 h, 400 μL supernatant was collected and centrifuged at room temperature for 10 min at 500 × g. 300 μL supernatant was then combined with 100 μL Lenti-X Concentrator (Takara 631231) and chilled at 4◦C overnight.



    Similar Products

    confluency  (MedChemExpress)
    94
    MedChemExpress confluency
    Confluency, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/confluency/IL-18%2C+Rat/pm42854813-65-9-19
    Average 94 stars, based on 1 article reviews
    confluency - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier
    cell confluence  (Yeasen Biotechnology)
    86
    Yeasen Biotechnology cell confluence
    Cell Confluence, supplied by Yeasen Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/confluency/cell+confluence/pm42268903-55-1-16
    Average 86 stars, based on 1 article reviews
    cell confluence - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    confluency  (Ontores Biotechnologies Inc)
    86
    Ontores Biotechnologies Inc confluency
    Confluency, supplied by Ontores Biotechnologies Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/confluency/confluency/pmc13132798-39-3-8
    Average 86 stars, based on 1 article reviews
    confluency - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    cell confluence  (Sartorius AG)
    99
    Sartorius AG cell confluence
    Cell Confluence, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/confluency/Live+Cell+Analysis+Instruments/pm42055283-96-11-20
    Average 99 stars, based on 1 article reviews
    cell confluence - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    maximum confluency  (Sartorius AG)
    99
    Sartorius AG maximum confluency
    Maximum Confluency, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/confluency/Live+Cell+Analysis+Instruments/pm42032042-37-50-46
    Average 99 stars, based on 1 article reviews
    maximum confluency - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    confluency  (Sartorius AG)
    99
    Sartorius AG confluency
    ( a) LC-MS of His levels in NMG (n = 7) and MMTV-c- Myc (n = 10) tumours after a 5 min [U 13 C]His bolus. Total abundance (left) and isotopologue distribution (right). Mean ± s.d.; p -values from two-way ANOVA (Šídák’s correction). ( b) Timeline: cells cultured in 2.0 or 0.1 mM Gln (24 h) before 20-min [U 13 C]His administration. ( c) Total relative His abundance (n = 3). Data are mean ± s.d.; p -values from two-way ANOVA (Šídák’s correction). ( d ) RT-qPCR of indicated genes expression in cells cultures in 2.0 mM or 0.1 mM Gln (n = 3), normalized to β-actin and expressed relative to 2.0 mM Gln. Mean ± s.d.; p -values from one-way ANOVA (Šídák’s correction). ( e,f ) WB of cells in 2.0 mM or 0.1 mM Gln (24 h), n = 3; in ( f ) MMTV-c- Myc tumour and liver tissue are used as controls. ( g ) Relative <t>confluency</t> of cells in 0-2.0 mM Gln (96 h), normalized to 2.0 mM Gln; IC50 values from non-linear fit of log[Gln] vs. normalized response (n = 2). ( h ) LC-MS of cells in 2.0 mM or 0.1 mM Gln (24 h), followed by a 10 min [U 13 C]His pulse (n = 3). Labelled His abundance is relative to 2.0 mM Gln. Mean ± s.d.; p -values from one-way ANOVA (Šídák’s correction). See also Figure S2.
    Confluency, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/confluency/Live+Cell+Analysis+Instruments/bio_rxiv__64898__2026__04__15__716193-282-14-22
    Average 99 stars, based on 1 article reviews
    confluency - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    confluency  (Mirus Bio)
    97
    Mirus Bio confluency
    ( A ) Expression profiles of indicated cell-cycle genes across cell-cycle pseudotime determined by tricycle. ( B ) Percentage of cells in each cell-cycle phase in Tfam , Opa1 , Polg KO cells, post-Mixscape, compared to non-targeting gRNA cells. Chi-squared tests with multiple testing correction (Bonferroni); ns, not significant. ( C ) Schematic showing the expression patterns of the PIP-FUCCI fluorescent reporters Cdt1-mVenus and Geminin-mCherry across the cell-cycle. ( D,E ) Gating strategies used to isolate cells for mtDNA CN measurements based on cell-cycle phase for both inter-phase ( D ) and intra-phase ( E ) comparisons. ( F,G ) Western blot ( F ) and ddPCR measurements ( G ) showing KD of TFAM protein ( F ) and reduced mtDNA CN ( G ) in HeLa cells transduced with two independent TFAM gRNAs. Vinculin is shown as a loading control ( F ). Number of individual cells per group is indicated in ( G ), data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test, **** p < 0.0001. ( H ) Map of the human mtDNA, highlighting the 7.5 Kb deletion present in the DeltaH2.1 cybrid cell line. ( I,J ) mtDNA CN ( I ) and heteroplasmy ( J ) of eight clonal populations isolated from the DeltaH2.1 cybrid cell line. Cell numbers per group indicated on graphs. Data presented as mean values +/- SD. One-way ANOVA of the mtDNA CN distributions was significant (p = 0.015); pairwise comparisons of all heteroplasmic clones to Clone 25 (0% heteroplasmy) using Tukey’s post-hoc test; ns, not significant. ( K ) Respirometry of DeltaH2.1 cybrid cells with increasing heteroplasmy levels, using Oroboros, showing baseline respiration (BR), proton-leak (PL), ATP-linked respiration (AR) and maximal respiratory capacity (MC). Three separate assays per clone. Data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test performed for each tested parameter, all significant pairwise comparisons are shown. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. ( L,M ) Growth curves of DeltaH2.1 cybrid clones carrying different levels of heteroplasmy in high ( L ) and low ( M ) glucose culture medium. <t>Confluency</t> values averaged over 8 individual images per timepoint for each clone in each condition, data presented as mean values ± SEM. Figure created in BioRender. Van den Ameele, J. (2026) https://BioRender.com/j3ro7vq .
    Confluency, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/confluency/TransIT+-293/pmc13095666-271-7-12
    Average 97 stars, based on 1 article reviews
    confluency - by Bioz Stars, 2026-11
    97/100 stars
    		  Buy from Supplier

