Review



cd45 antibody  (Miltenyi Biotec)


Bioz Verified Symbol Miltenyi Biotec is a verified supplier
Bioz Manufacturer Symbol Miltenyi Biotec manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Miltenyi Biotec cd45 antibody
    Composition of cells recovered after each digestion step Collected cells were analyzed after each digestion step to determine cell phenotypes, numbers and viability. When performing transcriptomics analysis all digestion fractions will be combined. (A) Percentages of immune cells <t>(CD45</t> + cells) and stromal cells (CD45 - cells) extracted from each digestion step analyzed via flow cytometry. (B) Representative viability images of each digestion step acquired on automated cell counter (LUNA 7-FX™) where red indicates dead cells and green live cells. (C) Immunofluorescence images of cells stained after each digestion step for CD45 (yellow) and Nuclei (blue). Representative Cytospin slides. Red arrows showing examples of CD45 - cells. Scale bars indicate 100 μm for main images and 10 μm for zoom. (D) After each digestion step the (i) percentage of live cells, (ii) number of live cells after each digestion measured by automated cell counting and (iii) percentage of immune (gray) and stromal cells (red) after each digestion fraction. (E) Combined cells from all digestions showing percentage and number of cells from each lymph node. (F) Representative gating strategy for lymph node cells showing stromal cell percentages. (G–L) Number of (G) immune cells, (H) stromal cells, (I) fibroblastic reticular cells (FRC), (J) lymphatic endothelial cells (LEC), (K) blood endothelial cells (BEC) and (L) double negative cells (DNC).
    Cd45 Antibody, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 356 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45/CD45+Antibody%2C+anti-mouse/pmc13101284-3-0-8
    Average 96 stars, based on 356 article reviews
    cd45 antibody - by Bioz Stars, 2026-11
    96/100 stars

    Images

    1) Product Images from "Protocol for isolating stromal cells from lymphoid tissue for performing scRNA-seq"

    Article Title: Protocol for isolating stromal cells from lymphoid tissue for performing scRNA-seq

    Journal: STAR Protocols

    doi: 10.1016/j.xpro.2026.104501

    Composition of cells recovered after each digestion step Collected cells were analyzed after each digestion step to determine cell phenotypes, numbers and viability. When performing transcriptomics analysis all digestion fractions will be combined. (A) Percentages of immune cells (CD45 + cells) and stromal cells (CD45 - cells) extracted from each digestion step analyzed via flow cytometry. (B) Representative viability images of each digestion step acquired on automated cell counter (LUNA 7-FX™) where red indicates dead cells and green live cells. (C) Immunofluorescence images of cells stained after each digestion step for CD45 (yellow) and Nuclei (blue). Representative Cytospin slides. Red arrows showing examples of CD45 - cells. Scale bars indicate 100 μm for main images and 10 μm for zoom. (D) After each digestion step the (i) percentage of live cells, (ii) number of live cells after each digestion measured by automated cell counting and (iii) percentage of immune (gray) and stromal cells (red) after each digestion fraction. (E) Combined cells from all digestions showing percentage and number of cells from each lymph node. (F) Representative gating strategy for lymph node cells showing stromal cell percentages. (G–L) Number of (G) immune cells, (H) stromal cells, (I) fibroblastic reticular cells (FRC), (J) lymphatic endothelial cells (LEC), (K) blood endothelial cells (BEC) and (L) double negative cells (DNC).
    Figure Legend Snippet: Composition of cells recovered after each digestion step Collected cells were analyzed after each digestion step to determine cell phenotypes, numbers and viability. When performing transcriptomics analysis all digestion fractions will be combined. (A) Percentages of immune cells (CD45 + cells) and stromal cells (CD45 - cells) extracted from each digestion step analyzed via flow cytometry. (B) Representative viability images of each digestion step acquired on automated cell counter (LUNA 7-FX™) where red indicates dead cells and green live cells. (C) Immunofluorescence images of cells stained after each digestion step for CD45 (yellow) and Nuclei (blue). Representative Cytospin slides. Red arrows showing examples of CD45 - cells. Scale bars indicate 100 μm for main images and 10 μm for zoom. (D) After each digestion step the (i) percentage of live cells, (ii) number of live cells after each digestion measured by automated cell counting and (iii) percentage of immune (gray) and stromal cells (red) after each digestion fraction. (E) Combined cells from all digestions showing percentage and number of cells from each lymph node. (F) Representative gating strategy for lymph node cells showing stromal cell percentages. (G–L) Number of (G) immune cells, (H) stromal cells, (I) fibroblastic reticular cells (FRC), (J) lymphatic endothelial cells (LEC), (K) blood endothelial cells (BEC) and (L) double negative cells (DNC).

