Review



mcherry coding sequence  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    New England Biolabs mcherry coding sequence
    Mcherry Coding Sequence, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1208 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/coding+sequence+for+mcherry/NotI-HF/pm39626663-302-29-35
    Average 99 stars, based on 1208 article reviews
    mcherry coding sequence - by Bioz Stars, 2026-11
    99/100 stars

    Images

    Related Articles

    Virus:

    Article Title: Metazoan lagging-strand DNA synthesis is distributive.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Anti-xPOLA1 This paper N/A Rabbit Anti-xPOLD1 This paper N/A Rabbit Anti-xGINS Terui et al.81 N/A Peroxidase AffiniPure Rabbit Anti-Mouse IgG (H + L) Jackson Immuno Research Labs Cat# 315-035-003; RRID:AB_2340061 Bacterial and virus strains DH5α NEB Cat# C2987H DH10EMBacY Geneva Biotech Cat# DH10EMBacY Rosetta (DE3) pLysS Novagen Cat# 70956-4 Chemicals, peptides, and recombinant proteins BamHI-HF NEB Cat# R3136S BstXI NEB Cat# R0113S HindIII-HF NEB Cat# R3104S NcoI-HF NEB Cat# R3193S NotI-HF NEB Cat# R3189S SalI-HF NEB Cat# R3138S SwaI NEB Cat# R0604S PI-SceI NEB Cat# R0696S PmeI NEB Cat# R0560S XhoI NEB Cat# R0146S Klenow Fragment (3′–5′ exo-) polymerase NEB Cat# M0212S Proteinase K NEB Cat# P8107S [α-32P] dCTP PerkinElmer Cat# BLU513A250UC biotin-dCTP Thermo Fisher Scientific Cat# 19518018 biotin-dGTP PerkinElmer Cat# NEL541001EA L-Cysteine hydrochloride monohydrate Fisher Scientific Cat# ICN10144601 Cycloheximide Sigma Aldrich Cat# 01810 Aprotinin Sigma Aldrich Cat# 11583794001 Leupeptin Sigma Aldrich Cat# 11529048001 Cytochalasin B from Drechslera dematioidea Sigma Aldrich Cat# C6762 Dithiothreitol (DTT) Bio-Rad Cat# 1610611 Nocodazole Sigma Aldrich Cat# M1404 Dimethyl sulfoxide (DMSO) Sigma Aldrich Cat# D8418 Adenosine 5′-triphosphate disodium salt hydrate (ATP) Sigma Aldrich Cat# A7699 Phosphocreatine disodium salt hydrate (PC) Sigma Aldrich Cat# P7956 Creatine Phosphokinase from rabbit muscle (CPK) Sigma Aldrich C3755 FEN1mkikGR Terui et al.81 N/A His6-Human Rhinovirus (HRV) 3C Protease Terui et al.81 N/A Alexa Fluor 647 C2 Maleimide Thermo Fisher Scientific Cat# A20347 Lumidyne 555 CoA Conjugate Lumidyne Technologies Custom Quote Lumidyne 655 CoA Conjugate Lumidyne Technologies Custom Quote (Continued on next page) ll OPEN ACCESS Cell 189, 1–12.e1–e10, December 24, 2026 e1 Short article .. REAGENT or RESOURCE SOURCE IDENTIFIER Ni-NTA Agarose Qiagen Cat# 30230 Imidazole Fisher Scientific Cat# 03196-500 Dynabeads Protein A Invitrogen Cat# 10002D rProtein A Sepharose Fast Flow GE Healthcare Cat# 171279 AminoLink Plus Coupling Resin Fisher Scientific Cat# PI20501 Cellfectin II Reagent Fisher Scientific Cat# 10-362-100 LB Broth Thermo Fisher Scientific Cat# BP9723 LB Agar Thermo Fisher Scientific Cat# BP9724 ESF 921 Insect Cell Culture Medium, Protein Free Expression Systems Cat# 96-001-01 Superdex 200 Increase 10/300 GL Cytiva Cat# 28990944 Mono Q 5/50 GL Cytiva Cat# 17516601 Mono S 5/50 GL Cytiva Cat# 17516801 Amicon Ultra-4-10K Merck Millipore Cat# UFC801024 Spectrum Spectra/Por 1 RC Dialysis Membrane Tubing 6–8 kD Spectrum Labs Cat# 132645 Spectrum Spectra/Por 4 RC Dialysis Membrane Tubing 12–14 kD Spectrum Labs Cat# 132700 Pierce Protease Inhibitor Tablets, EDTAfree ThermoFisher Scientific Cat# A32965 4%–15% Mini-PROTEAN TGX Precast Protein Gels Bio-Rad Cat# 4561086 Tris-Glycine-SDS Running Buffer Boston BioProducts Cat# BP-150 EZ-Run Prestained Rec Protein Ladder Fisher Scientific Cat# BP36031 Precision Plus Protein Dual Color Standard Bio-Rad Cat# 1610374EDU SuperSignal West Pico PLUS Chemiluminescent Substrate Fisher Scientific Cat# PI34577 Optiblot Blue InstantBlue Coomassie Protein Stain Abcam Cat# ab119211 PVDF membranes VWR Cat# 10061-492 Transfer Buffer Fisher Scientific Cat# NC9297917 Phosphate Buffered Saline (10x, pH 7.4) Fisher Scientific Cat# NC9140736 CHORULON Hormone Merck Cat# 133754 75 × 25 × 1 mm Glass Slides VWR Cat# 48300-026 High Precision Glass CoverSlip, No 1.5, 24 × 60 mm Bioscience Tools Cat# CSHP-No1.5-24x60 Double-sided tape Grace Bio-Labs SKU 62001 mPEG-Succinimidyl Valerate, MW 5,000 Laysan Bio Cat# MPEG-SVA-5000-1g Biotin-PEG-SVA, MW 5,000 Laysan Bio Cat# Biotin-PEG-SVA-5000-100MG Streptavidin from Streptomyces avidinii Sigma Aldrich Cat# S4762-5MG Streptavidin, Alexa Fluor 647 conjugate Thermo Fisher Scientific Cat# S21374 Aphidicolin from Nigrospora sphaerica Sigma-Aldrich Cat# A0781-5MG Critical commercial assays Q5 High-Fidelity 2X Master Mix NEB Cat# M0492S NEBuilder HiFi DNA Assembly Master Kit NEB Cat# E2621S ZR BAC DNA Miniprep kit Zymo Research Cat# D4049 Deposited data Raw data from this paper Stanford Digital Repository https://doi.org/10.25740/sq803bx0564 Experimental models: Cell lines Sf9 insect cells Expression Systems Cat# 94-001S (Continued on next page) ll OPEN ACCESS e2 Cell 189, 1–12.e1–e10, December 24, 2026 Short article

