codon-optimized spike protein nucleotide sequence (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
90
Structured Review
Thermo Fisher
codon-optimized spike protein nucleotide sequence
Codon Optimized Spike Protein Nucleotide Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/codon+optimized+nucleotide+sequence/ion+ampliseq+sars+cov+2+research+panel/pmc12125293-301-7-57
Average 90 stars, based on 1 article reviews
Codon Optimized Spike Protein Nucleotide Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/codon+optimized+nucleotide+sequence/ion+ampliseq+sars+cov+2+research+panel/pmc12125293-301-7-57
Average 90 stars, based on 1 article reviews
codon-optimized spike protein nucleotide sequence - by Bioz Stars,
2026-09
90/100 stars
Images
1) Product Images from "Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base"
Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base
Journal: Nature Communications
doi: 10.1038/s41467-025-60250-1
Figure Legend Snippet: a left: model of full-length prefusion S (6VSB_1_1_2 ) with superimposition of the R3DC23 – HR2 complex, all shown in molecular surface representation, with N-glycans in stick representation. R3DC23 VHHs are colored in orange, labeled S protein regions: cytoplasmic domain (red; CP), transmembrane domain (gray; TM), heptad repeat 2 (blue; HR2), S2 stem helix (deep pink; SH), heptad repeat 1 (lemon, HR1), central helix and connector domain (pink; CH-CD), the S1 regions encompassing the N-terminal domain (NTD) and receptor binding domain (RBD) (light blue). Right: model of the proteolytically processed postfusion S2 subunit (7E9T ), color coded as in prefusion spike. b Side and axial view (inset) of the R3DC23 – HR2 complex (sand and blue, respectively) superimposed with prefusion HR2 coiled-coil (light blue). In R3DC23, CDR1, 2, and 3 are colored magenta, yellow, and cyan, respectively. The HR2-binding epitope spanning D1192 – Y1206 is shown in stick representation. c Close-up of boxed region, encompassing a single VHH and two HR2 copies (i and ii) forming the adjoined binding epitope. Escape mutant positions are labeled in red. d Axial view of HR1-HR2 (lemon and blue) region of postfusion S protein, superimposed with R3DC23 in the HR2 complex (gray). e The amino acids involved in interactions between R3DC23 and two HR2 helices as observed in the crystal of the R3DC23-HR2 complex are indicated in red.
Techniques Used: Labeling, Binding Assay, Mutagenesis
Related Articles
Virus:Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base Article Snippet: For the pCG1-SARS-2-BA.2 Sdel18 expression vector, a codon-optimized spike protein nucleotide sequence containing the BA.2 mutations (T19I, ΔL14-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and flanking BamH I and Article Title: Decoding the transcriptome from bulk RNA of infection-naïve versus imprinted patients with SARS-CoV-2 Omicron B.1.1.529. Article Snippet: The results of the melting curve analysis were randomly verified by wholegenome sequencing using the Article Title: SARS-CoV-2 pathogenesis in angiotensin II induced heart-on-a-chip disease model and exosome screening Article Snippet: Primary antibodies used were 1:1000 Article Title: Purification of Messenger RNA Directly from Crude IVT Using Polyethylene Glycol and NaCl Precipitation Article Snippet: The increasing demand for mRNA-based therapeutics requires scalable and cost-effective purification methods.. Chromatography-based approaches, such as Oligo-dT affinity chromatography, require multiple processing steps, including buffer exchange and high-temperature treatments, which can lead to mRNA degradation and increased costs.. Although precipitation is commonly used at the lab scale, its application in large-scale mRNA purification remains underexplored. Article Title: A predisposing effect of HLA class II genes in celiac disease by skewing the naïve CD4 + T-cell receptor repertoire Article Snippet: For 196 of the subjects, the gDNA was used for SNP genotyping with an Article Title: Trans amplifying mRNA vaccine expressing consensus spike elicits broad neutralization of SARS CoV 2 variants. Article Snippet: The Article Title: Design of SARS-CoV-2 RBD immunogens to focus immune responses toward conserved coronavirus epitopes. Article Snippet: Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! Recombinant:Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base Article Snippet: For the pCG1-SARS-2-BA.2 Sdel18 expression vector, a codon-optimized spike protein nucleotide sequence containing the BA.2 mutations (T19I, ΔL14-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and flanking BamH I and