    Techniques Used: Transcriptomics, Flow Cytometry, Immunofluorescence, Staining, Cell Counting

    Cell selection using automated magnetic cell sorting (A) Cells were stained with CD45-biotin and CD31-biotin and sorted using autoMACS® Pro Separator. (B) Number of cells before staining for autoMACS® separation (step 11), and number of cells recovered from positive selection (CD45 + and CD31 + cells) and negative selection (CD45 - and CD31 - cells) in step 23. Each dot represents combined numbers from inguinal, axillary and brachial lymph nodes from 6 mice. Colors indicate biological replicates. (C) Percentages of cells after separation compared to the pre-staining cell count performed in step 11. (D) Purity check of separated cells using flow cytometry and staining for CD45 and CD31. (E) Overlay plots of positive selection (blue) and negative selection (red). (F) Percentage of CD45 + , CD45 - and CD31 + cells recovered (∗∗∗∗ p value < 0.0001, ∗ p value < 0.05). (G) Final viability check of positive and negative selected cells acquired just before performing scRNA-sequencing analysis.
    Figure Legend Snippet: Cell selection using automated magnetic cell sorting (A) Cells were stained with CD45-biotin and CD31-biotin and sorted using autoMACS® Pro Separator. (B) Number of cells before staining for autoMACS® separation (step 11), and number of cells recovered from positive selection (CD45 + and CD31 + cells) and negative selection (CD45 - and CD31 - cells) in step 23. Each dot represents combined numbers from inguinal, axillary and brachial lymph nodes from 6 mice. Colors indicate biological replicates. (C) Percentages of cells after separation compared to the pre-staining cell count performed in step 11. (D) Purity check of separated cells using flow cytometry and staining for CD45 and CD31. (E) Overlay plots of positive selection (blue) and negative selection (red). (F) Percentage of CD45 + , CD45 - and CD31 + cells recovered (∗∗∗∗ p value < 0.0001, ∗ p value < 0.05). (G) Final viability check of positive and negative selected cells acquired just before performing scRNA-sequencing analysis.

    Techniques Used: Selection, FACS, Staining, Cell Characterization, Flow Cytometry, Sequencing

    Related Articles

    other:

    Article Title: Protocol for isolating stromal cells from lymphoid tissue for performing scRNA-seq
    Article Snippet: CD45 antibody, anti-mouse, Biotin (Dilutions in 1:50) , Miltenyi Biotec , Cat# 130-124-209, RRID: AB_2819580.

    Mass Spectrometry:

    Article Title: Astrocytic EAAT ‐2 Upregulation Supports Neuro‐Axonal Homeostasis in Chronic Inflammatory CNS Lesions
    Article Snippet: MBP , PE , REA1154 , Miltenyi Biotec , 130‐120‐342 , Human cell line , Hu, ms, rat , 1:50. .. CD45 , PE , 30F11 , Miltenyi Biotec , 130‐117‐498 , Rat , ms , 1:20. .. Anti‐rabbit , Alexa Fluor 594 , Polyclonal , Thermo Fisher Scientific , — , Goat , Rabbit , 1:400.

    Cell-Signaling:

    Article Title: LncRNA Arsa-DT is required for spermatogenesis and male fertility by regulating G2/M progression.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Cyclin B1 Monoclonal Antibody Thermo Fisher Scientific Cat# MA1-155; RRID: AB_2536863 Anti-Cyclin D1 Monoclonal Antibody Abcam Cat# ab16663; RRID: AB_443423 Anti-Phospho-cdc2 (Tyr15) Antibody Cell Signaling Technology Cat# 9111; RRID: AB_331460 Anti-Phospho-Histone H3 (Ser10) Antibody Cell Signaling Technology Cat# 9701; RRID: AB_331535 Anti-Caspase-3 Antibody Cell Signaling Technology Cat# 9665; RRID: AB_2069872 Anti-PARP Antibody Cell Signaling Technology Cat# 9532; RRID: AB_659884 Anti-GAPDH Antibody Santa Cruz Biotechnology Cat# sc-32233; RRID: AB_627679 Rabbit anti-Goat IgG (H + L) Cross-Adsorbed Secondary Antibody, HRP Thermo Fisher Scientific Cat# R-21459; RRID: AB_2556529 Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, HRP Thermo Fisher Scientific Cat# G-21040; RRID: AB_2536527 Anti-Ki67 Antibody Abcam Cat# ab16667; RRID: AB_302459 Anti-Histone H2A.X (phospho S139) antibody Abcam Cat# ab81299; RRID: AB_1640564 Anti-alpha-Tubulin Antibody Millipore Cat# 05-829; RRID: AB_310035 Anti-CD117/c-kit Antibody R&D systems Cat# AF1356; RRID: AB_354750 Anti-PLZF Antibody R&D systems Cat# AF2944; RRID: AB_2218943 Anti-STAR Antibody ProteinTech Cat# 80751-1; RRID: AB_2918910 Anti-SOX9 Antibody Thermo Fisher Scientific Cat# 14-9765-82; RRID: AB_2573006 Chicken Anti-Rabbit IgG (H + L) Antibody, Alexa FluorTM 488 Conjugated Thermo Fisher Scientific Cat# A-21441; RRID: AB_2535859 Chicken Anti-Mouse IgG (H + L) Antibody, Alexa FluorTM 488 Conjugated Thermo Fisher Scientific Cat# A-21200; RRID: AB_2535786 Donkey Anti-Goat IgG (H + L) Antibody, Alexa FluorTM 488 Conjugated Thermo Fisher Scientific Cat# A-11055; RRID: AB_2534102 Donkey Anti-Rabbit IgG (H + L) Polyclonal Antibody, Alexa FluorTM 555 Conjugated Thermo Fisher Scientific Cat# A-31572; RRID: AB_162543 Goat Anti-Mouse IgG (H + L) Highly Cross-adsorbed Antibody, Alexa FluorTM 633 Conjugated Thermo Fisher Scientific Cat# A-21052; RRID: AB_2535719 Goat Anti-Rabbit IgG (H + L) Highly Cross-adsorbed Antibody, Alexa FluorTM 647 Conjugated Thermo Fisher Scientific Cat# A-21245; RRID: AB_2535813 Anti-CD45 Antibody, anti-mouse, Biotin Miltenyi Biotec Cat# 130-124-209; RRID: AB_2819580 Anti-CD16/CD32 Antibody, anti-mouse, Biotin Miltenyi Biotec Cat# 130-101-895; RRID: AB_2660226 Anti-CD326 (EpCAM) Monoclonal Antibody (G8.8), PE Thermo Fisher Scientific Cat# 12-5791-81; RRID: AB_953619 Anti-phospho-Ser/Thr-Pro, MPM-2 Antibody Millipore Cat# 05-368; RRID: AB_309698 Chemicals, peptides, and recombinant proteins Dulbecco’s modified Eagle’s medium Cytiva SH30243.01 Fetal bovine serum Cytiva SH31194.03 Penicillin-Streptomycin solution Cytiva SV30010 Lipofectamine 3000 Thermo Fisher Scientific L3000001 Nocodazole Sigma Aldrich SML1665 i-StarTaqTM DNA polymerase iNtRON Biotechnology 25161 TRIzolTM Reagent Thermo Fisher Scientific 15596026 Collagenase type IV Sigma Aldrich C5138 DNase I Sigma Aldrich DN25 IGEPAL CA-630 (NP-40) Sigma Aldrich I3021 (Continued on next page) iScience 29, 117813, November 20, 2026 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER Easy-Blue phenol buffer iNtRON Biotechnology 17061 FITC-conjugated peanut agglutinin (PNA) Sigma Aldrich L7381 M-MLV Reverse Transcriptase Thermo Fisher Scientific 28025013 Donkey serum Sigma Aldrich D9663 Bovine serum albumin MP Biomedicals MP 0216006980 TritonTM X-100 Sigma Aldrich T9284 Dihydroethidium Sigma Aldrich 37291 Anti-PE MicroBeads Miltenyi Biotec 130-048-801 Streptavidin MicroBeads Miltenyi Biotec 130-048-102 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) Sigma Aldrich 475989 Propidium iodide Sigma Aldrich P4170 cOmpleteTM, Mini Protease Inhibitor Cocktail Roche 11836153001 PhosSTOPTM Roche 4906845001 (PHOSS-RO) AmershamTM ECL Western Blotting Detection Reagent Cytiva RPN2105 AmershamTM ECL Prime Western Blotting Detection Reagent Cytiva RPN2232 NICSROWESTTM ECL PICO Bionics BNROW-0007 NICSROWESTTM ECL ADVANCE Bionics BNROP-0009 Critical commercial assays Testosterone ELISA Kit Cayman Chemical 582701 Periodic Acid Schiff (PAS) Stain Kit ScyTek Laboratories PAS-1 GeneRacerTM Kit with SuperScriptTM III RT and TOPO TA CloningTM Kit for Sequencing Thermo Fisher Scientific L150201 in situ Apoptosis Detection Kit Takara MK500 Rneasy Mini kit Qiagen 74104 RNAscopeTM Multiplex Fluorescent Reagent Kit v2 Advanced Cell Diagnostics 323100 Pierce BCA protein assay kit Thermo Fisher Scientific 23225 Deposited data Mouse testes single-cell RNA-seq data Yuan et al.19 GEO: GSE254812 Human testes RNA-seq data Balagannavar et al.29 GEO: GSE216907 Experimental models: Cell lines GC-1 spg ATCC CRL-2053 Experimental models: Organisms/strains C57BL/6 mice Orient Bio C57BL/6NCrlOri C57BL/6 Arsa-DT− /− mice In house N/A Oligonucleotides Arsa-DT (C230037L18Rik) primer In house Forward 5′- CCAGGACCTGCGCATTATT -3′; Reverse 5′- CCTCTTCGCTTGGTGTCTTT -3′ Stra8 primer In house Forward 5′- CTGTGGCAGGTACTGAATAGG -3′; Reverse 5′- GCAGGTTGAAGGATGCTTTG -3′ Arsa primer In house Forward 5′- CCTTGTTCCCATCCCACTAC -3′; Reverse 5′- GTCTCGGGAGAAAGACACATAC -3′ Shank3 primer In house Forward 5′- CCGATACAAGCGGAGAGTTTAT -3′; Reverse 5′- CCACCTTATCTGTGCTGTGTAG -3′ Gapdh primer In house Forward 5′- GTGGCAAAGTGGAGATTGTTG -3′; Reverse 5′- CGTTGAATTTGCCGTGAGTG -3′ Arsa-DT Transcript 1 primer In house Forward 5′- ACATTCCAGCACGGTTTCTG -3′; Reverse 5′- GTGTGGGTGTTTTACCTGCATTA -3′ (Continued on next page) 14 iScience 29, 117813, November 20, 2026

