Review



cd34 cell fraction  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Qiagen cd34 cell fraction
    Cd34 Cell Fraction, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 3361 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd34++fraction/miRNeasy+Micro+Kit/pmc11604037-358-7-18
    Average 99 stars, based on 3361 article reviews
    cd34 cell fraction - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Purification:

    Article Title: MiRNA-based expression signatures in differential diagnosis of enchondroma and chondrosarcoma
    Article Snippet: .. The miRNeasy Micro Kit (QIAGEN) was utilized for the purification of miRNAs from human platelets. ..

    Isolation:

    Article Title: Targeted Intra-Atrial Delivery of GMP-Grade Human Extracellular Vesicles Prevents Inflammation-Driven Postoperative Atrial Fibrillation in Pigs
    Article Snippet: .. Total RNA was isolated from cells/tissues (Qiagen, 217084), plasma (Norgen Biotek, 55000) or urine (Norgen Biotek, 47200) before reverse transcription (Qiagen, 339340) and qPCR (Qiagen, 339345) using the human NT4 forward primer (5′–GGTCCGATGGTAGTGGGTTATCAG–3′). .. Data were corrected for background using human U6 as a reference gene (Qiagen, 339306, GeneGlobe ID: YP00203907).

    Clinical Proteomics:

    Article Title: Targeted Intra-Atrial Delivery of GMP-Grade Human Extracellular Vesicles Prevents Inflammation-Driven Postoperative Atrial Fibrillation in Pigs
    Article Snippet: .. Total RNA was isolated from cells/tissues (Qiagen, 217084), plasma (Norgen Biotek, 55000) or urine (Norgen Biotek, 47200) before reverse transcription (Qiagen, 339340) and qPCR (Qiagen, 339345) using the human NT4 forward primer (5′–GGTCCGATGGTAGTGGGTTATCAG–3′). .. Data were corrected for background using human U6 as a reference gene (Qiagen, 339306, GeneGlobe ID: YP00203907).

    Reverse Transcription:

    Article Title: Targeted Intra-Atrial Delivery of GMP-Grade Human Extracellular Vesicles Prevents Inflammation-Driven Postoperative Atrial Fibrillation in Pigs
    Article Snippet: .. Total RNA was isolated from cells/tissues (Qiagen, 217084), plasma (Norgen Biotek, 55000) or urine (Norgen Biotek, 47200) before reverse transcription (Qiagen, 339340) and qPCR (Qiagen, 339345) using the human NT4 forward primer (5′–GGTCCGATGGTAGTGGGTTATCAG–3′). .. Data were corrected for background using human U6 as a reference gene (Qiagen, 339306, GeneGlobe ID: YP00203907).

    Real-time Polymerase Chain Reaction:

    Article Title: Targeted Intra-Atrial Delivery of GMP-Grade Human Extracellular Vesicles Prevents Inflammation-Driven Postoperative Atrial Fibrillation in Pigs
    Article Snippet: .. Total RNA was isolated from cells/tissues (Qiagen, 217084), plasma (Norgen Biotek, 55000) or urine (Norgen Biotek, 47200) before reverse transcription (Qiagen, 339340) and qPCR (Qiagen, 339345) using the human NT4 forward primer (5′–GGTCCGATGGTAGTGGGTTATCAG–3′). .. Data were corrected for background using human U6 as a reference gene (Qiagen, 339306, GeneGlobe ID: YP00203907).

    Extraction:

    Article Title: Plasma-aqueous dual-fluid NEAT1/miR-93-5p axis may be involved in retinal ganglion cell degeneration in glaucoma: mechanistic dissection and diagnostic model construction.
    Article Snippet: .. Total RNA was extracted using the miRNeasy extraction kit (Qiagen, USA) according to the manufacturer's instructions. .. The concentration and purity of the RNA were confirmed by a NanoDrop 2000 (Thermo Fisher, USA).



    Similar Products

    cd34 fraction  (Miltenyi Biotec)
    96
    Miltenyi Biotec cd34 fraction
    Cd34 Fraction, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd34++fraction/CD34+MicroBead+Kit+UltraPure%2C+human/bio_rxiv__64898__2025__12__22__695871-246-1-6
    Average 96 stars, based on 1 article reviews
    cd34 fraction - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    cd34 cell fractions  (Miltenyi Biotec)
    99
    Miltenyi Biotec cd34 cell fractions
    Cd34 Cell Fractions, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd34++fraction/CD34-VioBlue/us12203096-489-17-31
    Average 99 stars, based on 1 article reviews
    cd34 cell fractions - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    cd34 cell fraction  (Miltenyi Biotec)
    99
    Miltenyi Biotec cd34 cell fraction
    Cd34 Cell Fraction, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd34++fraction/CD34-VioBlue/pm39277669-53-1-17
    Average 99 stars, based on 1 article reviews
    cd34 cell fraction - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    cd34 cell fraction  (Qiagen)
    99
    Qiagen cd34 cell fraction
    Cd34 Cell Fraction, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd34++fraction/miRNeasy+Micro+Kit/pmc11604037-358-7-18
    Average 99 stars, based on 1 article reviews
    cd34 cell fraction - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    autologous cd34+-enriched cell fraction strimvelis  (Glaxo Smith)
    90
    Glaxo Smith autologous cd34+-enriched cell fraction strimvelis
    FDA/EMA approved gene therapy product for rare monogenic diseases
    Autologous Cd34+ Enriched Cell Fraction Strimvelis, supplied by Glaxo Smith, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd34++fraction/strimvelis/pmc11222908-222-7-8
    Average 90 stars, based on 1 article reviews
    autologous cd34+-enriched cell fraction strimvelis - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    FDA/EMA approved gene therapy product for rare monogenic diseases

    Journal: Clinical and Experimental Pediatrics

    Article Title: Development of orphan drugs for rare diseases

    doi: 10.3345/cep.2023.00535

    Figure Lengend Snippet: FDA/EMA approved gene therapy product for rare monogenic diseases

    Article Snippet: For instance, an autologous CD34+-enriched cell fraction, Strimvelis (GlaxoSmithKline plk, London, UK), which contains CD34+ cells transduced with a retroviral vector that encodes the human ADA cDNA sequence for ADA deficiency (introduced in 2016), and voretigene neparvovec-rzyl (Luxturna, Spark Therapeutics, Philadelphia, USA), for retinal dystrophy caused by mutations in the RPE65 gene, were approved by the FDA in 2017 at a cost of $850,000 per eye [ ].

    Techniques: Plasmid Preparation, In Vivo, Ex Vivo, Mutagenesis, Modification, Variant Assay