Article Title: Decoding the transcriptome from bulk RNA of infection-naïve versus imprinted patients with SARS-CoV-2 Omicron B.1.1.529. Article Snippet: The results of the melting curve analysis were randomly verified by wholegenome sequencing using the Article Title: SARS-CoV-2 pathogenesis in angiotensin II induced heart-on-a-chip disease model and exosome screening Article Snippet: Primary antibodies used were 1:1000 Article Title: Purification of Messenger RNA Directly from Crude IVT Using Polyethylene Glycol and NaCl Precipitation Article Snippet: The increasing demand for mRNA-based therapeutics requires scalable and cost-effective purification methods.. Chromatography-based approaches, such as Oligo-dT affinity chromatography, require multiple processing steps, including buffer exchange and high-temperature treatments, which can lead to mRNA degradation and increased costs.. Although precipitation is commonly used at the lab scale, its application in large-scale mRNA purification remains underexplored. Article Title: A predisposing effect of HLA class II genes in celiac disease by skewing the naïve CD4 + T-cell receptor repertoire Article Snippet: For 196 of the subjects, the gDNA was used for SNP genotyping with an Article Title: Trans amplifying mRNA vaccine expressing consensus spike elicits broad neutralization of SARS CoV 2 variants. Article Snippet: The Article Title: Design of SARS-CoV-2 RBD immunogens to focus immune responses toward conserved coronavirus epitopes. Article Snippet: Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! Isolation:Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base Article Snippet: For the pCG1-SARS-2-BA.2 Sdel18 expression vector, a codon-optimized spike protein nucleotide sequence containing the BA.2 mutations (T19I, ΔL14-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and flanking BamH I and Article Title: Decoding the transcriptome from bulk RNA of infection-naïve versus imprinted patients with SARS-CoV-2 Omicron B.1.1.529. Article Snippet: The results of the melting curve analysis were randomly verified by wholegenome sequencing using the Article Title: SARS-CoV-2 pathogenesis in angiotensin II induced heart-on-a-chip disease model and exosome screening Article Snippet: Primary antibodies used were 1:1000 Article Title: Purification of Messenger RNA Directly from Crude IVT Using Polyethylene Glycol and NaCl Precipitation Article Snippet: The increasing demand for mRNA-based therapeutics requires scalable and cost-effective purification methods.. Chromatography-based approaches, such as Oligo-dT affinity chromatography, require multiple processing steps, including buffer exchange and high-temperature treatments, which can lead to mRNA degradation and increased costs.. Although precipitation is commonly used at the lab scale, its application in large-scale mRNA purification remains underexplored. Article Title: A predisposing effect of HLA class II genes in celiac disease by skewing the naïve CD4 + T-cell receptor repertoire Article Snippet: For 196 of the subjects, the gDNA was used for SNP genotyping with an Article Title: Trans amplifying mRNA vaccine expressing consensus spike elicits broad neutralization of SARS CoV 2 variants. Article Snippet: The Article Title: Design of SARS-CoV-2 RBD immunogens to focus immune responses toward conserved coronavirus epitopes. Article Snippet: Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! Quantitation Assay:Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base Article Snippet: For the pCG1-SARS-2-BA.2 Sdel18 expression vector, a codon-optimized spike protein nucleotide sequence containing the BA.2 mutations (T19I, ΔL14-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and flanking BamH I and Article Title: Decoding the transcriptome from bulk RNA of infection-naïve versus imprinted patients with SARS-CoV-2 Omicron B.1.1.529. Article Snippet: The results of the melting curve analysis were randomly verified by wholegenome sequencing using the Article Title: SARS-CoV-2 pathogenesis in angiotensin II induced heart-on-a-chip disease model and exosome screening Article Snippet: Primary antibodies used were 1:1000 Article Title: Purification of Messenger RNA Directly from Crude IVT Using Polyethylene Glycol and NaCl Precipitation Article Snippet: The increasing demand for mRNA-based therapeutics requires scalable and cost-effective purification methods.. Chromatography-based approaches, such as Oligo-dT affinity chromatography, require multiple processing steps, including buffer exchange and high-temperature treatments, which can lead to mRNA degradation and increased