    Image Search Results


    ( a) LC-MS of His levels in NMG (n = 7) and MMTV-c- Myc (n = 10) tumours after a 5 min [U 13 C]His bolus. Total abundance (left) and isotopologue distribution (right). Mean ± s.d.; p -values from two-way ANOVA (Šídák’s correction). ( b) Timeline: cells cultured in 2.0 or 0.1 mM Gln (24 h) before 20-min [U 13 C]His administration. ( c) Total relative His abundance (n = 3). Data are mean ± s.d.; p -values from two-way ANOVA (Šídák’s correction). ( d ) RT-qPCR of indicated genes expression in cells cultures in 2.0 mM or 0.1 mM Gln (n = 3), normalized to β-actin and expressed relative to 2.0 mM Gln. Mean ± s.d.; p -values from one-way ANOVA (Šídák’s correction). ( e,f ) WB of cells in 2.0 mM or 0.1 mM Gln (24 h), n = 3; in ( f ) MMTV-c- Myc tumour and liver tissue are used as controls. ( g ) Relative confluency of cells in 0-2.0 mM Gln (96 h), normalized to 2.0 mM Gln; IC50 values from non-linear fit of log[Gln] vs. normalized response (n = 2). ( h ) LC-MS of cells in 2.0 mM or 0.1 mM Gln (24 h), followed by a 10 min [U 13 C]His pulse (n = 3). Labelled His abundance is relative to 2.0 mM Gln. Mean ± s.d.; p -values from one-way ANOVA (Šídák’s correction). See also Figure S2.

    Journal: bioRxiv

    Article Title: Histidine exchange sustains LAT1 activity and proliferation in glutamine-addicted breast cancers

    doi: 10.64898/2026.04.15.716193

    Figure Lengend Snippet: ( a) LC-MS of His levels in NMG (n = 7) and MMTV-c- Myc (n = 10) tumours after a 5 min [U 13 C]His bolus. Total abundance (left) and isotopologue distribution (right). Mean ± s.d.; p -values from two-way ANOVA (Šídák’s correction). ( b) Timeline: cells cultured in 2.0 or 0.1 mM Gln (24 h) before 20-min [U 13 C]His administration. ( c) Total relative His abundance (n = 3). Data are mean ± s.d.; p -values from two-way ANOVA (Šídák’s correction). ( d ) RT-qPCR of indicated genes expression in cells cultures in 2.0 mM or 0.1 mM Gln (n = 3), normalized to β-actin and expressed relative to 2.0 mM Gln. Mean ± s.d.; p -values from one-way ANOVA (Šídák’s correction). ( e,f ) WB of cells in 2.0 mM or 0.1 mM Gln (24 h), n = 3; in ( f ) MMTV-c- Myc tumour and liver tissue are used as controls. ( g ) Relative confluency of cells in 0-2.0 mM Gln (96 h), normalized to 2.0 mM Gln; IC50 values from non-linear fit of log[Gln] vs. normalized response (n = 2). ( h ) LC-MS of cells in 2.0 mM or 0.1 mM Gln (24 h), followed by a 10 min [U 13 C]His pulse (n = 3). Labelled His abundance is relative to 2.0 mM Gln. Mean ± s.d.; p -values from one-way ANOVA (Šídák’s correction). See also Figure S2.

