codon optimized dysferlin cdna (Addgene inc)
Addgene inc is a verified supplier 
92
Structured Review
Addgene inc
codon optimized dysferlin cdna
Codon Optimized Dysferlin Cdna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/codon/Codon+Optimized+Dysferlin+(Plasmid+%2367878)/pm39511170-201-1-4
Average 92 stars, based on 2 article reviews
Codon Optimized Dysferlin Cdna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/codon/Codon+Optimized+Dysferlin+(Plasmid+%2367878)/pm39511170-201-1-4
Average 92 stars, based on 2 article reviews
codon optimized dysferlin cdna - by Bioz Stars,
2026-10
92/100 stars
Images
1) Product Images from "Cryo-EM structures of the membrane repair protein dysferlin."
Article Title: Cryo-EM structures of the membrane repair protein dysferlin.
Journal: Nature communications
doi: 10.1038/s41467-024-53773-6
Figure Legend Snippet: Fig. 3 | Key interactions in the dysferlin monomer. a Two views (front, back) of the pentameric ring formed by the C2B, C2E, C2D, C2C, and composite C2 domain and stabilized by the C2D-C2E linker. Individual domains are color-coded. b Schematic representation of the pentameric ring. Color code according to panel a. c Residue-level interactions at interdomain interfaces in the pentameric ring. d Residue-level interactions of the FerI with the C2B, C2C, and C2E. Color code according to panel a. The electrostatic potential distribution is shown for the C2B, C2C, and C2E (left). e The C2E-C2F (grey) and C2F-C2G (grey) linkers connect the respective domains. The C2E insert interacts with the C2E (yellow), C2F (blue), and
Techniques Used: Residue
Related Articles
Plasmid Preparation:Article Title: N121T and N121S substitutions on the SARS-CoV-2 spike protein impact on serum neutralization. Article Snippet: Funding information Ministry of Science and ICT, South Korea, Grant/Award Number: 2020R1A6A1A06046235; Ministry of Education, republic of korea; National Research Foundation of Korea Abstract The N121 site on the spike protein of SARS‐CoV‐2 is associated with heme and its metabolite, biliverdin, which can affect antibody binding.. Both N121T and N121S substitutions have been observed in natural conditions and in a hamster model of dual infection with SARS‐CoV‐2 and Influenza A virus.. Serum pseudotype neutralization assays against HIV‐1 particles carrying wild‐type, N121T, and N121S spikes with immune mouse and human sera revealed that N121T and N121S mutations had a greater impact on serum neutralization than biliverdin treatment. Article Title: Regulation of transcription through CTCF loop anchors Article Snippet: .. The genomic sequences complementary to all guide RNAs are listed in Table S2 TABLE S2 FIG. 3 sequences gRNAs in pAW21 and pAW22 210-Δ.1 ACCGCCTGTCCTTCCCCCGC (SEQ ID NO: 6) 210-Δ.2 TTGGTTGCTCCCCGCGTTTG (SEQ ID NO: 7) 4C primers Fwd AGAGAGGCAGTCTGGTCATG (SEQ ID NO: 9) Rev CCAGTGTCTTGCTTTCAAAT (SEQ ID NO: 10) FIG. 4 sequences gRNA for CTCF motif deletion MYC_CTCF ATGATCTCTGCTGCCAGTAG (SEQ ID NO: 8) Primers for detection of endogenous MYC FWD AACCTCACAACCTTGGCTGA (SEQ ID NO: 11) REV TTCTTTTATGCCCAAAGTCCAA (SEQ ID NO: 12) Primers for detection of exogenous MYC FWD TGATCCTAGCAGAAGCACAGG (SEQ ID NO: 13) REV TGGACGAGCTGTTACAAGAGC (SEQ ID NO: 14) Primers for detection of GAPDH FWD TGCACCACCAACTGCTTAGC (SEQ ID NO: 15) REV GGCATGGACTGTGGTCATGAG (SEQ ID NO: 16) FIG. 5 sequences sgRNAs in pJS-DNMT3A-3L and pLentiGuide Puro GCCTGGATGTCAACGAGGGC (SEQ ID NO: 1) GCGGGTGCTGCCCAGAGAGG (SEQ ID NO: 2) GCAAAATCCAGCATAGCGAT (SEQ ID NO: 3) CTATTCAACCGCATAAGAGA (SEQ ID NO: 