    Recombinant:

    Article Title: Metazoan lagging-strand DNA synthesis is distributive.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Anti-xPOLA1 This paper N/A Rabbit Anti-xPOLD1 This paper N/A Rabbit Anti-xGINS Terui et al.81 N/A Peroxidase AffiniPure Rabbit Anti-Mouse IgG (H + L) Jackson Immuno Research Labs Cat# 315-035-003; RRID:AB_2340061 Bacterial and virus strains DH5α NEB Cat# C2987H DH10EMBacY Geneva Biotech Cat# DH10EMBacY Rosetta (DE3) pLysS Novagen Cat# 70956-4 Chemicals, peptides, and recombinant proteins BamHI-HF NEB Cat# R3136S BstXI NEB Cat# R0113S HindIII-HF NEB Cat# R3104S NcoI-HF NEB Cat# R3193S NotI-HF NEB Cat# R3189S SalI-HF NEB Cat# R3138S SwaI NEB Cat# R0604S PI-SceI NEB Cat# R0696S PmeI NEB Cat# R0560S XhoI NEB Cat# R0146S Klenow Fragment (3′–5′ exo-) polymerase NEB Cat# M0212S Proteinase K NEB Cat# P8107S [α-32P] dCTP PerkinElmer Cat# BLU513A250UC biotin-dCTP Thermo Fisher Scientific Cat# 19518018 biotin-dGTP PerkinElmer Cat# NEL541001EA L-Cysteine hydrochloride monohydrate Fisher Scientific Cat# ICN10144601 Cycloheximide Sigma Aldrich Cat# 01810 Aprotinin Sigma Aldrich Cat# 11583794001 Leupeptin Sigma Aldrich Cat# 11529048001 Cytochalasin B from Drechslera dematioidea Sigma Aldrich Cat# C6762 Dithiothreitol (DTT) Bio-Rad Cat# 1610611 Nocodazole Sigma Aldrich Cat# M1404 Dimethyl sulfoxide (DMSO) Sigma Aldrich Cat# D8418 Adenosine 5′-triphosphate disodium salt hydrate (ATP) Sigma Aldrich Cat# A7699 Phosphocreatine disodium salt hydrate (PC) Sigma Aldrich Cat# P7956 Creatine Phosphokinase from rabbit muscle (CPK) Sigma Aldrich C3755 FEN1mkikGR Terui et al.81 N/A His6-Human Rhinovirus (HRV) 3C Protease Terui et al.81 N/A Alexa Fluor 647 C2 Maleimide Thermo Fisher Scientific Cat# A20347 Lumidyne 555 CoA Conjugate Lumidyne Technologies Custom Quote Lumidyne 655 CoA Conjugate Lumidyne Technologies Custom Quote (Continued on next page) ll OPEN ACCESS Cell 189, 1–12.e1–e10, December 24, 2026 e1 Short article .. REAGENT or RESOURCE SOURCE IDENTIFIER Ni-NTA Agarose Qiagen Cat# 30230 Imidazole Fisher Scientific Cat# 03196-500 Dynabeads Protein A Invitrogen Cat# 10002D rProtein A Sepharose Fast Flow GE Healthcare Cat# 171279 AminoLink Plus Coupling Resin Fisher Scientific Cat# PI20501 Cellfectin II Reagent Fisher Scientific Cat# 10-362-100 LB Broth Thermo Fisher Scientific Cat# BP9723 LB Agar Thermo Fisher Scientific Cat# BP9724 ESF 921 Insect Cell Culture Medium, Protein Free Expression Systems Cat# 96-001-01 Superdex 200 Increase 10/300 GL Cytiva Cat# 28990944 Mono Q 5/50 GL Cytiva Cat# 17516601 Mono S 5/50 GL Cytiva Cat# 17516801 Amicon Ultra-4-10K Merck Millipore Cat# UFC801024 Spectrum Spectra/Por 1 RC Dialysis Membrane Tubing 6–8 kD Spectrum Labs Cat# 132645 Spectrum Spectra/Por 4 RC Dialysis Membrane Tubing 12–14 kD Spectrum Labs Cat# 132700 Pierce Protease Inhibitor Tablets, EDTAfree ThermoFisher Scientific Cat# A32965 4%–15% Mini-PROTEAN TGX Precast Protein Gels Bio-Rad Cat# 4561086 Tris-Glycine-SDS Running Buffer Boston BioProducts Cat# BP-150 EZ-Run Prestained Rec Protein Ladder Fisher Scientific Cat# BP36031 Precision Plus Protein Dual Color Standard Bio-Rad Cat# 1610374EDU SuperSignal West Pico PLUS Chemiluminescent Substrate Fisher Scientific Cat# PI34577 Optiblot Blue InstantBlue Coomassie Protein Stain Abcam Cat# ab119211 PVDF membranes VWR Cat# 10061-492 Transfer Buffer Fisher Scientific Cat# NC9297917 Phosphate Buffered Saline (10x, pH 7.4) Fisher Scientific Cat# NC9140736 CHORULON Hormone Merck Cat# 133754 75 × 25 × 1 mm Glass Slides VWR Cat# 48300-026 High Precision Glass CoverSlip, No 1.5, 24 × 60 mm Bioscience Tools Cat# CSHP-No1.5-24x60 Double-sided tape Grace Bio-Labs SKU 62001 mPEG-Succinimidyl Valerate, MW 5,000 Laysan Bio Cat# MPEG-SVA-5000-1g Biotin-PEG-SVA, MW 5,000 Laysan Bio Cat# Biotin-PEG-SVA-5000-100MG Streptavidin from Streptomyces avidinii Sigma Aldrich Cat# S4762-5MG Streptavidin, Alexa Fluor 647 conjugate Thermo Fisher Scientific Cat# S21374 Aphidicolin from Nigrospora sphaerica Sigma-Aldrich Cat# A0781-5MG Critical commercial assays Q5 High-Fidelity 2X Master Mix NEB Cat# M0492S NEBuilder HiFi DNA Assembly Master Kit NEB Cat# E2621S ZR BAC DNA Miniprep kit Zymo Research Cat# D4049 Deposited data Raw data from this paper Stanford Digital Repository https://doi.org/10.25740/sq803bx0564 Experimental models: Cell lines Sf9 insect cells Expression Systems Cat# 94-001S (Continued on next page) ll OPEN ACCESS e2 Cell 189, 1–12.e1–e10, December 24, 2026 Short article

    Plasmid Preparation:

    Article Title: The RNA-binding proteins Ddx6 and Ddx61 support development in mRNA-decay deficient pnrc2 mutants.
    Article Snippet: Riboprobe for rhov was synthesized from a plasmid containing the rhov cDNA (cb832) received from the Zebrafish International Resource Center (ZIRC). .. rhov-containing plasmid was linearized with NotI-HF (NEB) and transcribed with T7 RNA polymerase (Roche Life Science) to make DIG-labeled antisense rhov riboprobe. ..