costs.. Although precipitation is commonly used at the lab scale, its application in large-scale mRNA purification remains underexplored. Article Title: A predisposing effect of HLA class II genes in celiac disease by skewing the naïve CD4 + T-cell receptor repertoire Article Snippet: For 196 of the subjects, the gDNA was used for SNP genotyping with an Article Title: Trans amplifying mRNA vaccine expressing consensus spike elicits broad neutralization of SARS CoV 2 variants. Article Snippet: The Article Title: Design of SARS-CoV-2 RBD immunogens to focus immune responses toward conserved coronavirus epitopes. Article Snippet: Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! Reverse Transcription:Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base Article Snippet: For the pCG1-SARS-2-BA.2 Sdel18 expression vector, a codon-optimized spike protein nucleotide sequence containing the BA.2 mutations (T19I, ΔL14-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and flanking BamH I and Article Title: Decoding the transcriptome from bulk RNA of infection-naïve versus imprinted patients with SARS-CoV-2 Omicron B.1.1.529. Article Snippet: The results of the melting curve analysis were randomly verified by wholegenome sequencing using the Article Title: SARS-CoV-2 pathogenesis in angiotensin II induced heart-on-a-chip disease model and exosome screening Article Snippet: Primary antibodies used were 1:1000 Article Title: Purification of Messenger RNA Directly from Crude IVT Using Polyethylene Glycol and NaCl Precipitation Article Snippet: The increasing demand for mRNA-based therapeutics requires scalable and cost-effective purification methods.. Chromatography-based approaches, such as Oligo-dT affinity chromatography, require multiple processing steps, including buffer exchange and high-temperature treatments, which can lead to mRNA degradation and increased costs.. Although precipitation is commonly used at the lab scale, its application in large-scale mRNA purification remains underexplored. Article Title: A predisposing effect of HLA class II genes in celiac disease by skewing the naïve CD4 + T-cell receptor repertoire Article Snippet: For 196 of the subjects, the gDNA was used for SNP genotyping with an Article Title: Trans amplifying mRNA vaccine expressing consensus spike elicits broad neutralization of SARS CoV 2 variants. Article Snippet: The Article Title: Design of SARS-CoV-2 RBD immunogens to focus immune responses toward conserved coronavirus epitopes. Article Snippet: Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! SYBR Green Assay:Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base Article Snippet: For the pCG1-SARS-2-BA.2 Sdel18 expression vector, a codon-optimized spike protein nucleotide sequence containing the BA.2 mutations (T19I, ΔL14-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and flanking BamH I and Article Title: Decoding the transcriptome from bulk RNA of infection-naïve versus imprinted patients with SARS-CoV-2 Omicron B.1.1.529. Article Snippet: The results of the melting curve analysis were randomly verified by wholegenome sequencing using the Article Title: SARS-CoV-2 pathogenesis in angiotensin II induced heart-on-a-chip disease model and exosome screening Article Snippet: Primary antibodies used were 1:1000 Article Title: Purification of Messenger RNA Directly from Crude IVT Using Polyethylene Glycol and NaCl Precipitation Article Snippet: The increasing demand for mRNA-based therapeutics requires scalable and cost-effective purification methods.. Chromatography-based approaches, such as Oligo-dT affinity chromatography, require multiple processing steps, including buffer exchange and high-temperature treatments, which can lead to mRNA degradation and increased costs.. Although precipitation is commonly used at the lab scale, its application in large-scale mRNA purification remains underexplored. Article Title: A predisposing effect of HLA class II genes in celiac disease by skewing the naïve CD4 + T-cell receptor repertoire Article Snippet: For 196 of the subjects, the gDNA was used for SNP genotyping with an Article Title: Trans amplifying mRNA vaccine expressing consensus spike elicits broad neutralization of SARS CoV 2 variants. Article Snippet: The Article Title: Design of SARS-CoV-2 RBD immunogens to focus immune responses toward conserved coronavirus epitopes. Article Snippet: Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! Reporter Assay:Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base Article Snippet: For the pCG1-SARS-2-BA.2 Sdel18 expression vector, a codon-optimized spike protein nucleotide sequence