4) CGCTGAGCTGCAAACTCAAC (SEQ ID NO: 5) Primers for Bisulfite PCR FWD AAGGAGGTGGYTGGAAAYTT (SEQ ID NO: 17) REV TCCCTCCACCACCTCCAAAA (SEQ ID NO: 18) FIG. 9 sequences Primers for genotyping FWD TCTGAACCACTTTTTCCTCCA (SEQ ID NO: 19) REV ACTGGCAGCAGAGATCATCG (SEQ ID NO: 20) For generation of Myc-cover clones, target-specific oligonucleotides were cloned into the pX330 plasmid which carries a U6 promoter, chimeric guide RNA, and a Article Title: Cryo-EM structures of the membrane repair protein dysferlin. Article Snippet: .. The Article Title: Multistep allelic conversion in mouse pre-implantation embryos by AAV vectors Article Snippet: .. To clone pAAV-CMV version of recombinase plasmids using In-Fusion cloning (Takara Bio) method, Article Title: Cryo-EM structures of the membrane repair protein dysferlin Article Snippet: .. The Construct:Article Title: N121T and N121S substitutions on the SARS-CoV-2 spike protein impact on serum neutralization. Article Snippet: Funding information Ministry of Science and ICT, South Korea, Grant/Award Number: 2020R1A6A1A06046235; Ministry of Education, republic of korea; National Research Foundation of Korea Abstract The N121 site on the spike protein of SARS‐CoV‐2 is associated with heme and its metabolite, biliverdin, which can affect antibody binding.. Both N121T and N121S substitutions have been observed in natural conditions and in a hamster model of dual infection with SARS‐CoV‐2 and Influenza A virus.. Serum pseudotype neutralization assays against HIV‐1 particles carrying wild‐type, N121T, and N121S spikes with immune mouse and human sera revealed that N121T and N121S mutations had a greater impact on serum neutralization than biliverdin treatment. Luciferase:Article Title: N121T and N121S substitutions on the SARS-CoV-2 spike protein impact on serum neutralization. Article Snippet: Funding information Ministry of Science and ICT, South Korea, Grant/Award Number: 2020R1A6A1A06046235; Ministry of Education, republic of korea; National Research Foundation of Korea Abstract The N121 site on the spike protein of SARS‐CoV‐2 is associated with heme and its metabolite, biliverdin, which can affect antibody binding.. Both N121T and N121S substitutions have been observed in natural conditions and in a hamster model of dual infection with SARS‐CoV‐2 and Influenza A virus.. Serum pseudotype neutralization assays against HIV‐1 particles carrying wild‐type, N121T, and N121S spikes with immune mouse and human sera revealed that N121T and N121S mutations had a greater impact on serum neutralization than biliverdin treatment. Synthesized:Article Title: N121T and N121S substitutions on the SARS-CoV-2 spike protein impact on serum neutralization. Article Snippet: Funding information Ministry of Science and ICT, South Korea, Grant/Award Number: 2020R1A6A1A06046235; Ministry of Education, republic of korea; National Research Foundation of Korea Abstract The N121 site on the spike protein of SARS‐CoV‐2 is associated with heme and its metabolite, biliverdin, which can affect antibody binding.. Both N121T and N121S substitutions have been observed in natural conditions and in a hamster model of dual infection with SARS‐CoV‐2 and Influenza A virus.. Serum pseudotype neutralization assays against HIV‐1 particles carrying wild‐type, N121T, and N121S spikes with immune mouse and human sera revealed that N121T and N121S mutations had a greater impact on serum neutralization than biliverdin treatment. Expressing:Article Title: N121T and N121S substitutions on the SARS-CoV-2 spike protein impact on serum