    Article Title: Pharmacological inhibition of MCL-1 disrupts mitochondrial cristae and depletes the human neural progenitor cell pool.
    Article Snippet: .. The PCR was followed by a double restriction digest of NotI (New England Biolabs, R3189L) and PacI (New England Biolabs, R0547L) on the PCR product of the ACSL1– HaloTag plasmid and the lentiviral vector backbone at 37°C for 1 h. The digest was purified via gel extraction (Takara Bio, 740609.250), quantified via Nanodrop, and a 1:3 vector-to-insert molar ratio was used for the ligation step. .. The digested ACSL1–HaloTag insert and lentiviral backbone were incubated with T4 DNA Ligase (New England Biolabs, M0202L) overnight at 16°C.

    Article Title: Sustained Relief of Chronic Pain via a Na v 1.7-Targeting ASO-siRNA Conjugate in Rats.
    Article Snippet: 576 577 psiCHECK assay 578 Off-target activity was assessed using the Dual-Glo Luciferase Assay System (Promega, 579 Cat. E2920). .. The psiCHECK-2 vector contains a constitutively expressed firefly luciferase 580 cassette and a multiple cloning site located in the 3’-UTR of the Renilla luciferase gene.80 581 Oligonucleotides containing three tandem repeats of seed-matched (SM) sequences (Table 582 S5) were synthesized with XhoI (New England Biolabs, Cat. R0146S) and NotI (New 583 England Biolabs, Cat. R3189S) restriction sites at the ends. ..

    Article Title: Unilateral gene expression via maternally controlled zygotic recombination in Drosophila
    Article Snippet: All sequence analysis and construct design was performed in Geneious (Dotmatics). .. CaSpeR4-SGS plasmid ( smg5’UTR-GFP-smg3’UTR ; kind gift of Howard Lipshitz) containing a GFP open reading frame flanked by smg UTRs was verified for sequence integrity via NotI-HF and NheI-HF restriction analysis (New England Biolabs, #R3189S and #R3131S). .. CaSpeR4-SGS was transformed into chemically competent E. coli (OneShot Top10, Invitrogen).

    Article Title: The autosomal deubiquitylase Trabid drives sex-divergent neurodegeneration in Drosophila
    Article Snippet: Trabid-AnkOTU was cloned using “ctggaagtggatccGACA CCCTGCAAGAGCGTCAAGAG” and “CCGCGGGCCCTCTAGA ttaTTCTTCGTCGGAGTCGCCGTC” primers by Phusion polymerase (NEB, UK). .. pAC5 plasmid backbone was digested NotI-HF and XbaI Communications Biology Article in Press restriction enzymes (NEB, UK). .. The PCR fragments and digested backbones were assembled by NEBuilder HiFi DNA Assembly Cloning Kit (NEB, UK).

    Purification:

    Article Title: Functional roles for viral RNA ribosylation in mammalian cells.
    Article Snippet: .. Briefly, an infectious clone of 181/25 was linearized with NotI-HF (NEB), purified, and used as a template for in vitro transcription using mMessage Machine Kit (Invitrogen) according to the manufacturer’s directions. ..

    Article Title: Pharmacological inhibition of MCL-1 disrupts mitochondrial cristae and depletes the human neural progenitor cell pool.
    Article Snippet: .. The PCR was followed by a double restriction digest of NotI (New England Biolabs, R3189L) and PacI (New England Biolabs, R0547L) on the PCR product of the ACSL1– HaloTag plasmid and the lentiviral vector backbone at 37°C for 1 h. The digest was purified via gel extraction (Takara Bio, 740609.250), quantified via Nanodrop, and a 1:3 vector-to-insert molar ratio was used for the ligation step. .. The digested ACSL1–HaloTag insert and lentiviral backbone were incubated with T4 DNA Ligase (New England Biolabs, M0202L) overnight at 16°C.

    In Vitro Transcription:

    Article Title: Functional roles for viral RNA ribosylation in mammalian cells.
    Article Snippet: .. Briefly, an infectious clone of 181/25 was linearized with NotI-HF (NEB), purified, and used as a template for in vitro transcription using mMessage Machine Kit (Invitrogen) according to the manufacturer’s directions. ..

    Polymerase Chain Reaction:

    Article Title: Pharmacological inhibition of MCL-1 disrupts mitochondrial cristae and depletes the human neural progenitor cell pool.
    Article Snippet: .. The PCR was followed by a double restriction digest of NotI (New England Biolabs, R3189L) and PacI (New England Biolabs, R0547L) on the PCR product of the ACSL1– HaloTag plasmid and the lentiviral vector backbone at 37°C for 1 h. The digest was purified via gel extraction (Takara Bio, 740609.250), quantified via Nanodrop, and a 1:3 vector-to-insert molar ratio was used for the ligation step. .. The digested ACSL1–HaloTag insert and lentiviral backbone were incubated with T4 DNA Ligase (New England Biolabs, M0202L) overnight at 16°C.

    Restriction Assay:

    Article Title: Pharmacological inhibition of MCL-1 disrupts mitochondrial cristae and depletes the human neural progenitor cell pool.
    Article Snippet: .. The PCR was followed by a double restriction digest of NotI (New England Biolabs, R3189L) and PacI (New England Biolabs, R0547L) on the PCR product of the ACSL1– HaloTag plasmid and the lentiviral vector backbone at 37°C for 1 h. The digest was purified via gel extraction (Takara Bio, 740609.250), quantified via Nanodrop, and a 1:3 vector-to-insert molar ratio was used for the ligation step. .. The digested ACSL1–HaloTag insert and lentiviral backbone were incubated with T4 DNA Ligase (New England Biolabs, M0202L) overnight at 16°C.

    Gel Extraction:

    Article Title: Pharmacological inhibition of MCL-1 disrupts mitochondrial cristae and depletes the human neural progenitor cell pool.
    Article Snippet: .. The PCR was followed by a double restriction digest of NotI (New England Biolabs, R3189L) and PacI (New England Biolabs, R0547L) on the PCR product of the ACSL1– HaloTag plasmid and the lentiviral vector backbone at 37°C for 1 h. The digest was purified via gel extraction (Takara Bio, 740609.250), quantified via Nanodrop, and a 1:3 vector-to-insert molar ratio was used for the ligation step. .. The digested ACSL1–HaloTag insert and lentiviral backbone were incubated with T4 DNA Ligase (New England Biolabs, M0202L) overnight at 16°C.