containing the BA.2 mutations (T19I, ΔL14-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and flanking BamH I and Article Title: Decoding the transcriptome from bulk RNA of infection-naïve versus imprinted patients with SARS-CoV-2 Omicron B.1.1.529. Article Snippet: The results of the melting curve analysis were randomly verified by wholegenome sequencing using the Article Title: SARS-CoV-2 pathogenesis in angiotensin II induced heart-on-a-chip disease model and exosome screening Article Snippet: Primary antibodies used were 1:1000 Article Title: Purification of Messenger RNA Directly from Crude IVT Using Polyethylene Glycol and NaCl Precipitation Article Snippet: The increasing demand for mRNA-based therapeutics requires scalable and cost-effective purification methods.. Chromatography-based approaches, such as Oligo-dT affinity chromatography, require multiple processing steps, including buffer exchange and high-temperature treatments, which can lead to mRNA degradation and increased costs.. Although precipitation is commonly used at the lab scale, its application in large-scale mRNA purification remains underexplored. Article Title: A predisposing effect of HLA class II genes in celiac disease by skewing the naïve CD4 + T-cell receptor repertoire Article Snippet: For 196 of the subjects, the gDNA was used for SNP genotyping with an Article Title: Trans amplifying mRNA vaccine expressing consensus spike elicits broad neutralization of SARS CoV 2 variants. Article Snippet: The Article Title: Design of SARS-CoV-2 RBD immunogens to focus immune responses toward conserved coronavirus epitopes. Article Snippet: Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! Luciferase:Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base Article Snippet: For the pCG1-SARS-2-BA.2 Sdel18 expression vector, a codon-optimized spike protein nucleotide sequence containing the BA.2 mutations (T19I, ΔL14-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and flanking BamH I and Article Title: Decoding the transcriptome from bulk RNA of infection-naïve versus imprinted patients with SARS-CoV-2 Omicron B.1.1.529. Article Snippet: The results of the melting curve analysis were randomly verified by wholegenome sequencing using the Article Title: SARS-CoV-2 pathogenesis in angiotensin II induced heart-on-a-chip disease model and exosome screening Article Snippet: Primary antibodies used were 1:1000 Article Title: Purification of Messenger RNA Directly from Crude IVT Using Polyethylene Glycol and NaCl Precipitation Article Snippet: The increasing demand for mRNA-based therapeutics requires scalable and cost-effective purification methods.. Chromatography-based approaches, such as Oligo-dT affinity chromatography, require multiple processing steps, including buffer exchange and high-temperature treatments, which can lead to mRNA degradation and increased costs.. Although precipitation is commonly used at the lab scale, its application in large-scale mRNA purification remains underexplored. Article Title: A predisposing effect of HLA class II genes in celiac disease by skewing the naïve CD4 + T-cell receptor repertoire Article Snippet: For 196 of the subjects, the gDNA was used for SNP genotyping with an Article Title: Trans amplifying mRNA vaccine expressing consensus spike elicits broad neutralization of SARS CoV 2 variants. Article Snippet: The Article Title: Design of SARS-CoV-2 RBD immunogens to focus immune responses toward conserved coronavirus epitopes. Article Snippet: Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! Membrane:Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base Article Snippet: For the pCG1-SARS-2-BA.2 Sdel18 expression vector, a codon-optimized spike protein nucleotide sequence containing the BA.2 mutations (T19I, ΔL14-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and flanking BamH I and Article Title: Decoding the transcriptome from bulk RNA of infection-naïve versus imprinted patients with SARS-CoV-2 Omicron B.1.1.529. Article Snippet: The results of the melting curve analysis were randomly verified by wholegenome sequencing using the Article Title: SARS-CoV-2 pathogenesis in angiotensin II induced heart-on-a-chip disease model and exosome screening Article Snippet: Primary antibodies used were 1:1000 Article Title: Purification of Messenger RNA Directly from Crude IVT Using Polyethylene Glycol and NaCl Precipitation Article Snippet: The increasing demand for mRNA-based therapeutics requires scalable and cost-effective purification methods.. Chromatography-based approaches, such as Oligo-dT affinity chromatography, require multiple processing steps, including