    Recombinant:

    Article Title: LncRNA Arsa-DT is required for spermatogenesis and male fertility by regulating G2/M progression.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Cyclin B1 Monoclonal Antibody Thermo Fisher Scientific Cat# MA1-155; RRID: AB_2536863 Anti-Cyclin D1 Monoclonal Antibody Abcam Cat# ab16663; RRID: AB_443423 Anti-Phospho-cdc2 (Tyr15) Antibody Cell Signaling Technology Cat# 9111; RRID: AB_331460 Anti-Phospho-Histone H3 (Ser10) Antibody Cell Signaling Technology Cat# 9701; RRID: AB_331535 Anti-Caspase-3 Antibody Cell Signaling Technology Cat# 9665; RRID: AB_2069872 Anti-PARP Antibody Cell Signaling Technology Cat# 9532; RRID: AB_659884 Anti-GAPDH Antibody Santa Cruz Biotechnology Cat# sc-32233; RRID: AB_627679 Rabbit anti-Goat IgG (H + L) Cross-Adsorbed Secondary Antibody, HRP Thermo Fisher Scientific Cat# R-21459; RRID: AB_2556529 Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, HRP Thermo Fisher Scientific Cat# G-21040; RRID: AB_2536527 Anti-Ki67 Antibody Abcam Cat# ab16667; RRID: AB_302459 Anti-Histone H2A.X (phospho S139) antibody Abcam Cat# ab81299; RRID: AB_1640564 Anti-alpha-Tubulin Antibody Millipore Cat# 05-829; RRID: AB_310035 Anti-CD117/c-kit Antibody R&D systems Cat# AF1356; RRID: AB_354750 Anti-PLZF Antibody R&D systems Cat# AF2944; RRID: AB_2218943 Anti-STAR Antibody ProteinTech Cat# 80751-1; RRID: AB_2918910 Anti-SOX9 Antibody Thermo Fisher Scientific Cat# 14-9765-82; RRID: AB_2573006 Chicken Anti-Rabbit IgG (H + L) Antibody, Alexa FluorTM 488 Conjugated Thermo Fisher Scientific Cat# A-21441; RRID: AB_2535859 Chicken Anti-Mouse IgG (H + L) Antibody, Alexa FluorTM 488 Conjugated Thermo Fisher Scientific Cat# A-21200; RRID: AB_2535786 Donkey Anti-Goat IgG (H + L) Antibody, Alexa FluorTM 488 Conjugated Thermo Fisher Scientific Cat# A-11055; RRID: AB_2534102 Donkey Anti-Rabbit IgG (H + L) Polyclonal Antibody, Alexa FluorTM 555 Conjugated Thermo Fisher Scientific Cat# A-31572; RRID: AB_162543 Goat Anti-Mouse IgG (H + L) Highly Cross-adsorbed Antibody, Alexa FluorTM 633 Conjugated Thermo Fisher Scientific Cat# A-21052; RRID: AB_2535719 Goat Anti-Rabbit IgG (H + L) Highly Cross-adsorbed Antibody, Alexa FluorTM 647 Conjugated Thermo Fisher Scientific Cat# A-21245; RRID: AB_2535813 Anti-CD45 Antibody, anti-mouse, Biotin Miltenyi Biotec Cat# 130-124-209; RRID: AB_2819580 Anti-CD16/CD32 Antibody, anti-mouse, Biotin Miltenyi Biotec Cat# 130-101-895; RRID: AB_2660226 Anti-CD326 (EpCAM) Monoclonal Antibody (G8.8), PE Thermo Fisher Scientific Cat# 12-5791-81; RRID: AB_953619 Anti-phospho-Ser/Thr-Pro, MPM-2 Antibody Millipore Cat# 05-368; RRID: AB_309698 Chemicals, peptides, and recombinant proteins Dulbecco’s modified Eagle’s medium Cytiva SH30243.01 Fetal bovine serum Cytiva SH31194.03 Penicillin-Streptomycin