    Ligation:

    Article Title: Pharmacological inhibition of MCL-1 disrupts mitochondrial cristae and depletes the human neural progenitor cell pool.
    Article Snippet: .. The PCR was followed by a double restriction digest of NotI (New England Biolabs, R3189L) and PacI (New England Biolabs, R0547L) on the PCR product of the ACSL1– HaloTag plasmid and the lentiviral vector backbone at 37°C for 1 h. The digest was purified via gel extraction (Takara Bio, 740609.250), quantified via Nanodrop, and a 1:3 vector-to-insert molar ratio was used for the ligation step. .. The digested ACSL1–HaloTag insert and lentiviral backbone were incubated with T4 DNA Ligase (New England Biolabs, M0202L) overnight at 16°C.

    Luciferase:

    Article Title: Sustained Relief of Chronic Pain via a Na v 1.7-Targeting ASO-siRNA Conjugate in Rats.
    Article Snippet: 576 577 psiCHECK assay 578 Off-target activity was assessed using the Dual-Glo Luciferase Assay System (Promega, 579 Cat. E2920). .. The psiCHECK-2 vector contains a constitutively expressed firefly luciferase 580 cassette and a multiple cloning site located in the 3’-UTR of the Renilla luciferase gene.80 581 Oligonucleotides containing three tandem repeats of seed-matched (SM) sequences (Table 582 S5) were synthesized with XhoI (New England Biolabs, Cat. R0146S) and NotI (New 583 England Biolabs, Cat. R3189S) restriction sites at the ends. ..

    Cloning:

    Article Title: Sustained Relief of Chronic Pain via a Na v 1.7-Targeting ASO-siRNA Conjugate in Rats.
    Article Snippet: 576 577 psiCHECK assay 578 Off-target activity was assessed using the Dual-Glo Luciferase Assay System (Promega, 579 Cat. E2920). .. The psiCHECK-2 vector contains a constitutively expressed firefly luciferase 580 cassette and a multiple cloning site located in the 3’-UTR of the Renilla luciferase gene.80 581 Oligonucleotides containing three tandem repeats of seed-matched (SM) sequences (Table 582 S5) were synthesized with XhoI (New England Biolabs, Cat. R0146S) and NotI (New 583 England Biolabs, Cat. R3189S) restriction sites at the ends. ..

    Synthesized:

    Article Title: Sustained Relief of Chronic Pain via a Na v 1.7-Targeting ASO-siRNA Conjugate in Rats.
    Article Snippet: 576 577 psiCHECK assay 578 Off-target activity was assessed using the Dual-Glo Luciferase Assay System (Promega, 579 Cat. E2920). .. The psiCHECK-2 vector contains a constitutively expressed firefly luciferase 580 cassette and a multiple cloning site located in the 3’-UTR of the Renilla luciferase gene.80 581 Oligonucleotides containing three tandem repeats of seed-matched (SM) sequences (Table 582 S5) were synthesized with XhoI (New England Biolabs, Cat. R0146S) and NotI (New 583 England Biolabs, Cat. R3189S) restriction sites at the ends. ..

    Sequencing:

    Article Title: Unilateral gene expression via maternally controlled zygotic recombination in Drosophila
    Article Snippet: All sequence analysis and construct design was performed in Geneious (Dotmatics). .. CaSpeR4-SGS plasmid ( smg5’UTR-GFP-smg3’UTR ; kind gift of Howard Lipshitz) containing a GFP open reading frame flanked by smg UTRs was verified for sequence integrity via NotI-HF and NheI-HF restriction analysis (New England Biolabs, #R3189S and #R3131S). .. CaSpeR4-SGS was transformed into chemically competent E. coli (OneShot Top10, Invitrogen).

    Analysis:

    Article Title: Unilateral gene expression via maternally controlled zygotic recombination in Drosophila
    Article Snippet: All sequence analysis and construct design was performed in Geneious (Dotmatics). .. CaSpeR4-SGS plasmid ( smg5’UTR-GFP-smg3’UTR ; kind gift of Howard Lipshitz) containing a GFP open reading frame flanked by smg UTRs was verified for sequence integrity via NotI-HF and NheI-HF restriction analysis (New England Biolabs, #R3189S and #R3131S). .. CaSpeR4-SGS was transformed into chemically competent E. coli (OneShot Top10, Invitrogen).

    other:

    Article Title: Small molecules rescue pathogenic POLGA aggregation and restore its functions in a mouse model of PEO.
    Article Snippet: Polyclonal Antibody, Rabbit polyclonal, living colours antibody (used Takara Cat# 632460 © The Author(s) EMBO Molecular Medicine 13 Reagent/resource Reference or source Identifier or Catalogue Number for YFP) (used for WB, IP) Tom20 (D8T4N), Rabbit monoclonal (used for WB) Cell Signalling Technology Cat# 42406 OPA1 (D6U6N), Rabbit monoclonal (used for WB) Cell Signalling Technology Cat# 80471 DRP1 (D6C7), Rabbit monoclonal (used for WB) Cell Signalling Technology Cat# 8570 Phospho-DRP1 (Ser616) (D9A1), Rabbit monoclonal (used for WB) Cell Signalling Technology Cat# 4494 Phospho-DRP1 (Ser637) (D3A4), Rabbit monoclonal (used for WB) Cell Signalling Technology Cat# 6319 MFF (E5W4M), Rabbit monoclonal (used for WB) Cell Signalling Technology Cat# 84580 MFN-1 (D6E2S), Rabbit monoclonal (used for WB) Cell Signalling Technology Cat# 14739 MFN2 (D1E9), Rabbit monoclonal (used for WB) Cell Signalling Technology Cat# 11925 Anti-Laminin, Rabbit antibody (used for IF) Sigma-Aldrich Cat# L9393 Anti-ATG12 antibody, Rabbit Polyclonal (used for WB) Abcam Cat# ab155589 Anti-Cytochrome C antibody, Mouse monoclonal (used for IF) Novus Biologicals Cat# NB100-56503 COX IV antibody, Rabbit antibody (used for IF) Cell Signalling Technology Cat# 4844 Myc-Tag (71D10), Rabbit monoclonal antibody (used for WB) Cell Signalling Technology Cat# 2278 Anti-His, Mouse monoclonal antibody (used for WB) Santa Cruz Biotechnology Cat# Sc 8036 Anti- β actin, Mouse monoclonal antibody (used for WB) Santa Cruz Biotechnology Cat# Sc 47778 Anti-GST, Rabbit antibody (used for WB) Thermo Fisher Scientific Cat# 71-7500 DNA Polymerase gamma Antibody; Rabbit Polyclonal (used for IF) Thermo Fisher Scientific Cat# BS-13017R Anti-RECQL4 (used for WB, IP) Santa Cruz Biotechnology Cat# sc-366840 Oligonucleotides and other sequence-based reagents Cloning primers This study Table EV3 Reagent/resource Reference or source Identifier or Catalogue Number Genotyping PCR primer (SilvaPinheiro et al, 2021) Table EV3 Long-range mtDNA amplification primer (Chi et al, 2012) Table EV3 Primer extension assay primer (Gupta et al, 2014; Hussain et al, 2021) Table EV3 Exonuclease assay primer (Gupta et al, 2014) Table EV3 mtDNA copy number primer N/A Table EV3 Chemicals, enzymes and other reagents IPTG Merck Cat# I6758; CAS Number 367-93-1 Paraformaldehyde Merck Cat# 158127; CAS Number 30525-89-4 PMSF Merck Cat# P7626; CAS Number 329-98-6 Acrylamide Merck Cat# 110784; CAS Number 79-06-1 DTT Merck Cat# D0632; CAS Number 3483-12-3 Sodium deoxycholate Merck Cat# D6750; CAS Number 302-95-4 Tween 20 Sigma-Aldrich Cat# P7949; CAS Number 9005-64-5 Triton X-100 Merck Cat# T9284; CAS Number 9002-93-1 ATP Merck Cat# A9187; CAS Number 74804-12-9 DMSO Merck Cat# D2650; CAS Number 67-68-5 PMSF Sigma-Aldrich Cat# P7626; CAS Number 329-98-6 Imidazole Bio Basic Cat# IB0277; CAS Number 288-32-4 Lysozyme Sigma-Aldrich Cat# L4919; CAS Number 12650-88-3 Proteinase K Bio Basic Cat# PB0451; CAS Number 39450-01-6 L-Glutathione reduced Merck Cat# G6529; CAS Number 70-18-8 N, N′Methylenebisacrylamide Sigma-Aldrich Cat# M7279; CAS Number 110-26-9 Puromycin Sigma-Aldrich Cat# P8833; CAS Number 58-58-2 HEPES Sigma-Aldrich Cat# H3375; CAS Number 7365-45-9 EDTA Merck Cat# 324503; CAS Number 6381-92-6 EGTA Merck Cat# 324626; CAS Number 67-42-5 Na2HPO4 Merck Cat# 106559; CAS Number 7558-79-4 KCl Merck Cat# 104936; CAS Number 7447-40-7 14 EMBO Molecular Medicine © The Author(s) Reagent/resource Reference or source Identifier or Catalogue Number NaCl Merck Cat# 106406; CAS Number 7647-14-5 MgCl2 Sigma-Aldrich Cat# 814733; CAS Number: 7786-30-3 BSA Sigma-Aldrich Cat# SRE0098; CAS Number: 9048-46-8 2-Mercaptoethanol Sigma-Aldrich Cat# 63689; CAS Number: 60-24-2 SDS Sigma-Aldrich Cat# L3771; CAS Number: 151-21-3 Tris(hydroxymethyl) aminomethane Millipore Cat# 108382; CAS Number: 77-86-1 Glycine Millipore Cat# 3570; CAS Number: 56-40-6 Sucrose Sigma-Aldrich Cat# S9378; CAS Number: 57-50-1 Methanol Merck CAS Number: 67-56-1 CCCP Sigma-Aldrich Cat# C2759; CAS Number 555-60-2 BrdU Sigma-Aldrich Cat# B5002; CAS Number 59-14-3 IPTG Sigma-Aldrich Cat# I6758; CAS Number 367-93-1 MG132 Merck Cat# 474787; CAS Number 133407-82-6 Uridine Sigma-Aldrich Cat# U3003; CAS Number 58-96-8 Verapamil hydrochloride Merck CAS Number 152-11-4 Tazobactam Merck CAS Number 89786- 04-9 Clavulanic acid Merck CAS Number 58001- 44-8 D (-)-Mannitol Pure Merck Cat# M9647; CAS Number 69-65-8 Ampicillin Bio Basic Cat# AB0028 Kanamycin Bio Basic Cat# KB0286 Hygromycin B Sigma-Aldrich Cat# H7772 Penicillin-StreptomycinAmphotericin B Solution Biological industries Cat# 03-033-1B KH2PO4 Merck Cat# 104873; CAS Number 7778-77-0 Ethanol Merck Cat# 100983; CAS Number 64-17-5 Glycerol Merck Cat# 107051; CAS Number 56-81-5 TEMED Bio-Rad Cat# 1610801 Ammonium Persulfate Sigma-Aldrich Cat# A3678; CAS Number 7727-54-0 Coomassie brilliant blue-R-250 Bio-Rad Cat# 1610400 Ethidium bromide (EtBr) Sigma-Aldrich Cat# E7637 Luria Bertani Broth, Miller Himedia Cat# M1245 Reagent/resource Reference or source Identifier or Catalogue Number Luria Bertani Agar, Miller Himedia Cat# M1151 Skim milk powder Himedia Cat# GRM1254 Agarose Sigma-Aldrich Cat# A9539 Foetal bovine Serum Thermo Fisher Scientific Cat# 10082147 Advanced DMEM Thermo Fisher Scientific Cat# 12491-023 DMEM/F-12 medium Thermo Fisher Scientific Cat# 11320033 Horse serum Thermo Fisher Scientific Cat# 16050130 OptiMem reduced serum medium Thermo Fisher Scientific Cat# 31985-088 Complete Protease Cocktail inhibitor Roche Cat# 116974980 BL21 (DE3) competent cells Thermo Fisher Scientific Cat# EC0114 Poly-Prep Chromatography column Bio-Rad Cat# 73101550 Mounting medium with DAPI Vector Laboratories Cat# H-1200 Nhe1-HF New England BioLabs Cat# R3131 Not1-HF New England BioLabs Cat# R3189 Spe1-HF New England BioLabs Cat# R3133 XhoI New England BioLabs Cat# R0146 BamHI-HF New England BioLabs Cat# R3136 HindIII-HF New England BioLabs Cat# R3104 Glutathione SSepharose beads Cytiva Cat# 17-5279-02 ANTI-FLAG M2 Affinity Gel Sigma-Aldrich Cat# A2220 Sepharose CL-6B Sigma-Aldrich Cat# CL6B200 3X Flag peptide Sigma-Aldrich Cat# F4799 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668019 LongAmp Taq DNA polymerase New England Biolabs Cat# M0323L Immobilon Western Chemiluminescent HRP substrate Merck Cat# WBKLS0500 10Χ PBS Sartorius Cat# 02-023-5 A Trypsin (2.5%) Thermo Fisher Scientific Cat# 15090046 L-Glutamine solution Biological industries Cat# 03-020-1B Prestained Low Molecular weight markers Bio-Rad Cat# 1610374 Wide range DNA marker Sigma-Aldrich Cat# D7058 Nitrocellulose membrane Bio-Rad Cat# 1620115 Streptavidin Agarose Millipore Cat# 69203 T7 Quick-coupled Transcription/ Translation system Promega Cat# L2080 © The Author(s) EMBO Molecular Medicine 15 Reagent/resource Reference or source Identifier or Catalogue Number Software GraphPad Prism 9 https://www.graphpad.



