cas9 mdc123 (Addgene inc)
Addgene inc is a verified supplier 
94
Structured Review
Addgene inc
cas9 mdc123
Cas9 Mdc123, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cas9+expression+construct/Cas9+MDC123+(Plasmid+%2359184)/pmc08394151-58-10-44
Average 94 stars, based on 66 article reviews
Cas9 Mdc123, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cas9+expression+construct/Cas9+MDC123+(Plasmid+%2359184)/pmc08394151-58-10-44
Average 94 stars, based on 66 article reviews
cas9 mdc123 - by Bioz Stars,
2026-11
94/100 stars
Images
1) Product Images from "Assessment of the Level of Accumulation of the dIFN Protein Integrated by the Knock-In Method into the Region of the Histone H3.3 Gene of Arabidopsis thaliana"
Article Title: Assessment of the Level of Accumulation of the dIFN Protein Integrated by the Knock-In Method into the Region of the Histone H3.3 Gene of Arabidopsis thaliana
Journal: Cells
doi: 10.3390/cells10082137
Figure Legend Snippet: PCR analysis of the obtained cell lines, confirming the integration of the target gene into the target region of the HTR5 gene. ( a ) The location of primers for testing using the pIFN(H3.3).2 construct as an example: P1—P-NOS-promoter of A. tumefaciens nopaline synthase gene; nptII —gene of neomycin phosphotransferase II, which provides plant cell resistance to kanamycin; P2—CaMV35S promoter of the cauliflower mosaic virus; S—DNA sequence encoding the leader signal of the carrot extensin gene, which ensures the transport of deltaferon to the apoplast; dIFN—DNA sequence encoding the target protein deltaferon; GST—DNA sequence encoding the GST tag; sgRNA—20 bp Cas9 endonuclease recognition sites, identical to the recognition site in the intergenic region upstream of the A. thaliana HTR5 gene, for excision of the construct from the plasmid in the cell. At the bottom, the names of the oligonucleotides used and the size of the PCR fragments obtained with them are indicated. ( b – d ) Electrophoresis of PCR products of cell lines produced with the pIFN(H3.3).2 construct. ( b ) PCR with primers for the nptII gene (lanes 1–4; the size of the expected fragment is 487 bp) and for the dIFN gene (lanes 5–8; the size of the expected fragment 478 bp). ( c ) PCR with primers for the target insertion into the region of the HTR5 gene (lanes 1–4—with primers Up_H3.3/Lo_plan3 (630 bp) and lanes 5–8—with primers Up_H3.3.1/Lo_plan3 (1048 bp)). ( d ) PCR with primers for the target insertion into the region of the HTR5 gene with primers Up_H3.3.1/Lo_plan3 (1048 bp). Cell line numbers are indicated above the gel lanes. Cell lines 1.1–1.4 and 6.2–6.3 are knock-ins. Lane M is a 1 kb DNA fragment length marker (SibEnzyme, Novosibirsk, Russia). ( e – g ) Electrophoresis of PCR products of cell lines produced with pIFN(H3.3).3 construct. ( e ) PCR with primers Up_H3.3/Lo_plan3 (1048 bp) for the target insertion into the region of the HTR5 gene. ( f ) PCR with primers Up_H3.3/Lo_plan3 (630 bp) for the target insertion into the region of the HTR5 gene. ( g ) PCR with primers npt1 and npt2 for the nptII gene (487 bp). Cell line numbers are indicated above the gel lanes. Cell lines 38.3, 38.29 and 4.10 are knock-ins. Cell lines 10 and 51 have random insertion of the transgene constructs pIFN(H3.3).2 and pIFN(H3.3).3 correspondingly. Lane n.t. is non-transgenic A. thaliana (negative control 1). Lane 0 is non-template DNA (negative control 2). Lane M is a DNA fragment length marker (GeneRuler Express DNA Ladder; Thermo Fisher, Lenexa, KS, USA).
