confluency (Mirus Bio)

Mirus Bio is a verified supplier

Mirus Bio manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Mirus Bio confluency

( A ) Expression profiles of indicated cell-cycle genes across cell-cycle pseudotime determined by tricycle. ( B ) Percentage of cells in each cell-cycle phase in Tfam , Opa1 , Polg KO cells, post-Mixscape, compared to non-targeting gRNA cells. Chi-squared tests with multiple testing correction (Bonferroni); ns, not significant. ( C ) Schematic showing the expression patterns of the PIP-FUCCI fluorescent reporters Cdt1-mVenus and Geminin-mCherry across the cell-cycle. ( D,E ) Gating strategies used to isolate cells for mtDNA CN measurements based on cell-cycle phase for both inter-phase ( D ) and intra-phase ( E ) comparisons. ( F,G ) Western blot ( F ) and ddPCR measurements ( G ) showing KD of TFAM protein ( F ) and reduced mtDNA CN ( G ) in HeLa cells transduced with two independent TFAM gRNAs. Vinculin is shown as a loading control ( F ). Number of individual cells per group is indicated in ( G ), data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test, **** p < 0.0001. ( H ) Map of the human mtDNA, highlighting the 7.5 Kb deletion present in the DeltaH2.1 cybrid cell line. ( I,J ) mtDNA CN ( I ) and heteroplasmy ( J ) of eight clonal populations isolated from the DeltaH2.1 cybrid cell line. Cell numbers per group indicated on graphs. Data presented as mean values +/- SD. One-way ANOVA of the mtDNA CN distributions was significant (p = 0.015); pairwise comparisons of all heteroplasmic clones to Clone 25 (0% heteroplasmy) using Tukey’s post-hoc test; ns, not significant. ( K ) Respirometry of DeltaH2.1 cybrid cells with increasing heteroplasmy levels, using Oroboros, showing baseline respiration (BR), proton-leak (PL), ATP-linked respiration (AR) and maximal respiratory capacity (MC). Three separate assays per clone. Data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test performed for each tested parameter, all significant pairwise comparisons are shown. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. ( L,M ) Growth curves of DeltaH2.1 cybrid clones carrying different levels of heteroplasmy in high ( L ) and low ( M ) glucose culture medium. <t>Confluency</t> values averaged over 8 individual images per timepoint for each clone in each condition, data presented as mean values ± SEM. Figure created in BioRender. Van den Ameele, J. (2026) https://BioRender.com/j3ro7vq .

Confluency, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 97/100, based on 2904 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/confluency/TransIT+-293/pmc13095666-271-7-12
Average 97 stars, based on 2904 article reviews

confluency - by Bioz Stars, 2026-10

97/100 stars

Images

1) Product Images from "MitoPerturb-Seq identifies gene-specific single-cell responses to mitochondrial DNA depletion and heteroplasmy"

Article Title: MitoPerturb-Seq identifies gene-specific single-cell responses to mitochondrial DNA depletion and heteroplasmy

Journal: Nature Structural & Molecular Biology

doi: 10.1038/s41594-026-01779-7

Figure Legend Snippet: ( A ) Expression profiles of indicated cell-cycle genes across cell-cycle pseudotime determined by tricycle. ( B ) Percentage of cells in each cell-cycle phase in Tfam , Opa1 , Polg KO cells, post-Mixscape, compared to non-targeting gRNA cells. Chi-squared tests with multiple testing correction (Bonferroni); ns, not significant. ( C ) Schematic showing the expression patterns of the PIP-FUCCI fluorescent reporters Cdt1-mVenus and Geminin-mCherry across the cell-cycle. ( D,E ) Gating strategies used to isolate cells for mtDNA CN measurements based on cell-cycle phase for both inter-phase ( D ) and intra-phase ( E ) comparisons. ( F,G ) Western blot ( F ) and ddPCR measurements ( G ) showing KD of TFAM protein ( F ) and reduced mtDNA CN ( G ) in HeLa cells transduced with two independent TFAM gRNAs. Vinculin is shown as a loading control ( F ). Number of individual cells per group is indicated in ( G ), data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test, **** p < 0.0001. ( H ) Map of the human mtDNA, highlighting the 7.5 Kb deletion present in the DeltaH2.1 cybrid cell line. ( I,J ) mtDNA CN ( I ) and heteroplasmy ( J ) of eight clonal populations isolated from the DeltaH2.1 cybrid cell line. Cell numbers per group indicated on graphs. Data presented as mean values +/- SD. One-way ANOVA of the mtDNA CN distributions was significant (p = 0.015); pairwise comparisons of all heteroplasmic clones to Clone 25 (0% heteroplasmy) using Tukey’s post-hoc test; ns, not significant. ( K ) Respirometry of DeltaH2.1 cybrid cells with increasing heteroplasmy levels, using Oroboros, showing baseline respiration (BR), proton-leak (PL), ATP-linked respiration (AR) and maximal respiratory capacity (MC). Three separate assays per clone. Data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test performed for each tested parameter, all significant pairwise comparisons are shown. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. ( L,M ) Growth curves of DeltaH2.1 cybrid clones carrying different levels of heteroplasmy in high ( L ) and low ( M ) glucose culture medium. Confluency values averaged over 8 individual images per timepoint for each clone in each condition, data presented as mean values ± SEM. Figure created in BioRender. Van den Ameele, J. (2026) https://BioRender.com/j3ro7vq .