    Similar Products

    coding sequence for mcherry  (Benchling Inc)
    90
    Benchling Inc coding sequence for mcherry
    Coding Sequence For Mcherry, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/coding+sequence+for+mcherry/coding+sequence+for+mcherry/pmc11573670__pnas__2418037121__sapp-90-12-33
    Average 90 stars, based on 1 article reviews
    coding sequence for mcherry - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    mcherry coding sequence  (Addgene inc)
    90
    Addgene inc mcherry coding sequence
    Mcherry Coding Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/coding+sequence+for+mcherry/mcherry+coding+sequence/pm40030016-340-5-15
    Average 90 stars, based on 1 article reviews
    mcherry coding sequence - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    dna coding sequences (cds) of the candidate immunogens and the mcherry reporter, and the flanking sequences  (GenScript corporation)
    90
    GenScript corporation dna coding sequences (cds) of the candidate immunogens and the mcherry reporter, and the flanking sequences
    Dna Coding Sequences (Cds) Of The Candidate Immunogens And The Mcherry Reporter, And The Flanking Sequences, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/coding+sequence+for+mcherry/dna+coding+sequences/pm39905025-114-15-20
    Average 90 stars, based on 1 article reviews
    dna coding sequences (cds) of the candidate immunogens and the mcherry reporter, and the flanking sequences - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    mcherry coding sequence  (New England Biolabs)
    99
    New England Biolabs mcherry coding sequence
    Mcherry Coding Sequence, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/coding+sequence+for+mcherry/NotI-HF/pm39626663-302-29-35
    Average 99 stars, based on 1 article reviews
    mcherry coding sequence - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    f tractin mcherry coding sequence  (Addgene inc)
    93
    Addgene inc f tractin mcherry coding sequence
    F Tractin Mcherry Coding Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/coding+sequence+for+mcherry/C1-F-tractin-mCherry+(Plasmid+%23155218)/pmc11411054-342-9-14
    Average 93 stars, based on 1 article reviews
    f tractin mcherry coding sequence - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    mcherry coding sequences  (TaKaRa)
    86
    TaKaRa mcherry coding sequences
    ( A ) Top: domain diagram of WT Hop1. Bottom: diagram of the deleted or mutated Hop1 sites in the 6 analyzed mutants (). ( B ) Protein localization and phenotypes of the hop1-HORMAΔ mutant. Top: In the hop1Δ background, the mutant protein tagged with <t>mCherry</t> (mC, left) is not visible along the axes, marked <t>by</t> <t>Spo76-GFP</t> (middle) and merge (right). Bottom: colocalization with Ecm11-GFP + Hei10-GFP (middle) indicates that only few SC segments (containing Hei10 foci, arrows) are formed in this mutant; right corresponding DAPI. ( C, D ) hop1-HORMAΔ SCs exhibit the same length ( C ) and Hei10 foci number ( D ) as hop1Δ . Mean and error bar (SD) are indicated for each set. Significance between WT, hop1Δ and hop1-HORMAΔ nuclei was established by Brown–Forsythe ANOVA test: ns = not significant, P -value > 0.05; n = 38 and 42 nuclei. ( E ) hop1-only-HORMA . Top: the HORMA domain alone is sufficient for axis localization of the protein but only as discontinuous segments (arrows) that colocalize with Spo76-GFP (arrows middle and merge right) in contrast to the continuous lines seen in WT with Hop1-mCherry (right). Bottom: colocalization of Hop1-only-HORMA-mC (left) with Ecm11-GFP and Hei10-GFP (middle) and merge (right) indicates that the visible mutant segments correspond to SCs. ( C ) The mutant SCs have the same length as hop1Δ SCs ( C ) but exhibit a slightly lower number of Hei10 foci ( D ): Brown–Forsythe ANOVA test, ns = not significant; n = 31 and 42 nuclei. Scale bars: 2 μm. The raw data underlying panels 6C and 6D are available in . SC, synaptonemal complex; WT, wild-type.
    Mcherry Coding Sequences, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/coding+sequence+for+mcherry/pmc11244814-323-2-6
    Average 86 stars, based on 1 article reviews
    mcherry coding sequences - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    dta coding sequence  (Addgene inc)
    93
    Addgene inc dta coding sequence
    a, Diagram illustrating the injection <t>of</t> <t>AAV-hMAG-mCherry</t> and <t>AAV-hMAG-DTA</t> into the mouse cerebellum at early postnatal days (P6-7). b, Fluorescence microscopy image showing mCherry expression (red) in the section of cerebellum at P14 following AAV-hMAG-mCherry injection at P7. Scale bar, 300 µm. c, Specificity of mCherry expression (red) in ASPA-positive oligodendrocytes (green) at P14 by AAV-hMAG-mCherry injection at P7. Scale bar, 100 µm. d, Scatter plot graph depicting the percentage of RFP and ASPA double-positive cells among RFP-positive populations (from 2 mice). e, Sequential visualization of oligodendrocyte deletion over time, indicated by ASPA staining in cerebellar sections from control (AAV-hMAG-mCherry) and DTA-treated (AAV-hMAG-DTA) mice at P10, P14, P21, and P78. Scale bar, 100 µm. f, Quantification of ASPA-positive cell density at each stage (from 3 mice per group per each stage). Bars and dots indicate mean and data from individual fields of view, respectively. g-i, Decrease in correlation coefficients (CCs) indicating reduced synchrony of spontaneous activities among PC population at P13-15 following DTA-mediated oligodendrocyte ablation. g, Representative time-course of spontaneous calcium transients by extracting relative fluorescence changes by in vivo calcium imaging captured from 25 regions of interest (ROIs) in the cerebellum of control and DTA-expressing mice at P14. Scale bar = 20 s. Y-axis is ΔF/F0 = (F - F0)/(F0). h, Correlation coefficient matrices for spontaneous calcium transient activity across multiple ROIs in CTL (upper panel) and DTA (lower panel) mice, with the color scale indicating the strength of the correlation between pairs of ROIs. i, Scatter plot graph of CCs for ROI pairs, categorized by separation distances of 0–80 mm and 120–200 mm (analyzed from four mice per group). Lines and plots indicate mean and data from individual separation distances, respectively. j-l, Quantification of the frequency, amplitude, and integrated area of calcium transients in control (AAV-hMAG-mCherry) and DTA-treated (AAV-hMAG-DTA) mice at P13-15 (data from four mice per group). Bars and dots indicate mean and data from individual ROIs, respectively. **** p < 0.0001 (Mann-Whitney U test).
    Dta Coding Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/coding+sequence+for+mcherry/pAAV-mCherry-flex-dtA+(Plasmid+%2358536)/bio_rxiv__2024__05__06__590880-133-5-16
    Average 93 stars, based on 1 article reviews
    dta coding sequence - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    ( A ) Top: domain diagram of WT Hop1. Bottom: diagram of the deleted or mutated Hop1 sites in the 6 analyzed mutants (). ( B ) Protein localization and phenotypes of the hop1-HORMAΔ mutant. Top: In the hop1Δ background, the mutant protein tagged with mCherry (mC, left) is not visible along the axes, marked by Spo76-GFP (middle) and merge (right). Bottom: colocalization with Ecm11-GFP + Hei10-GFP (middle) indicates that only few SC segments (containing Hei10 foci, arrows) are formed in this mutant; right corresponding DAPI. ( C, D ) hop1-HORMAΔ SCs exhibit the same length ( C ) and Hei10 foci number ( D ) as hop1Δ . Mean and error bar (SD) are indicated for each set. Significance between WT, hop1Δ and hop1-HORMAΔ nuclei was established by Brown–Forsythe ANOVA test: ns = not significant, P -value > 0.05; n = 38 and 42 nuclei. ( E ) hop1-only-HORMA . Top: the HORMA domain alone is sufficient for axis localization of the protein but only as discontinuous segments (arrows) that colocalize with Spo76-GFP (arrows middle and merge right) in contrast to the continuous lines seen in WT with Hop1-mCherry (right). Bottom: colocalization of Hop1-only-HORMA-mC (left) with Ecm11-GFP and Hei10-GFP (middle) and merge (right) indicates that the visible mutant segments correspond to SCs. ( C ) The mutant SCs have the same length as hop1Δ SCs ( C ) but exhibit a slightly lower number of Hei10 foci ( D ): Brown–Forsythe ANOVA test, ns = not significant; n = 31 and 42 nuclei. Scale bars: 2 μm. The raw data underlying panels 6C and 6D are available in . SC, synaptonemal complex; WT, wild-type.