Techniques Used: Construct, Virus, Sequencing, Plasmid Preparation, Electrophoresis, Produced, Marker, Transgenic Assay, Negative Control
Related Articles
Plasmid Preparation:Article Title: CRISPR having or associated with destabilization domains Article Snippet: .. The Article Title: CRISPR enzymes and systems with modified pam specificity Article Snippet: .. The Article Title: Methods and compositions for optochemical control of CRISPR-CAS9 Article Snippet: .. The Article Title: Compositions and methods for T cell engineering Article Snippet: .. Article Title: Inhibitors of RNA-guided nuclease activity and uses thereof Article Snippet: .. The Article Title: Molecular pathology and cystogenic propensity of the ADPKD Taiwan founder variant Article Snippet: Using our previously generated (source Creative Biogene) CRISPR/Cas9-edited HEK293 PKD2 null cell line, we introduced nonsense mutations to both PKD1 alleles to create a PKD1 null :PKD2 null cell line ( ). .. HEK293 PKD2 null cells were electrotransfected with PKD1 sgRNAs ( CACC GCATAGGTGTGGTTGGCAGC and AAAC GCTGCCAACCACACCTATGC) with the All-in-one Synthesized:Article Title: CRISPR having or associated with destabilization domains Article Snippet: .. The Article Title: CRISPR enzymes and systems with modified pam specificity Article Snippet: .. The Article Title: Methods and compositions for optochemical control of CRISPR-CAS9 Article Snippet: .. The Article Title: Inhibitors of RNA-guided nuclease activity and uses thereof Article Snippet: .. The other:Article Title: Molecular pathology and cystogenic propensity of the ADPKD Taiwan founder variant. Article Snippet: MRI imaging was conducted using a Bruker BioSpec (9.4 Tesla). Clone Assay:Article Title: Genomic atlas of 8,105 accessions reveals stepwise domestication, global dissemination, and improvement trajectories in soybean. Article Snippet: Article Genomic atlas of 8,105 accessions reveals stepwise domestication, global dissemination, and improvement trajectories in soybean |
![( A ) Plot of the candidate genes from <t>CRISPR-Cas9</t> knockout (KO) screen in LNCaP cells treated with 450 nM ipatasertib on day 18. ( B ) Top genes identified from the CRISPR-Cas9 KO screen on day 18 (ipatasertib-treated LNCaP cells compared to DMSO-treated cells). ( C ) TSC2-KO LNCaP cells were subjected to a 4-hour treatment with either DMSO or 500 nM ipatasertib. Expression levels of downstream targets in the PI3K pathway were evaluated using Western Blot analysis. ( D and E ) Outcomes of a competition assay involving four candidate genes in LNCaP cells. Cells were transduced with lentivirus carrying sgNT-GFP or sgRNA-GFP targeting the candidate genes, each with two specific sgRNAs. Following transduction, cells were treated with either DMSO or 500 nM ipatasertib. The ratio of GFP + cells was normalized to the DMSO treatment group. The data represent the results of three independent experiments ( n = 3). ( F ) LNCaP, CWR22Pc-EP-sgPTEN, and PCa12, each stably expressing sgNT or sgNPRL3, were subjected to treatment with either ipatasertib (500 nM) or DMSO. Cell viability on day 7 was assessed. ( G ) WT, TSC2-KO, or NPRL3-KO LNCaP cells were exposed to 6 hours of starvation and a 4-hour treatment with either DMSO or 500 nM ipatasertib. Following this, cells were stimulated with or without amino acids for 10 min. The expression levels of downstream targets in the PI3K pathway were evaluated using Western Blot analysis {* P < 0.05, ** P < 0.01, and **** P < 0.0001; [(D) to (F)] Welch’s t test; error bar represents ±SEM}.](https://pub-med-central-images-cdn.bioz.com/pub_med_central_ids_ending_with_4928/pmc11804928/pmc11804928__sciadv.adq3802-f3.jpg)
![Fig. 2 Oncogene exposure transforms induced hepatocytes but not control fibroblasts. A Phase contrast microscope images showing the phenotype and morphology of the cells in the course of conversion of fibroblasts to iHeps at different times points after transduction with a cocktail of three TFs HNF1A, HNF4A and FOXA3 [36]. B Generation of highly proliferative iHep cells by transducing iHeps with two pools of liver cancer-specific oncogenic drivers, a list of xenograft experiments in nude mice that were used to test the tumorigenicity of different conditions, and mutation rates of the oncogenic drivers as reported in the COSMIC database for HCC and MYC amplification as reported in [43]. CMT pool contains three oncogenes CTNNB1T41A, MYC, and TERT, and CMT + sgTP53 pool contains the same oncogenes along with constructs for TP53 inactivation by <t>CRISPR-Cas9.</t> Phase contrast microscope images showing the phenotype and morphology of the cells. Oncogenes are co-transduced with fluorescent reporter mCherry for the detection of transduced cells. Oncogene transduction to fibroblasts fails to transform the cells, passaging of oncogene-expressing fibroblasts results in cellular senescence as demonstrated by β-galactosidase staining and loss of mCherry-positive oncogene-expressing cells from the fibroblast population. iHeps maintained in defined culture medium become senescent around week four of transdifferentiation although they can survive in culture for several weeks after that if not passaged. Passaging of iHeps without oncogenes results in apoptosis after few passages. Scale bar 1000 μm unless otherwise specified.](https://pub-med-unpaywalled-images-cdn.bioz.com/pub_med_ids_ending_with_2118/pm34302118/pm34302118__page3_image1.jpg)