buffer exchange and high-temperature treatments, which can lead to mRNA degradation and increased costs.. Although precipitation is commonly used at the lab scale, its application in large-scale mRNA purification remains underexplored. Article Title: A predisposing effect of HLA class II genes in celiac disease by skewing the naïve CD4 + T-cell receptor repertoire Article Snippet: For 196 of the subjects, the gDNA was used for SNP genotyping with an Article Title: Trans amplifying mRNA vaccine expressing consensus spike elicits broad neutralization of SARS CoV 2 variants. Article Snippet: The Article Title: Design of SARS-CoV-2 RBD immunogens to focus immune responses toward conserved coronavirus epitopes. Article Snippet: Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! Expressing:Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base Article Snippet: For the pCG1-SARS-2-BA.2 Sdel18 expression vector, a codon-optimized spike protein nucleotide sequence containing the BA.2 mutations (T19I, ΔL14-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and flanking BamH I and Article Title: Decoding the transcriptome from bulk RNA of infection-naïve versus imprinted patients with SARS-CoV-2 Omicron B.1.1.529. Article Snippet: The results of the melting curve analysis were randomly verified by wholegenome sequencing using the Article Title: SARS-CoV-2 pathogenesis in angiotensin II induced heart-on-a-chip disease model and exosome screening Article Snippet: Primary antibodies used were 1:1000 Article Title: Purification of Messenger RNA Directly from Crude IVT Using Polyethylene Glycol and NaCl Precipitation Article Snippet: The increasing demand for mRNA-based therapeutics requires scalable and cost-effective purification methods.. Chromatography-based approaches, such as Oligo-dT affinity chromatography, require multiple processing steps, including buffer exchange and high-temperature treatments, which can lead to mRNA degradation and increased costs.. Although precipitation is commonly used at the lab scale, its application in large-scale mRNA purification remains underexplored. Article Title: A predisposing effect of HLA class II genes in celiac disease by skewing the naïve CD4 + T-cell receptor repertoire Article Snippet: For 196 of the subjects, the gDNA was used for SNP genotyping with an Article Title: Trans amplifying mRNA vaccine expressing consensus spike elicits broad neutralization of SARS CoV 2 variants. Article Snippet: The Article Title: Design of SARS-CoV-2 RBD immunogens to focus immune responses toward conserved coronavirus epitopes. Article Snippet: Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! Plasmid Preparation:Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base Article Snippet: For the pCG1-SARS-2-BA.2 Sdel18 expression vector, a codon-optimized spike protein nucleotide sequence containing the BA.2 mutations (T19I, ΔL14-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and flanking BamH I and Article Title: Decoding the transcriptome from bulk RNA of infection-naïve versus imprinted patients with SARS-CoV-2 Omicron B.1.1.529. Article Snippet: The results of the melting curve analysis were randomly verified by wholegenome sequencing using the Article Title: SARS-CoV-2 pathogenesis in angiotensin II induced heart-on-a-chip disease model and exosome screening Article Snippet: Primary antibodies used were 1:1000 Article Title: Purification of Messenger RNA Directly from Crude IVT Using Polyethylene Glycol and NaCl Precipitation Article Snippet: The increasing demand for mRNA-based therapeutics requires scalable and cost-effective purification methods.. Chromatography-based approaches, such as Oligo-dT affinity chromatography, require multiple processing steps, including buffer exchange and high-temperature treatments, which can lead to mRNA degradation and increased costs.. Although precipitation is commonly used at the lab scale, its application in large-scale mRNA purification remains underexplored. Article Title: A predisposing effect of HLA class II genes in celiac disease by skewing the naïve CD4 + T-cell receptor repertoire Article Snippet: For 196 of the subjects, the gDNA was used for SNP genotyping with an Article Title: Trans amplifying mRNA vaccine expressing consensus spike elicits broad neutralization of SARS CoV 2 variants. Article Snippet: The Article Title: Design of SARS-CoV-2 RBD immunogens to focus immune responses toward conserved coronavirus epitopes. Article Snippet: Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! Sequencing:Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base Article Snippet: For the