    Journal: PLOS Biology

    Article Title: Canonical and noncanonical roles of Hop1 are crucial for meiotic prophase in the fungus Sordaria macrospora

    doi: 10.1371/journal.pbio.3002705

    Figure Lengend Snippet: ( A ) Top: domain diagram of WT Hop1. Bottom: diagram of the deleted or mutated Hop1 sites in the 6 analyzed mutants (). ( B ) Protein localization and phenotypes of the hop1-HORMAΔ mutant. Top: In the hop1Δ background, the mutant protein tagged with mCherry (mC, left) is not visible along the axes, marked by Spo76-GFP (middle) and merge (right). Bottom: colocalization with Ecm11-GFP + Hei10-GFP (middle) indicates that only few SC segments (containing Hei10 foci, arrows) are formed in this mutant; right corresponding DAPI. ( C, D ) hop1-HORMAΔ SCs exhibit the same length ( C ) and Hei10 foci number ( D ) as hop1Δ . Mean and error bar (SD) are indicated for each set. Significance between WT, hop1Δ and hop1-HORMAΔ nuclei was established by Brown–Forsythe ANOVA test: ns = not significant, P -value > 0.05; n = 38 and 42 nuclei. ( E ) hop1-only-HORMA . Top: the HORMA domain alone is sufficient for axis localization of the protein but only as discontinuous segments (arrows) that colocalize with Spo76-GFP (arrows middle and merge right) in contrast to the continuous lines seen in WT with Hop1-mCherry (right). Bottom: colocalization of Hop1-only-HORMA-mC (left) with Ecm11-GFP and Hei10-GFP (middle) and merge (right) indicates that the visible mutant segments correspond to SCs. ( C ) The mutant SCs have the same length as hop1Δ SCs ( C ) but exhibit a slightly lower number of Hei10 foci ( D ): Brown–Forsythe ANOVA test, ns = not significant; n = 31 and 42 nuclei. Scale bars: 2 μm. The raw data underlying panels 6C and 6D are available in . SC, synaptonemal complex; WT, wild-type.

    Article Snippet: GFP and mCherry coding sequences (p-EGFP-1, Clontech; pRsetB-mCherry) were fused to the C-terminus of HOP1 under the control of the HOP1 promoter.

    Techniques: Mutagenesis

    a, Diagram illustrating the injection of AAV-hMAG-mCherry and AAV-hMAG-DTA into the mouse cerebellum at early postnatal days (P6-7). b, Fluorescence microscopy image showing mCherry expression (red) in the section of cerebellum at P14 following AAV-hMAG-mCherry injection at P7. Scale bar, 300 µm. c, Specificity of mCherry expression (red) in ASPA-positive oligodendrocytes (green) at P14 by AAV-hMAG-mCherry injection at P7. Scale bar, 100 µm. d, Scatter plot graph depicting the percentage of RFP and ASPA double-positive cells among RFP-positive populations (from 2 mice). e, Sequential visualization of oligodendrocyte deletion over time, indicated by ASPA staining in cerebellar sections from control (AAV-hMAG-mCherry) and DTA-treated (AAV-hMAG-DTA) mice at P10, P14, P21, and P78. Scale bar, 100 µm. f, Quantification of ASPA-positive cell density at each stage (from 3 mice per group per each stage). Bars and dots indicate mean and data from individual fields of view, respectively. g-i, Decrease in correlation coefficients (CCs) indicating reduced synchrony of spontaneous activities among PC population at P13-15 following DTA-mediated oligodendrocyte ablation. g, Representative time-course of spontaneous calcium transients by extracting relative fluorescence changes by in vivo calcium imaging captured from 25 regions of interest (ROIs) in the cerebellum of control and DTA-expressing mice at P14. Scale bar = 20 s. Y-axis is ΔF/F0 = (F - F0)/(F0). h, Correlation coefficient matrices for spontaneous calcium transient activity across multiple ROIs in CTL (upper panel) and DTA (lower panel) mice, with the color scale indicating the strength of the correlation between pairs of ROIs. i, Scatter plot graph of CCs for ROI pairs, categorized by separation distances of 0–80 mm and 120–200 mm (analyzed from four mice per group). Lines and plots indicate mean and data from individual separation distances, respectively. j-l, Quantification of the frequency, amplitude, and integrated area of calcium transients in control (AAV-hMAG-mCherry) and DTA-treated (AAV-hMAG-DTA) mice at P13-15 (data from four mice per group). Bars and dots indicate mean and data from individual ROIs, respectively. **** p < 0.0001 (Mann-Whitney U test).