solution Cytiva SV30010 Lipofectamine 3000 Thermo Fisher Scientific L3000001 Nocodazole Sigma Aldrich SML1665 i-StarTaqTM DNA polymerase iNtRON Biotechnology 25161 TRIzolTM Reagent Thermo Fisher Scientific 15596026 Collagenase type IV Sigma Aldrich C5138 DNase I Sigma Aldrich DN25 IGEPAL CA-630 (NP-40) Sigma Aldrich I3021 (Continued on next page) iScience 29, 117813, November 20, 2026 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER Easy-Blue phenol buffer iNtRON Biotechnology 17061 FITC-conjugated peanut agglutinin (PNA) Sigma Aldrich L7381 M-MLV Reverse Transcriptase Thermo Fisher Scientific 28025013 Donkey serum Sigma Aldrich D9663 Bovine serum albumin MP Biomedicals MP 0216006980 TritonTM X-100 Sigma Aldrich T9284 Dihydroethidium Sigma Aldrich 37291 Anti-PE MicroBeads Miltenyi Biotec 130-048-801 Streptavidin MicroBeads Miltenyi Biotec 130-048-102 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) Sigma Aldrich 475989 Propidium iodide Sigma Aldrich P4170 cOmpleteTM, Mini Protease Inhibitor Cocktail Roche 11836153001 PhosSTOPTM Roche 4906845001 (PHOSS-RO) AmershamTM ECL Western Blotting Detection Reagent Cytiva RPN2105 AmershamTM ECL Prime Western Blotting Detection Reagent Cytiva RPN2232 NICSROWESTTM ECL PICO Bionics BNROW-0007 NICSROWESTTM ECL ADVANCE Bionics BNROP-0009 Critical commercial assays Testosterone ELISA Kit Cayman Chemical 582701 Periodic Acid Schiff (PAS) Stain Kit ScyTek Laboratories PAS-1 GeneRacerTM Kit with SuperScriptTM III RT and TOPO TA CloningTM Kit for Sequencing Thermo Fisher Scientific L150201 in situ Apoptosis Detection Kit Takara MK500 Rneasy Mini kit Qiagen 74104 RNAscopeTM Multiplex Fluorescent Reagent Kit v2 Advanced Cell Diagnostics 323100 Pierce BCA protein assay kit Thermo Fisher Scientific 23225 Deposited data Mouse testes single-cell RNA-seq data Yuan et al.19 GEO: GSE254812 Human testes RNA-seq data Balagannavar et al.29 GEO: GSE216907 Experimental models: Cell lines GC-1 spg ATCC CRL-2053 Experimental models: Organisms/strains C57BL/6 mice Orient Bio C57BL/6NCrlOri C57BL/6 Arsa-DT− /− mice In house N/A Oligonucleotides Arsa-DT (C230037L18Rik) primer In house Forward 5′- CCAGGACCTGCGCATTATT -3′; Reverse 5′- CCTCTTCGCTTGGTGTCTTT -3′ Stra8 primer In house Forward 5′- CTGTGGCAGGTACTGAATAGG -3′; Reverse 5′- GCAGGTTGAAGGATGCTTTG -3′ Arsa primer In house Forward 5′- CCTTGTTCCCATCCCACTAC -3′; Reverse 5′- GTCTCGGGAGAAAGACACATAC -3′ Shank3 primer In house Forward 5′- CCGATACAAGCGGAGAGTTTAT -3′; Reverse 5′- CCACCTTATCTGTGCTGTGTAG -3′ Gapdh primer In house Forward 5′- GTGGCAAAGTGGAGATTGTTG -3′; Reverse 5′- CGTTGAATTTGCCGTGAGTG -3′ Arsa-DT Transcript 1 primer In house Forward 5′- ACATTCCAGCACGGTTTCTG -3′; Reverse 5′- GTGTGGGTGTTTTACCTGCATTA -3′ (Continued on next page) 14 iScience 29, 117813, November 20, 2026

