Review



dissociation buffer  (Worthington Biochemical)


Bioz Verified Symbol Worthington Biochemical is a verified supplier
Bioz Manufacturer Symbol Worthington Biochemical manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Worthington Biochemical dissociation buffer
    Dissociation Buffer, supplied by Worthington Biochemical, used in various techniques. Bioz Stars score: 99/100, based on 60 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+ebss/Papain+Dissociation+System%2C+Without+EBSS/pmc11502789-300-9-19
    Average 99 stars, based on 60 article reviews
    dissociation buffer - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Cell Culture:

    Article Title: Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Iba1 Genetex GTX100042; RRID:AB_1240434 Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Invitrogen A-21206; RRID:AB_2535792 Chemicals, peptides, and recombinant proteins Vitamin B3 (nicotinamide) (D4, 98%) Cambridge Isotope Laboratories, Inc. DLM-6883-0.5 Mass Spectrometry Metabolite Library of Standards IROA Technologies MSMLS PHGDH Sino Biological 13167-H08E PSAT1 Novus Biologicals NBP1-78827 Nicotinamide Riboside Chloride MedChem Express HY-123033A BAMBANKER® Serum-Free Cell Freezing Media GC LYMPHOTEC Inc. CS-02-001 RNasin Plus Ribonuclease Inhibitor Promega N2611/N2615 Ethidium Homodimer-1 Invitrogen E1169 Rat Collagen Type I Sigma-Aldrich C3867 MEM, HEPES, no glutamine Gibco 12360038 Nutrient Mixture F-12 Ham Sigma-Aldrich N4888-500ML Endothelial Cell Growth Supplement Sigma-Aldrich 02-102 RSL3 Medchem Express HY-100218A Tamoxifen Sigma T5648 L-Ascorbic acid MilliporeSigma A4544 Pyridoxine hydrochloride Sigma-Aldrich P9755 D-Calcium pantothenate Sigma-Aldrich P5155 Thiamine hydrochloride >99% Sigma-Aldrich T1270 i-Inositol Sigma-Aldrich I7508 choline chloride Sigma-Aldrich C7527 Folic acid Sigma-Aldrich F8758 Riboflavin Sigma-Aldrich R9504 Heparin Sigma-Aldrich H3149 Normal Donkey serum Abcam ab7475 Puromycin Sigma-Aldrich P8833 DMEM Gibco 11995073 AMPure XP Beads Beckman Coulter A63880 FBS Corning MT35015CV Penicillin-Streptomycin-Glutamine Corning MT30009CI DMEM w/o Serine and Nicotinamide US Biologicals D9810-02 L-Serine Sigma S4311 Dialyzed FBS Thermo Fisher 26400044 Nicotinamide Sigma N0636 MwoI NEB R0573 Proteinase K NEB P8107S TURBO DNAase Invitrogen AM2238 Dulbecco’s MEM (DMEM) High Glucose, w/L-Glutamine, w/o Phenol Red, Na Pyruvate, Vitamins US Biological Lifesciences D9801-05 (Continued on next page) ll OPEN ACCESS e1 Cell 189, 1–15.e1–e10, April 30, 2026 Please cite this article in press as: Garg et al., Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease, Cell (2026), https:// doi.org/10.1016/j.cell.2026.01.022 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER L-Valine (D8, 98%) Cambridge Isotope Laboratories, Inc. DLM-488-0.25 Ammonium Acetate Honeywell 14267 Critical commercial assays Blood and Cell Culture DNA Maxi Kit Qiagen 13323 In Situ Cell Death Detection Kit, Fluorescein Roche 11684795910 GEM-X Flex Sample Preparation v2 Kit 10X Genomics PN-1000781 GEM-X Flex Mouse Transcriptome Probe Kit 10X Genomics PN-1000902 Agilent High Sensitivity DNA Kit Agilent 5067-4626 Papain Dissociation System, Without EBSS Worthington Biochemical LK003160 CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Deposited data Mouse reference 10x Genomics (GRCm39) - 2024-A https://www.10xgenomics.com/support/ software/cell-ranger/downloads snRNA-seq data GEO: GSE304377 This paper CellMarker 2.0 mouse brain cell marker database Hu et al. 48 http://www.bio-bigdata.center/ CellMarker_download.html Gene Ontology Biological Processes Ashburner et al. 49 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae7 fa0bd6ec/shiny_run/databases/ Mm_20250415.RData WikiPathways Agrawal et al. 50 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae7 fa0bd6ec/shiny_run/databases/ Mm_20250415.RData Pathway annotation databases, PFOCR Shin and Pico 51 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae 7fa0bd6ec/shiny_run/databases/ Mm_20250415.RData KEGG Kanehisa et al. 52 https://www.genome.jp/kegg/ko.html Gene sets: MSigDB Subramanian et al. 53 https://www.gsea-msigdb.org/gsea/msigdb Gene sets: Enrichr Chen et al. 54 https://maayanlab.cloud/Enrichr/ Chromium mouse transcriptome probe set v1.1.1 10x Genomics https://www.10xgenomics.com/support/ flex-gene-expression/documentation/ steps/probe-sets/chromium-frp-mousetranscriptome-probe-set-1-1 Experimental models: Cell lines .. Experimental models: Organisms/strains Mouse: C57BL/6NJ The Jackson Laboratory RRID: IMSR_JAX:005304 Mouse: Gpx4NIKO: Gpx4(f/f);Slick Chen et al. 23 N/A Mouse: Naxd KO This paper N/A Oligonucleotides crRNA: TCTGACGTCGAAGAAGCACA IDT This paper NAXD Exon 2 Fwd: GACCATCACTTCCCCAAGAA IDT This paper NAXD Exon 2 Rev: GAAACGATCACTGCACATGG IDT This paper Recombinant DNA Brunello Human CRISPR Knockout Pooled Library Addgene 73179-LV; RRID: Addgene_73179-LV (Continued on next page) ll OPEN ACCESS Cell 189, 1–15.e1–e10, April 30, 2026 e2 Please cite this article in press as: Garg et al., Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease, Cell (2026), https:// doi.org/10.1016/j.cell.2026.01.022 Article