neutralization. Article Snippet: Funding information Ministry of Science and ICT, South Korea, Grant/Award Number: 2020R1A6A1A06046235; Ministry of Education, republic of korea; National Research Foundation of Korea Abstract The N121 site on the spike protein of SARS‐CoV‐2 is associated with heme and its metabolite, biliverdin, which can affect antibody binding.. Both N121T and N121S substitutions have been observed in natural conditions and in a hamster model of dual infection with SARS‐CoV‐2 and Influenza A virus.. Serum pseudotype neutralization assays against HIV‐1 particles carrying wild‐type, N121T, and N121S spikes with immune mouse and human sera revealed that N121T and N121S mutations had a greater impact on serum neutralization than biliverdin treatment. Genomic Sequencing:Article Title: Regulation of transcription through CTCF loop anchors Article Snippet: .. The genomic sequences complementary to all guide RNAs are listed in Table S2 TABLE S2 FIG. 3 sequences gRNAs in pAW21 and pAW22 210-Δ.1 ACCGCCTGTCCTTCCCCCGC (SEQ ID NO: 6) 210-Δ.2 TTGGTTGCTCCCCGCGTTTG (SEQ ID NO: 7) 4C primers Fwd AGAGAGGCAGTCTGGTCATG (SEQ ID NO: 9) Rev CCAGTGTCTTGCTTTCAAAT (SEQ ID NO: 10) FIG. 4 sequences gRNA for CTCF motif deletion MYC_CTCF ATGATCTCTGCTGCCAGTAG (SEQ ID NO: 8) Primers for detection of endogenous MYC FWD AACCTCACAACCTTGGCTGA (SEQ ID NO: 11) REV TTCTTTTATGCCCAAAGTCCAA (SEQ ID NO: 12) Primers for detection of exogenous MYC FWD TGATCCTAGCAGAAGCACAGG (SEQ ID NO: 13) REV TGGACGAGCTGTTACAAGAGC (SEQ ID NO: 14) Primers for detection of GAPDH FWD TGCACCACCAACTGCTTAGC (SEQ ID NO: 15) REV GGCATGGACTGTGGTCATGAG (SEQ ID NO: 16) FIG. 5 sequences sgRNAs in pJS-DNMT3A-3L and pLentiGuide Puro GCCTGGATGTCAACGAGGGC (SEQ ID NO: 1) GCGGGTGCTGCCCAGAGAGG (SEQ ID NO: 2) GCAAAATCCAGCATAGCGAT (SEQ ID NO: 3) CTATTCAACCGCATAAGAGA (SEQ ID NO: 4) CGCTGAGCTGCAAACTCAAC (SEQ ID NO: 5) Primers for Bisulfite PCR FWD AAGGAGGTGGYTGGAAAYTT (SEQ ID NO: 17) REV TCCCTCCACCACCTCCAAAA (SEQ ID NO: 18) FIG. 9 sequences Primers for genotyping FWD TCTGAACCACTTTTTCCTCCA (SEQ ID NO: 19) REV ACTGGCAGCAGAGATCATCG (SEQ ID NO: 20) For generation of Myc-cover clones, target-specific oligonucleotides were cloned into the pX330 plasmid which carries a U6 promoter, chimeric guide RNA, and a Polymerase Chain Reaction:Article Title: Regulation of transcription through CTCF loop anchors Article Snippet: .. The genomic sequences complementary to all guide RNAs are listed in Table S2 TABLE S2 FIG. 3 sequences gRNAs in pAW21 and pAW22 210-Δ.1 ACCGCCTGTCCTTCCCCCGC (SEQ ID NO: 6) 210-Δ.2 TTGGTTGCTCCCCGCGTTTG (SEQ ID NO: 7) 4C primers Fwd AGAGAGGCAGTCTGGTCATG (SEQ ID NO: 9) Rev CCAGTGTCTTGCTTTCAAAT (SEQ ID NO: 10) FIG. 4 sequences gRNA for CTCF motif deletion MYC_CTCF ATGATCTCTGCTGCCAGTAG (SEQ ID NO: 8) Primers for detection of endogenous MYC FWD AACCTCACAACCTTGGCTGA (SEQ ID NO: 11) REV TTCTTTTATGCCCAAAGTCCAA (SEQ ID NO: 12) Primers for detection of exogenous MYC FWD TGATCCTAGCAGAAGCACAGG (SEQ ID NO: 13) REV TGGACGAGCTGTTACAAGAGC (SEQ ID NO: 14) Primers for detection of GAPDH FWD TGCACCACCAACTGCTTAGC (SEQ ID NO: 15) REV GGCATGGACTGTGGTCATGAG (SEQ ID NO: 16) FIG. 5 sequences sgRNAs in pJS-DNMT3A-3L and pLentiGuide Puro GCCTGGATGTCAACGAGGGC (SEQ ID NO: 1) GCGGGTGCTGCCCAGAGAGG (SEQ ID NO: 2) GCAAAATCCAGCATAGCGAT (SEQ ID NO: 3) CTATTCAACCGCATAAGAGA (SEQ ID NO: 4) CGCTGAGCTGCAAACTCAAC (SEQ ID NO: 5) Primers for Bisulfite PCR FWD AAGGAGGTGGYTGGAAAYTT (SEQ ID NO: 17) REV TCCCTCCACCACCTCCAAAA (SEQ ID NO: 18) FIG. 9 sequences Primers for genotyping FWD TCTGAACCACTTTTTCCTCCA (SEQ ID NO: 19) REV