    Modification:

    Article Title: LncRNA Arsa-DT is required for spermatogenesis and male fertility by regulating G2/M progression.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Cyclin B1 Monoclonal Antibody Thermo Fisher Scientific Cat# MA1-155; RRID: AB_2536863 Anti-Cyclin D1 Monoclonal Antibody Abcam Cat# ab16663; RRID: AB_443423 Anti-Phospho-cdc2 (Tyr15) Antibody Cell Signaling Technology Cat# 9111; RRID: AB_331460 Anti-Phospho-Histone H3 (Ser10) Antibody Cell Signaling Technology Cat# 9701; RRID: AB_331535 Anti-Caspase-3 Antibody Cell Signaling Technology Cat# 9665; RRID: AB_2069872 Anti-PARP Antibody Cell Signaling Technology Cat# 9532; RRID: AB_659884 Anti-GAPDH Antibody Santa Cruz Biotechnology Cat# sc-32233; RRID: AB_627679 Rabbit anti-Goat IgG (H + L) Cross-Adsorbed Secondary Antibody, HRP Thermo Fisher Scientific Cat# R-21459; RRID: AB_2556529 Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, HRP Thermo Fisher Scientific Cat# G-21040; RRID: AB_2536527 Anti-Ki67 Antibody Abcam Cat# ab16667; RRID: AB_302459 Anti-Histone H2A.X (phospho S139) antibody Abcam Cat# ab81299; RRID: AB_1640564 Anti-alpha-Tubulin Antibody Millipore Cat# 05-829; RRID: AB_310035 Anti-CD117/c-kit Antibody R&D systems Cat# AF1356; RRID: AB_354750 Anti-PLZF Antibody R&D systems Cat# AF2944; RRID: AB_2218943 Anti-STAR Antibody ProteinTech Cat# 80751-1; RRID: AB_2918910 Anti-SOX9 Antibody Thermo Fisher Scientific Cat# 14-9765-82; RRID: AB_2573006 Chicken Anti-Rabbit IgG (H + L) Antibody, Alexa FluorTM 488 Conjugated Thermo Fisher Scientific Cat# A-21441; RRID: AB_2535859 Chicken Anti-Mouse IgG (H + L) Antibody, Alexa FluorTM 488 Conjugated Thermo Fisher Scientific Cat# A-21200; RRID: AB_2535786 Donkey Anti-Goat IgG (H + L) Antibody, Alexa FluorTM 488 Conjugated Thermo Fisher Scientific Cat# A-11055; RRID: AB_2534102 Donkey Anti-Rabbit IgG (H + L) Polyclonal Antibody, Alexa FluorTM 555 Conjugated Thermo Fisher Scientific Cat# A-31572; RRID: AB_162543 Goat Anti-Mouse IgG (H + L) Highly Cross-adsorbed Antibody, Alexa FluorTM 633 Conjugated Thermo Fisher Scientific Cat# A-21052; RRID: AB_2535719 Goat Anti-Rabbit IgG (H + L) Highly Cross-adsorbed Antibody, Alexa FluorTM 647 Conjugated Thermo Fisher Scientific Cat# A-21245; RRID: AB_2535813 Anti-CD45 Antibody, anti-mouse, Biotin Miltenyi Biotec Cat# 130-124-209; RRID: AB_2819580 Anti-CD16/CD32 Antibody, anti-mouse, Biotin Miltenyi Biotec Cat# 130-101-895; RRID: AB_2660226 Anti-CD326 (EpCAM) Monoclonal Antibody (G8.8), PE Thermo Fisher Scientific Cat# 12-5791-81; RRID: AB_953619 Anti-phospho-Ser/Thr-Pro, MPM-2 Antibody Millipore Cat# 05-368; RRID: AB_309698 Chemicals, peptides, and recombinant proteins Dulbecco’s modified Eagle’s medium Cytiva SH30243.01 Fetal bovine serum Cytiva SH31194.03 Penicillin-Streptomycin