pCG1-SARS-2-BA.2 Sdel18 expression vector, a codon-optimized spike protein nucleotide sequence containing the BA.2 mutations (T19I, ΔL14-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and flanking BamH I and Article Title: Decoding the transcriptome from bulk RNA of infection-naïve versus imprinted patients with SARS-CoV-2 Omicron B.1.1.529. Article Snippet: The results of the melting curve analysis were randomly verified by wholegenome sequencing using the Article Title: SARS-CoV-2 pathogenesis in angiotensin II induced heart-on-a-chip disease model and exosome screening Article Snippet: Primary antibodies used were 1:1000 Article Title: Purification of Messenger RNA Directly from Crude IVT Using Polyethylene Glycol and NaCl Precipitation Article Snippet: The increasing demand for mRNA-based therapeutics requires scalable and cost-effective purification methods.. Chromatography-based approaches, such as Oligo-dT affinity chromatography, require multiple processing steps, including buffer exchange and high-temperature treatments, which can lead to mRNA degradation and increased costs.. Although precipitation is commonly used at the lab scale, its application in large-scale mRNA purification remains underexplored. Article Title: A predisposing effect of HLA class II genes in celiac disease by skewing the naïve CD4 + T-cell receptor repertoire Article Snippet: For 196 of the subjects, the gDNA was used for SNP genotyping with an Article Title: Trans amplifying mRNA vaccine expressing consensus spike elicits broad neutralization of SARS CoV 2 variants. Article Snippet: The Article Title: Design of SARS-CoV-2 RBD immunogens to focus immune responses toward conserved coronavirus epitopes. Article Snippet: Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! Clone Assay:Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base Article Snippet: For the pCG1-SARS-2-BA.2 Sdel18 expression vector, a codon-optimized spike protein nucleotide sequence containing the BA.2 mutations (T19I, ΔL14-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and flanking BamH I and Article Title: Decoding the transcriptome from bulk RNA of infection-naïve versus imprinted patients with SARS-CoV-2 Omicron B.1.1.529. Article Snippet: The results of the melting curve analysis were randomly verified by wholegenome sequencing using the Article Title: SARS-CoV-2 pathogenesis in angiotensin II induced heart-on-a-chip disease model and exosome screening Article Snippet: Primary antibodies used were 1:1000 Article Title: Purification of Messenger RNA Directly from Crude IVT Using Polyethylene Glycol and NaCl Precipitation Article Snippet: The increasing demand for mRNA-based therapeutics requires scalable and cost-effective purification methods.. Chromatography-based approaches, such as Oligo-dT affinity chromatography, require multiple processing steps, including buffer exchange and high-temperature treatments, which can lead to mRNA degradation and increased costs.. Although precipitation is commonly used at the lab scale, its application in large-scale mRNA purification remains underexplored. Article Title: A predisposing effect of HLA class II genes in celiac disease by skewing the naïve CD4 + T-cell receptor repertoire Article Snippet: For 196 of the subjects, the gDNA was used for SNP genotyping with an Article Title: Trans amplifying mRNA vaccine expressing consensus spike elicits broad neutralization of SARS CoV 2 variants. Article Snippet: The Article Title: Design of SARS-CoV-2 RBD immunogens to focus immune responses toward conserved coronavirus epitopes. Article Snippet: Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! Labeling:Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base Article Snippet: For the pCG1-SARS-2-BA.2 Sdel18 expression vector, a codon-optimized spike protein nucleotide sequence containing the BA.2 mutations (T19I, ΔL14-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and flanking BamH I and Article Title: Decoding the transcriptome from bulk RNA of infection-naïve versus imprinted patients with SARS-CoV-2 Omicron B.1.1.529. Article Snippet: The results of the melting curve analysis were randomly verified by wholegenome sequencing using the Article Title: SARS-CoV-2 pathogenesis in angiotensin II induced heart-on-a-chip disease model and exosome screening Article Snippet: Primary antibodies used were 1:1000 Article Title: Purification of Messenger RNA Directly from Crude IVT Using Polyethylene Glycol and NaCl Precipitation Article Snippet: The increasing demand for mRNA-based therapeutics requires scalable and cost-effective purification methods.. Chromatography-based