ACTGGCAGCAGAGATCATCG (SEQ ID NO: 20) For generation of Myc-cover clones, target-specific oligonucleotides were cloned into the pX330 plasmid which carries a U6 promoter, chimeric guide RNA, and a Clone Assay:Article Title: Regulation of transcription through CTCF loop anchors Article Snippet: .. The genomic sequences complementary to all guide RNAs are listed in Table S2 TABLE S2 FIG. 3 sequences gRNAs in pAW21 and pAW22 210-Δ.1 ACCGCCTGTCCTTCCCCCGC (SEQ ID NO: 6) 210-Δ.2 TTGGTTGCTCCCCGCGTTTG (SEQ ID NO: 7) 4C primers Fwd AGAGAGGCAGTCTGGTCATG (SEQ ID NO: 9) Rev CCAGTGTCTTGCTTTCAAAT (SEQ ID NO: 10) FIG. 4 sequences gRNA for CTCF motif deletion MYC_CTCF ATGATCTCTGCTGCCAGTAG (SEQ ID NO: 8) Primers for detection of endogenous MYC FWD AACCTCACAACCTTGGCTGA (SEQ ID NO: 11) REV TTCTTTTATGCCCAAAGTCCAA (SEQ ID NO: 12) Primers for detection of exogenous MYC FWD TGATCCTAGCAGAAGCACAGG (SEQ ID NO: 13) REV TGGACGAGCTGTTACAAGAGC (SEQ ID NO: 14) Primers for detection of GAPDH FWD TGCACCACCAACTGCTTAGC (SEQ ID NO: 15) REV GGCATGGACTGTGGTCATGAG (SEQ ID NO: 16) FIG. 5 sequences sgRNAs in pJS-DNMT3A-3L and pLentiGuide Puro GCCTGGATGTCAACGAGGGC (SEQ ID NO: 1) GCGGGTGCTGCCCAGAGAGG (SEQ ID NO: 2) GCAAAATCCAGCATAGCGAT (SEQ ID NO: 3) CTATTCAACCGCATAAGAGA (SEQ ID NO: 4) CGCTGAGCTGCAAACTCAAC (SEQ ID NO: 5) Primers for Bisulfite PCR FWD AAGGAGGTGGYTGGAAAYTT (SEQ ID NO: 17) REV TCCCTCCACCACCTCCAAAA (SEQ ID NO: 18) FIG. 9 sequences Primers for genotyping FWD TCTGAACCACTTTTTCCTCCA (SEQ ID NO: 19) REV ACTGGCAGCAGAGATCATCG (SEQ ID NO: 20) For generation of Myc-cover clones, target-specific oligonucleotides were cloned into the pX330 plasmid which carries a U6 promoter, chimeric guide RNA, and a Article Title: Multistep allelic conversion in mouse pre-implantation embryos by AAV vectors Article Snippet: .. To clone pAAV-CMV version of recombinase plasmids using In-Fusion cloning (Takara Bio) method, Amplification:Article Title: Cryo-EM structures of the membrane repair protein dysferlin. Article Snippet: .. The Article Title: Multistep allelic conversion in mouse pre-implantation embryos by AAV vectors Article Snippet: .. To clone pAAV-CMV version of recombinase plasmids using In-Fusion cloning (Takara Bio) method, Article Title: Cryo-EM structures of the membrane repair protein dysferlin Article Snippet: .. The Sequencing:Article Title: Cryo-EM structures of the membrane repair protein dysferlin. Article Snippet: .. The Article Title: Multistep allelic conversion in mouse pre-implantation embryos by AAV vectors Article Snippet: .. To clone pAAV-CMV version of recombinase plasmids using In-Fusion cloning (Takara Bio) method, Article Title: Cryo-EM structures of the membrane repair protein dysferlin Article Snippet: .. The Cloning:Article Title: Cryo-EM structures of the membrane repair protein dysferlin. Article Snippet: .. The Article Title: Multistep allelic conversion in mouse pre-implantation embryos by AAV vectors Article Snippet: .. To clone pAAV-CMV version of recombinase plasmids using In-Fusion cloning (Takara Bio) method, Article Title: Cryo-EM structures of the membrane repair protein dysferlin Article Snippet: .. The Bioprocessing:Article Title: Multistep allelic conversion in mouse pre-implantation embryos by AAV vectors Article Snippet: .. To clone pAAV-CMV version of recombinase plasmids using In-Fusion cloning (Takara Bio) method, Control:Article Title: Multistep allelic conversion in mouse pre-implantation embryos by AAV vectors Article Snippet: .. To clone pAAV-CMV version of recombinase plasmids using In-Fusion cloning (Takara Bio) method, |