solution Cytiva SV30010 Lipofectamine 3000 Thermo Fisher Scientific L3000001 Nocodazole Sigma Aldrich SML1665 i-StarTaqTM DNA polymerase iNtRON Biotechnology 25161 TRIzolTM Reagent Thermo Fisher Scientific 15596026 Collagenase type IV Sigma Aldrich C5138 DNase I Sigma Aldrich DN25 IGEPAL CA-630 (NP-40) Sigma Aldrich I3021 (Continued on next page) iScience 29, 117813, November 20, 2026 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER Easy-Blue phenol buffer iNtRON Biotechnology 17061 FITC-conjugated peanut agglutinin (PNA) Sigma Aldrich L7381 M-MLV Reverse Transcriptase Thermo Fisher Scientific 28025013 Donkey serum Sigma Aldrich D9663 Bovine serum albumin MP Biomedicals MP 0216006980 TritonTM X-100 Sigma Aldrich T9284 Dihydroethidium Sigma Aldrich 37291 Anti-PE MicroBeads Miltenyi Biotec 130-048-801 Streptavidin MicroBeads Miltenyi Biotec 130-048-102 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) Sigma Aldrich 475989 Propidium iodide Sigma Aldrich P4170 cOmpleteTM, Mini Protease Inhibitor Cocktail Roche 11836153001 PhosSTOPTM Roche 4906845001 (PHOSS-RO) AmershamTM ECL Western Blotting Detection Reagent Cytiva RPN2105 AmershamTM ECL Prime Western Blotting Detection Reagent Cytiva RPN2232 NICSROWESTTM ECL PICO Bionics BNROW-0007 NICSROWESTTM ECL ADVANCE Bionics BNROP-0009 Critical commercial assays Testosterone ELISA Kit Cayman Chemical 582701 Periodic Acid Schiff (PAS) Stain Kit ScyTek Laboratories PAS-1 GeneRacerTM Kit with SuperScriptTM III RT and TOPO TA CloningTM Kit for Sequencing Thermo Fisher Scientific L150201 in situ Apoptosis Detection Kit Takara MK500 Rneasy Mini kit Qiagen 74104 RNAscopeTM Multiplex Fluorescent Reagent Kit v2 Advanced Cell Diagnostics 323100 Pierce BCA protein assay kit Thermo Fisher Scientific 23225 Deposited data Mouse testes single-cell RNA-seq data Yuan et al.19 GEO: GSE254812 Human testes RNA-seq data Balagannavar et al.29 GEO: GSE216907 Experimental models: Cell lines GC-1 spg ATCC CRL-2053 Experimental models: Organisms/strains C57BL/6 mice Orient Bio C57BL/6NCrlOri C57BL/6 Arsa-DT− /− mice In house N/A Oligonucleotides Arsa-DT (C230037L18Rik) primer In house Forward 5′- CCAGGACCTGCGCATTATT -3′; Reverse 5′- CCTCTTCGCTTGGTGTCTTT -3′ Stra8 primer In house Forward 5′- CTGTGGCAGGTACTGAATAGG -3′; Reverse 5′- GCAGGTTGAAGGATGCTTTG -3′ Arsa primer In house Forward 5′- CCTTGTTCCCATCCCACTAC -3′; Reverse 5′- GTCTCGGGAGAAAGACACATAC -3′ Shank3 primer In house Forward 5′- CCGATACAAGCGGAGAGTTTAT -3′; Reverse 5′- CCACCTTATCTGTGCTGTGTAG -3′ Gapdh primer In house Forward 5′- GTGGCAAAGTGGAGATTGTTG -3′; Reverse 5′- CGTTGAATTTGCCGTGAGTG -3′ Arsa-DT Transcript 1 primer In house Forward 5′- ACATTCCAGCACGGTTTCTG -3′; Reverse 5′- GTGTGGGTGTTTTACCTGCATTA -3′ (Continued on next page) 14 iScience 29, 117813, November 20, 2026