    Journal: bioRxiv

    Article Title: Oligodendrocyte dependent synchronized activity orchestrates circuit maturation and brain functionalization

    doi: 10.1101/2024.05.06.590880

    Figure Lengend Snippet: a, Diagram illustrating the injection of AAV-hMAG-mCherry and AAV-hMAG-DTA into the mouse cerebellum at early postnatal days (P6-7). b, Fluorescence microscopy image showing mCherry expression (red) in the section of cerebellum at P14 following AAV-hMAG-mCherry injection at P7. Scale bar, 300 µm. c, Specificity of mCherry expression (red) in ASPA-positive oligodendrocytes (green) at P14 by AAV-hMAG-mCherry injection at P7. Scale bar, 100 µm. d, Scatter plot graph depicting the percentage of RFP and ASPA double-positive cells among RFP-positive populations (from 2 mice). e, Sequential visualization of oligodendrocyte deletion over time, indicated by ASPA staining in cerebellar sections from control (AAV-hMAG-mCherry) and DTA-treated (AAV-hMAG-DTA) mice at P10, P14, P21, and P78. Scale bar, 100 µm. f, Quantification of ASPA-positive cell density at each stage (from 3 mice per group per each stage). Bars and dots indicate mean and data from individual fields of view, respectively. g-i, Decrease in correlation coefficients (CCs) indicating reduced synchrony of spontaneous activities among PC population at P13-15 following DTA-mediated oligodendrocyte ablation. g, Representative time-course of spontaneous calcium transients by extracting relative fluorescence changes by in vivo calcium imaging captured from 25 regions of interest (ROIs) in the cerebellum of control and DTA-expressing mice at P14. Scale bar = 20 s. Y-axis is ΔF/F0 = (F - F0)/(F0). h, Correlation coefficient matrices for spontaneous calcium transient activity across multiple ROIs in CTL (upper panel) and DTA (lower panel) mice, with the color scale indicating the strength of the correlation between pairs of ROIs. i, Scatter plot graph of CCs for ROI pairs, categorized by separation distances of 0–80 mm and 120–200 mm (analyzed from four mice per group). Lines and plots indicate mean and data from individual separation distances, respectively. j-l, Quantification of the frequency, amplitude, and integrated area of calcium transients in control (AAV-hMAG-mCherry) and DTA-treated (AAV-hMAG-DTA) mice at P13-15 (data from four mice per group). Bars and dots indicate mean and data from individual ROIs, respectively. **** p < 0.0001 (Mann-Whitney U test).

    Article Snippet: For AAV-hMAG-DTA, we amplified the DTA coding sequence from the pAAV-mCherry-flex-dtA (a gift from Naoshige Uchida, Addgene plasmid # 58536) using primer pairs (Table.

    Techniques: Injection, Fluorescence, Microscopy, Expressing, Staining, Control, In Vivo, Imaging, Activity Assay, MANN-WHITNEY

    a , Representative traces of CF-EPSCs in PCs from control (CTL) and AAV-hMAG-DTA-injected (DTA) mice at P23. Scale bar, 0.5 nA, 10 ms. b , Frequency distributions of the number of CFs innervating each PC during P23 to P47 for control (orange columns, n = 58 cells, 7 mice) and AAV-hMAG-DTA-injected (cyan, n = 66 cells, 9 mice) mice. c , Average total amplitude of CF-EPSCs (summation of all CF-EPSC in each PC) for control (orange columns) and AAV-hMAG-DTA-injected mice (cyan), with individual data points (from each cell) overlaid on the bars. d , Fluorescence microscopy images showing PCs labeled with Car8 (magenta) and climbing fiber terminals with vesicular glutamate transporter type 2 (VGluT2, green) in control and AAV-hMAG-DTA-injected mice at P21 and P72. Scale bars: 20 µm. e, Frequency distributions of the number of perisomatic CF terminals on PCs for control (orange, n = 253 cells, 3 mice at P12; n = 159 cells, 3 mice at P72-P76) and AAV-hMAG-DTA-injected mice (cyan, n = 157 cells, 3 mice at P12; n = 160 cells, 3 mice at P72-P76). f , Immunofluorescence images showing VGluT2 (green) in control and AAV-hMAG-DTA-injected mice at P21 and P72, highlighting the top dots of VGluT2 in the molecular layer (arrows) and the demarcation between dendrites and soma of each PC (dotted line). Scale bars: 20 µm. g , Bar graph summarizing the relative positioning of CF terminals to the molecular layer thickness in control versus AAV-hMAG-DTA-injected mice at P21 and P72-P82 (n = 13-18 measurements per group, from 3 mice each). Statistical significance denoted as **p < 0.01 and ****p < 0.0001, according to Mann-Whitney U tests.

    Journal: bioRxiv

    Article Title: Oligodendrocyte dependent synchronized activity orchestrates circuit maturation and brain functionalization

    doi: 10.1101/2024.05.06.590880

    Figure Lengend Snippet: a , Representative traces of CF-EPSCs in PCs from control (CTL) and AAV-hMAG-DTA-injected (DTA) mice at P23. Scale bar, 0.5 nA, 10 ms. b , Frequency distributions of the number of CFs innervating each PC during P23 to P47 for control (orange columns, n = 58 cells, 7 mice) and AAV-hMAG-DTA-injected (cyan, n = 66 cells, 9 mice) mice. c , Average total amplitude of CF-EPSCs (summation of all CF-EPSC in each PC) for control (orange columns) and AAV-hMAG-DTA-injected mice (cyan), with individual data points (from each cell) overlaid on the bars. d , Fluorescence microscopy images showing PCs labeled with Car8 (magenta) and climbing fiber terminals with vesicular glutamate transporter type 2 (VGluT2, green) in control and AAV-hMAG-DTA-injected mice at P21 and P72. Scale bars: 20 µm. e, Frequency distributions of the number of perisomatic CF terminals on PCs for control (orange, n = 253 cells, 3 mice at P12; n = 159 cells, 3 mice at P72-P76) and AAV-hMAG-DTA-injected mice (cyan, n = 157 cells, 3 mice at P12; n = 160 cells, 3 mice at P72-P76). f , Immunofluorescence images showing VGluT2 (green) in control and AAV-hMAG-DTA-injected mice at P21 and P72, highlighting the top dots of VGluT2 in the molecular layer (arrows) and the demarcation between dendrites and soma of each PC (dotted line). Scale bars: 20 µm. g , Bar graph summarizing the relative positioning of CF terminals to the molecular layer thickness in control versus AAV-hMAG-DTA-injected mice at P21 and P72-P82 (n = 13-18 measurements per group, from 3 mice each). Statistical significance denoted as **p < 0.01 and ****p < 0.0001, according to Mann-Whitney U tests.

    Article Snippet: For AAV-hMAG-DTA, we amplified the DTA coding sequence from the pAAV-mCherry-flex-dtA (a gift from Naoshige Uchida, Addgene plasmid # 58536) using primer pairs (Table.

    Techniques: Control, Injection, Fluorescence, Microscopy, Labeling, Immunofluorescence, MANN-WHITNEY