    Article Snippet: Cells were imaged at regular intervals using the Incucyte ® live-cell imaging system, and confluency was quantified using the Incucyte S3 Software (Sartorius v.2021C).

    Techniques: Liquid Chromatography with Mass Spectroscopy, Cell Culture, Quantitative RT-PCR, Expressing

    ( a,b ) WB of replenished cells after amino acid starvation with ( a ) 1.6 mM His ( n = 3) or ( b ) 1.6 mM D-His (n = 2) for 48 h. Protein levels are normalized to mTOR/Vinc and expressed relative to the maximum. ( c ) WB of puromycin incorporation in cells starved or preloaded with 0.12 mM or 1.6 mM His (48 h), then replenished with DMEM. Protein levels normalized to Ponceau and expressed relative to the maximum. A representative of 2 independent replicates. ( b) Time-course of relative abundance of intracellular Leu (left) and Met (right) in DMEM-replenished cells after His preloading (1.6 mM, 48 h). 0 min represents pre-replenishment levels. Mean ± s.d.; p -value from two-way ANOVA (Šídák’’s correction). ( e ) Confluency of DMEM-replenished cells preloaded with His, normalized to pre-replenishment confluency (n = 3). Gompertz growth curve applied. Mean ± s.d.; p- values from two -way ANOVA (Dunnett correction). See also Figure S5.

    Journal: bioRxiv

    Article Title: Histidine exchange sustains LAT1 activity and proliferation in glutamine-addicted breast cancers

    doi: 10.64898/2026.04.15.716193

    Figure Lengend Snippet: ( a,b ) WB of replenished cells after amino acid starvation with ( a ) 1.6 mM His ( n = 3) or ( b ) 1.6 mM D-His (n = 2) for 48 h. Protein levels are normalized to mTOR/Vinc and expressed relative to the maximum. ( c ) WB of puromycin incorporation in cells starved or preloaded with 0.12 mM or 1.6 mM His (48 h), then replenished with DMEM. Protein levels normalized to Ponceau and expressed relative to the maximum. A representative of 2 independent replicates. ( b) Time-course of relative abundance of intracellular Leu (left) and Met (right) in DMEM-replenished cells after His preloading (1.6 mM, 48 h). 0 min represents pre-replenishment levels. Mean ± s.d.; p -value from two-way ANOVA (Šídák’’s correction). ( e ) Confluency of DMEM-replenished cells preloaded with His, normalized to pre-replenishment confluency (n = 3). Gompertz growth curve applied. Mean ± s.d.; p- values from two -way ANOVA (Dunnett correction). See also Figure S5.

    Article Snippet: Cells were imaged at regular intervals using the Incucyte ® live-cell imaging system, and confluency was quantified using the Incucyte S3 Software (Sartorius v.2021C).

    Techniques:

    ( A ) Expression profiles of indicated cell-cycle genes across cell-cycle pseudotime determined by tricycle. ( B ) Percentage of cells in each cell-cycle phase in Tfam , Opa1 , Polg KO cells, post-Mixscape, compared to non-targeting gRNA cells. Chi-squared tests with multiple testing correction (Bonferroni); ns, not significant. ( C ) Schematic showing the expression patterns of the PIP-FUCCI fluorescent reporters Cdt1-mVenus and Geminin-mCherry across the cell-cycle. ( D,E ) Gating strategies used to isolate cells for mtDNA CN measurements based on cell-cycle phase for both inter-phase ( D ) and intra-phase ( E ) comparisons. ( F,G ) Western blot ( F ) and ddPCR measurements ( G ) showing KD of TFAM protein ( F ) and reduced mtDNA CN ( G ) in HeLa cells transduced with two independent TFAM gRNAs. Vinculin is shown as a loading control ( F ). Number of individual cells per group is indicated in ( G ), data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test, **** p < 0.0001. ( H ) Map of the human mtDNA, highlighting the 7.5 Kb deletion present in the DeltaH2.1 cybrid cell line. ( I,J ) mtDNA CN ( I ) and heteroplasmy ( J ) of eight clonal populations isolated from the DeltaH2.1 cybrid cell line. Cell numbers per group indicated on graphs. Data presented as mean values +/- SD. One-way ANOVA of the mtDNA CN distributions was significant (p = 0.015); pairwise comparisons of all heteroplasmic clones to Clone 25 (0% heteroplasmy) using Tukey’s post-hoc test; ns, not significant. ( K ) Respirometry of DeltaH2.1 cybrid cells with increasing heteroplasmy levels, using Oroboros, showing baseline respiration (BR), proton-leak (PL), ATP-linked respiration (AR) and maximal respiratory capacity (MC). Three separate assays per clone. Data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test performed for each tested parameter, all significant pairwise comparisons are shown. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. ( L,M ) Growth curves of DeltaH2.1 cybrid clones carrying different levels of heteroplasmy in high ( L ) and low ( M ) glucose culture medium. Confluency values averaged over 8 individual images per timepoint for each clone in each condition, data presented as mean values ± SEM. Figure created in BioRender. Van den Ameele, J. (2026) https://BioRender.com/j3ro7vq .

    Journal: Nature Structural & Molecular Biology

    Article Title: MitoPerturb-Seq identifies gene-specific single-cell responses to mitochondrial DNA depletion and heteroplasmy

    doi: 10.1038/s41594-026-01779-7

    Figure Lengend Snippet: ( A ) Expression profiles of indicated cell-cycle genes across cell-cycle pseudotime determined by tricycle. ( B ) Percentage of cells in each cell-cycle phase in Tfam , Opa1 , Polg KO cells, post-Mixscape, compared to non-targeting gRNA cells. Chi-squared tests with multiple testing correction (Bonferroni); ns, not significant. ( C ) Schematic showing the expression patterns of the PIP-FUCCI fluorescent reporters Cdt1-mVenus and Geminin-mCherry across the cell-cycle. ( D,E ) Gating strategies used to isolate cells for mtDNA CN measurements based on cell-cycle phase for both inter-phase ( D ) and intra-phase ( E ) comparisons. ( F,G ) Western blot ( F ) and ddPCR measurements ( G ) showing KD of TFAM protein ( F ) and reduced mtDNA CN ( G ) in HeLa cells transduced with two independent TFAM gRNAs. Vinculin is shown as a loading control ( F ). Number of individual cells per group is indicated in ( G ), data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test, **** p < 0.0001. ( H ) Map of the human mtDNA, highlighting the 7.5 Kb deletion present in the DeltaH2.1 cybrid cell line. ( I,J ) mtDNA CN ( I ) and heteroplasmy ( J ) of eight clonal populations isolated from the DeltaH2.1 cybrid cell line. Cell numbers per group indicated on graphs. Data presented as mean values +/- SD. One-way ANOVA of the mtDNA CN distributions was significant (p = 0.015); pairwise comparisons of all heteroplasmic clones to Clone 25 (0% heteroplasmy) using Tukey’s post-hoc test; ns, not significant. ( K ) Respirometry of DeltaH2.1 cybrid cells with increasing heteroplasmy levels, using Oroboros, showing baseline respiration (BR), proton-leak (PL), ATP-linked respiration (AR) and maximal respiratory capacity (MC). Three separate assays per clone. Data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test performed for each tested parameter, all significant pairwise comparisons are shown. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. ( L,M ) Growth curves of DeltaH2.1 cybrid clones carrying different levels of heteroplasmy in high ( L ) and low ( M ) glucose culture medium. Confluency values averaged over 8 individual images per timepoint for each clone in each condition, data presented as mean values ± SEM. Figure created in BioRender. Van den Ameele, J. (2026) https://BioRender.com/j3ro7vq .

    Article Snippet: Transfections were performed with cells at 80–90% confluency using TransIT-293 transfection reagent (Mirus, MIR2704) according to the manufacturer’s instructions.

    Techniques: Expressing, Western Blot, Transduction, Control, Isolation, Clone Assay