    Similar Products

    cd45 antibody  (NSJ Bioreagents)
    99
    NSJ Bioreagents cd45 antibody
    Cd45 Antibody, supplied by NSJ Bioreagents, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45/CD45+Antibody/custom%40v2240%4042925675
    Average 99 stars, based on 1 article reviews
    cd45 antibody - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    30f11  (Miltenyi Biotec)
    96
    Miltenyi Biotec 30f11
    Antibodies for immunofluorescence staining of mouse spinal cord tissue and human tissue.
    30f11, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45/CD45+Antibody%2C+anti-mouse/pmc13693491-14-4-6
    Average 96 stars, based on 1 article reviews
    30f11 - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    percp cyanine5 5 anti mouse cd45 antibody  (Elabscience Biotechnology)
    94
    Elabscience Biotechnology percp cyanine5 5 anti mouse cd45 antibody
    Antibodies for immunofluorescence staining of mouse spinal cord tissue and human tissue.
    Percp Cyanine5 5 Anti Mouse Cd45 Antibody, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45/PerCP%2FCyanine5%2E5+Anti-Mouse+CD45+Antibody/pm42918800-465-5-30
    Average 94 stars, based on 1 article reviews
    percp cyanine5 5 anti mouse cd45 antibody - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier
    cd45  (Novus Biologicals)
    93
    Novus Biologicals cd45
    Antibodies for immunofluorescence staining of mouse spinal cord tissue and human tissue.
    Cd45, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45/CD45+Antibody+(30-F11)+-+BSA+Free/pm42907443-307-0-5
    Average 93 stars, based on 1 article reviews
    cd45 - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    mouse antihuman cd45 alexa fluor 647  (Bio-Rad)
    93
    Bio-Rad mouse antihuman cd45 alexa fluor 647
    Antibodies for immunofluorescence staining of mouse spinal cord tissue and human tissue.
    Mouse Antihuman Cd45 Alexa Fluor 647, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45/Mouse+anti+Human+CD45/pmc13691775-62-47-55
    Average 93 stars, based on 1 article reviews
    mouse antihuman cd45 alexa fluor 647 - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    cd45 microbeads  (Miltenyi Biotec)
    97
    Miltenyi Biotec cd45 microbeads
    Antibodies for immunofluorescence staining of mouse spinal cord tissue and human tissue.
    Cd45 Microbeads, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45/CD45+MicroBeads%2C+mouse/10__1038_slash_s41419___026___09359___9-692-5-7
    Average 97 stars, based on 1 article reviews
    cd45 microbeads - by Bioz Stars, 2026-11
    97/100 stars
    		  Buy from Supplier
    anti cd45 antibody anti mouse biotin  (Miltenyi Biotec)
    96
    Miltenyi Biotec anti cd45 antibody anti mouse biotin
    Antibodies for immunofluorescence staining of mouse spinal cord tissue and human tissue.
    Anti Cd45 Antibody Anti Mouse Biotin, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45/CD45+Antibody%2C+anti-mouse/pm42894537-453-277-281
    Average 96 stars, based on 1 article reviews
    anti cd45 antibody anti mouse biotin - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    percp conjugated anti human cd45 antibody  (Agilent technologies)
    95
    Agilent technologies percp conjugated anti human cd45 antibody
    Antibodies for immunofluorescence staining of mouse spinal cord tissue and human tissue.
    Percp Conjugated Anti Human Cd45 Antibody, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45/PerCP/pmc13679345-115-18-22
    Average 95 stars, based on 1 article reviews
    percp conjugated anti human cd45 antibody - by Bioz Stars, 2026-11
    95/100 stars
    		  Buy from Supplier
    cd45  (Sino Biological)
    94
    Sino Biological cd45
    Antibodies for immunofluorescence staining of mouse spinal cord tissue and human tissue.
    Cd45, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45/Human+CD45-AB+Protein/pm42896768-48-33-34
    Average 94 stars, based on 1 article reviews
    cd45 - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    Antibodies for immunofluorescence staining of mouse spinal cord tissue and human tissue.

    Journal: Glia

    Article Title: Astrocytic EAAT ‐2 Upregulation Supports Neuro‐Axonal Homeostasis in Chronic Inflammatory CNS Lesions

    doi: 10.1002/glia.70243

    Figure Lengend Snippet: Antibodies for immunofluorescence staining of mouse spinal cord tissue and human tissue.

    Article Snippet: CD45 , PE , 30F11 , Miltenyi Biotec , 130‐117‐498 , Rat , ms , 1:20.

    Techniques: Immunofluorescence, Staining, Tissue