Techniques Used: Expressing, Western Blot, Transduction, Control, Isolation, Clone Assay

Plasmid Preparation:

Article Title: Cotranslational membrane protein biogenesis by an EMC-bound translocon.
Article Snippet: Stable, doxycycline-inducible Flp-In T-REx 293 cell lines were generated in the corresponding wild-type (SSER-3xFlag-EMC7, SSER-3xFlag-EMC10, SSER-Twin-Strep-EMC10, SSER-Twin-Strep-CCDC47 and SSER-Twin-Strep-OST48) or knockout (3xFlag-EMC6) background 16 according to the manufacturer’s instructions (Thermo Fisher). .. Briefly, 100 ng of the desired plasmid were cotransfected with 900 ng of pOG44 (1:9 ratio) in a six-well plate using TransIT (Mirus Bio, cat. no. MIR2700). .. After 24 h, cells were selected for Flp-mediated recombination with 100 μg ml−1 hygromycin B (Gibco, cat. no. 10687010) for 3–4 weeks to obtain the stably integrated cell lines.

Article Title: Targeting CD28 on T lineage malignancies with chimeric antigen receptor T cells.
Article Snippet: .. CAR molecules cloned into pMP71 were transfected into 293Vec-Galv cells (kindly provided by BioVec Pharma Inc) using TransIT-293 Transfection Reagent (Mirus Bio) according to the supplier’s informationwith 2.5 μg of plasmid DNA. .. Retroviral supernatant was used for transduction of 293Vec-RD114 cells (kindly provided by BioVec Pharma Inc) to create a stable producer system, which were subsequently FACS-sorted for myc-positive cells.

Clone Assay:

Transfection:

Article Title: TET2 loss triggers ssDNA gap accumulation and heightened PARP inhibitor sensitivity.
Article Snippet: Silencer select negative control #1 siRNA (Ambion, 4390843) was used as control (siCTRL) at the same concentration of the highest concentration of siRNA used in the experiment97. .. HEK-293T cells were transfected using Mirus Transit 293 reagent with lentiviral packaging vectors pMD2.G (Addgene, #12259) and psPAX2 (Addgene, #12260) along with the construct of interest. .. CRISPR guide constructs targeting TET1 (5′CCCGAAGGCATCGTACAGTG 3′) or TET3 (5′ TCGAGAAGGTCATCTACACG 3′) were cloned into lentiCRISPR v2blast (#83480, Addgene) or lentiCRISPR v2-puro (Addgene, #52961).

Article Title: Cell-type-specific repression reveals MC4R neurons as a site of action for ciliary obesity genes.
Article Snippet: AAV DJ preparation AAV DJ used in adult stereotaxic injections was produced in AAVpro cells (Takara, 632273, passage number less than 10) maintained in complete DMEM [DMEM (Gibco, 11995065) supplemented with 10% FBS (Gibco, A5670801) and 1% penicillin– streptomycin (Sigma-Aldrich, P4333)]. .. Cells were seeded at 2.5 × 107 cells per 15-cm dish (two dishes per virus) and transfected 24 h later with 20 μg each of pHelper (Takara), pRC DJ [88], and AAV sgRNA plasmids using 120 μl TransIT-293 reagent (Mirus, 2700) in 4 mL Opti-MEM (Gibco, 31985-070). ..

Article Title: A massively parallel reporter assay of MECP2cis-regulatory elements reveals genetic candidates for male-biased autism.
Article Snippet: .. After 24 h, transfection was performed using 0.063 pmol firefly construct, 0.063 4 The American Journal of Human Genetics 113, 1–18, November 5, 2026 pmol Renilla control (Addgene 106292), 108 ng pMD2.G (Addgene 12259), and 325 ng psPAX2 (Addgene 12260), with TransIT293 Transfection Reagent (Mirus Bio 2704) and OptiMEM (Thermo Fisher Scientific 31985062). .. After 48 h, 400 μL supernatant was collected and centrifuged at room temperature for 10 min at 500 × g. 300 μL supernatant was then combined with 100 μL Lenti-X Concentrator (Takara 631231) and chilled at 4◦C overnight.

Generated:

Article Title: DNA replication stress redistributes the histone methyltransferase G9a and activates lineage-specific gene expression
Article Snippet: .. For all lentiviral transductions, lentiviral particles were generated by transfecting 293T cells (ATCC, CRL-3216) with a 4:2:1:1 ratio of the TARGET : pMDLg : pMD2.G : pRSV-REV plasmids using Transit 293T reagent (Mirus Bio, MIR 2700). ..

Construct:

Virus:

Bioprocessing:

other:

Article Title: The Factor VII mutation F7 c.760T>C (FVII p.Cys254Arg ) is causative for Factor VII deficiency by impairing secretion.
Article Snippet: Background: Hereditary Factor VII (FVII) deficiency is a bleeding disorder caused by mutations in the F7 gene, a diagnosis that is complicated by a weak genotype-phenotype correlation.. However, accurate pathogenicity assessment of FVII variants is essential for effective clinical management.. Objectives: Here, we report about the FVIIp.Cys254Arg variant, caused by the F7 c.760T>C mutation.

Review