approaches, such as Oligo-dT affinity chromatography, require multiple processing steps, including buffer exchange and high-temperature treatments, which can lead to mRNA degradation and increased costs.. Although precipitation is commonly used at the lab scale, its application in large-scale mRNA purification remains underexplored. Article Title: A predisposing effect of HLA class II genes in celiac disease by skewing the naïve CD4 + T-cell receptor repertoire Article Snippet: For 196 of the subjects, the gDNA was used for SNP genotyping with an Article Title: Trans amplifying mRNA vaccine expressing consensus spike elicits broad neutralization of SARS CoV 2 variants. Article Snippet: The Article Title: Design of SARS-CoV-2 RBD immunogens to focus immune responses toward conserved coronavirus epitopes. Article Snippet: Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! Binding Assay:Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base Article Snippet: For the pCG1-SARS-2-BA.2 Sdel18 expression vector, a codon-optimized spike protein nucleotide sequence containing the BA.2 mutations (T19I, ΔL14-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and flanking BamH I and Article Title: Decoding the transcriptome from bulk RNA of infection-naïve versus imprinted patients with SARS-CoV-2 Omicron B.1.1.529. Article Snippet: The results of the melting curve analysis were randomly verified by wholegenome sequencing using the Article Title: SARS-CoV-2 pathogenesis in angiotensin II induced heart-on-a-chip disease model and exosome screening Article Snippet: Primary antibodies used were 1:1000 Article Title: Purification of Messenger RNA Directly from Crude IVT Using Polyethylene Glycol and NaCl Precipitation Article Snippet: The increasing demand for mRNA-based therapeutics requires scalable and cost-effective purification methods.. Chromatography-based approaches, such as Oligo-dT affinity chromatography, require multiple processing steps, including buffer exchange and high-temperature treatments, which can lead to mRNA degradation and increased costs.. Although precipitation is commonly used at the lab scale, its application in large-scale mRNA purification remains underexplored. Article Title: A predisposing effect of HLA class II genes in celiac disease by skewing the naïve CD4 + T-cell receptor repertoire Article Snippet: For 196 of the subjects, the gDNA was used for SNP genotyping with an Article Title: Trans amplifying mRNA vaccine expressing consensus spike elicits broad neutralization of SARS CoV 2 variants. Article Snippet: The Article Title: Design of SARS-CoV-2 RBD immunogens to focus immune responses toward conserved coronavirus epitopes. Article Snippet: Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! Mutagenesis:Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base Article Snippet: For the pCG1-SARS-2-BA.2 Sdel18 expression vector, a codon-optimized spike protein nucleotide sequence containing the BA.2 mutations (T19I, ΔL14-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and flanking BamH I and Article Title: Decoding the transcriptome from bulk RNA of infection-naïve versus imprinted patients with SARS-CoV-2 Omicron B.1.1.529. Article Snippet: The results of the melting curve analysis were randomly verified by wholegenome sequencing using the Article Title: SARS-CoV-2 pathogenesis in angiotensin II induced heart-on-a-chip disease model and exosome screening Article Snippet: Primary antibodies used were 1:1000 Article Title: Purification of Messenger RNA Directly from Crude IVT Using Polyethylene Glycol and NaCl Precipitation Article Snippet: The increasing demand for mRNA-based therapeutics requires scalable and cost-effective purification methods.. Chromatography-based approaches, such as Oligo-dT affinity chromatography, require multiple processing steps, including buffer exchange and high-temperature treatments, which can lead to mRNA degradation and increased costs.. Although precipitation is commonly used at the lab scale, its application in large-scale mRNA purification remains underexplored. Article Title: A predisposing effect of HLA class II genes in celiac disease by skewing the naïve CD4 + T-cell receptor repertoire Article Snippet: For 196 of the subjects, the gDNA was used for SNP genotyping with an Article Title: Trans amplifying mRNA vaccine expressing consensus spike elicits broad neutralization of SARS CoV 2 variants. Article Snippet: The Article Title: Design of SARS-CoV-2 RBD immunogens to focus immune responses toward conserved coronavirus epitopes. Article Snippet: Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! |