    In Situ:

    Article Title: Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Iba1 Genetex GTX100042; RRID:AB_1240434 Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Invitrogen A-21206; RRID:AB_2535792 Chemicals, peptides, and recombinant proteins Vitamin B3 (nicotinamide) (D4, 98%) Cambridge Isotope Laboratories, Inc. DLM-6883-0.5 Mass Spectrometry Metabolite Library of Standards IROA Technologies MSMLS PHGDH Sino Biological 13167-H08E PSAT1 Novus Biologicals NBP1-78827 Nicotinamide Riboside Chloride MedChem Express HY-123033A BAMBANKER® Serum-Free Cell Freezing Media GC LYMPHOTEC Inc. CS-02-001 RNasin Plus Ribonuclease Inhibitor Promega N2611/N2615 Ethidium Homodimer-1 Invitrogen E1169 Rat Collagen Type I Sigma-Aldrich C3867 MEM, HEPES, no glutamine Gibco 12360038 Nutrient Mixture F-12 Ham Sigma-Aldrich N4888-500ML Endothelial Cell Growth Supplement Sigma-Aldrich 02-102 RSL3 Medchem Express HY-100218A Tamoxifen Sigma T5648 L-Ascorbic acid MilliporeSigma A4544 Pyridoxine hydrochloride Sigma-Aldrich P9755 D-Calcium pantothenate Sigma-Aldrich P5155 Thiamine hydrochloride >99% Sigma-Aldrich T1270 i-Inositol Sigma-Aldrich I7508 choline chloride Sigma-Aldrich C7527 Folic acid Sigma-Aldrich F8758 Riboflavin Sigma-Aldrich R9504 Heparin Sigma-Aldrich H3149 Normal Donkey serum Abcam ab7475 Puromycin Sigma-Aldrich P8833 DMEM Gibco 11995073 AMPure XP Beads Beckman Coulter A63880 FBS Corning MT35015CV Penicillin-Streptomycin-Glutamine Corning MT30009CI DMEM w/o Serine and Nicotinamide US Biologicals D9810-02 L-Serine Sigma S4311 Dialyzed FBS Thermo Fisher 26400044 Nicotinamide Sigma N0636 MwoI NEB R0573 Proteinase K NEB P8107S TURBO DNAase Invitrogen AM2238 Dulbecco’s MEM (DMEM) High Glucose, w/L-Glutamine, w/o Phenol Red, Na Pyruvate, Vitamins US Biological Lifesciences D9801-05 (Continued on next page) ll OPEN ACCESS e1 Cell 189, 1–15.e1–e10, April 30, 2026 Please cite this article in press as: Garg et al., Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease, Cell (2026), https:// doi.org/10.1016/j.cell.2026.01.022 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER L-Valine (D8, 98%) Cambridge Isotope Laboratories, Inc. DLM-488-0.25 Ammonium Acetate Honeywell 14267 Critical commercial assays Blood and Cell Culture DNA Maxi Kit Qiagen 13323 In Situ Cell Death Detection Kit, Fluorescein Roche 11684795910 GEM-X Flex Sample Preparation v2 Kit 10X Genomics PN-1000781 GEM-X Flex Mouse Transcriptome Probe Kit 10X Genomics PN-1000902 Agilent High Sensitivity DNA Kit Agilent 5067-4626 Papain Dissociation System, Without EBSS Worthington Biochemical LK003160 CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Deposited data Mouse reference 10x Genomics (GRCm39) - 2024-A https://www.10xgenomics.com/support/ software/cell-ranger/downloads snRNA-seq data GEO: GSE304377 This paper CellMarker 2.0 mouse brain cell marker database Hu et al. 48 http://www.bio-bigdata.center/ CellMarker_download.html Gene Ontology Biological Processes Ashburner et al. 49 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae7 fa0bd6ec/shiny_run/databases/ Mm_20250415.RData WikiPathways Agrawal et al. 50 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae7 fa0bd6ec/shiny_run/databases/ Mm_20250415.RData Pathway annotation databases, PFOCR Shin and Pico 51 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae 7fa0bd6ec/shiny_run/databases/ Mm_20250415.RData KEGG Kanehisa et al. 52 https://www.genome.jp/kegg/ko.html Gene sets: MSigDB Subramanian et al. 53 https://www.gsea-msigdb.org/gsea/msigdb Gene sets: Enrichr Chen et al. 54 https://maayanlab.cloud/Enrichr/ Chromium mouse transcriptome probe set v1.1.1 10x Genomics https://www.10xgenomics.com/support/ flex-gene-expression/documentation/ steps/probe-sets/chromium-frp-mousetranscriptome-probe-set-1-1 Experimental models: Cell lines .. Experimental models: Organisms/strains Mouse: C57BL/6NJ The Jackson Laboratory RRID: IMSR_JAX:005304 Mouse: Gpx4NIKO: Gpx4(f/f);Slick Chen et al. 23 N/A Mouse: Naxd KO This paper N/A Oligonucleotides crRNA: TCTGACGTCGAAGAAGCACA IDT This paper NAXD Exon 2 Fwd: GACCATCACTTCCCCAAGAA IDT This paper NAXD Exon 2 Rev: GAAACGATCACTGCACATGG IDT This paper Recombinant DNA Brunello Human CRISPR Knockout Pooled Library Addgene 73179-LV; RRID: Addgene_73179-LV (Continued on next page) ll OPEN ACCESS Cell 189, 1–15.e1–e10, April 30, 2026 e2 Please cite this article in press as: Garg et al., Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease, Cell (2026), https:// doi.org/10.1016/j.cell.2026.01.022 Article

    Sample Prep:

    Article Title: Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Iba1 Genetex GTX100042; RRID:AB_1240434 Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Invitrogen A-21206; RRID:AB_2535792 Chemicals, peptides, and recombinant proteins Vitamin B3 (nicotinamide) (D4, 98%) Cambridge Isotope Laboratories, Inc. DLM-6883-0.5 Mass Spectrometry Metabolite Library of Standards IROA Technologies MSMLS PHGDH Sino Biological 13167-H08E PSAT1 Novus Biologicals NBP1-78827 Nicotinamide Riboside Chloride MedChem Express HY-123033A BAMBANKER® Serum-Free Cell Freezing Media GC LYMPHOTEC Inc. CS-02-001 RNasin Plus Ribonuclease Inhibitor Promega N2611/N2615 Ethidium Homodimer-1 Invitrogen E1169 Rat Collagen Type I Sigma-Aldrich C3867 MEM, HEPES, no glutamine Gibco 12360038 Nutrient Mixture F-12 Ham Sigma-Aldrich N4888-500ML Endothelial Cell Growth Supplement Sigma-Aldrich 02-102 RSL3 Medchem Express HY-100218A Tamoxifen Sigma T5648 L-Ascorbic acid MilliporeSigma A4544 Pyridoxine hydrochloride Sigma-Aldrich P9755 D-Calcium pantothenate Sigma-Aldrich P5155 Thiamine hydrochloride >99% Sigma-Aldrich T1270 i-Inositol Sigma-Aldrich I7508 choline chloride Sigma-Aldrich C7527 Folic acid Sigma-Aldrich F8758 Riboflavin Sigma-Aldrich R9504 Heparin Sigma-Aldrich H3149 Normal Donkey serum Abcam ab7475 Puromycin Sigma-Aldrich P8833 DMEM Gibco 11995073 AMPure XP Beads Beckman Coulter A63880 FBS Corning MT35015CV Penicillin-Streptomycin-Glutamine Corning MT30009CI DMEM w/o Serine and Nicotinamide US Biologicals D9810-02 L-Serine Sigma S4311 Dialyzed FBS Thermo Fisher 26400044 Nicotinamide Sigma N0636 MwoI NEB R0573 Proteinase K NEB P8107S TURBO DNAase Invitrogen AM2238 Dulbecco’s MEM (DMEM) High Glucose, w/L-Glutamine, w/o Phenol Red, Na Pyruvate, Vitamins US Biological Lifesciences D9801-05 (Continued on next page) ll OPEN ACCESS e1 Cell 189, 1–15.e1–e10, April 30, 2026 Please cite this article in press as: Garg et al., Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease, Cell (2026), https:// doi.org/10.1016/j.cell.2026.01.022 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER L-Valine (D8, 98%) Cambridge Isotope Laboratories, Inc. DLM-488-0.25 Ammonium Acetate Honeywell 14267 Critical commercial assays Blood and Cell Culture DNA Maxi Kit Qiagen 13323 In Situ Cell Death Detection Kit, Fluorescein Roche 11684795910 GEM-X Flex Sample Preparation v2 Kit 10X Genomics PN-1000781 GEM-X Flex Mouse Transcriptome Probe Kit 10X Genomics PN-1000902 Agilent High Sensitivity DNA Kit Agilent 5067-4626 Papain Dissociation System, Without EBSS Worthington Biochemical LK003160 CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Deposited data Mouse reference 10x Genomics (GRCm39) - 2024-A https://www.10xgenomics.com/support/ software/cell-ranger/downloads snRNA-seq data GEO: GSE304377 This paper CellMarker 2.0 mouse brain cell marker database Hu et al. 48 http://www.bio-bigdata.center/ CellMarker_download.html Gene Ontology Biological Processes Ashburner et al. 49 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae7 fa0bd6ec/shiny_run/databases/ Mm_20250415.RData WikiPathways Agrawal et al. 50 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae7 fa0bd6ec/shiny_run/databases/ Mm_20250415.RData Pathway annotation databases, PFOCR Shin and Pico 51 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae 7fa0bd6ec/shiny_run/databases/ Mm_20250415.RData KEGG Kanehisa et al. 52 https://www.genome.jp/kegg/ko.html Gene sets: MSigDB Subramanian et al. 53 https://www.gsea-msigdb.org/gsea/msigdb Gene sets: Enrichr Chen et al. 54 https://maayanlab.cloud/Enrichr/ Chromium mouse transcriptome probe set v1.1.1 10x Genomics https://www.10xgenomics.com/support/ flex-gene-expression/documentation/ steps/probe-sets/chromium-frp-mousetranscriptome-probe-set-1-1 Experimental models: Cell lines .. Experimental models: Organisms/strains Mouse: C57BL/6NJ The Jackson Laboratory RRID: IMSR_JAX:005304 Mouse: Gpx4NIKO: Gpx4(f/f);Slick Chen et al. 23 N/A Mouse: Naxd KO This paper N/A Oligonucleotides crRNA: TCTGACGTCGAAGAAGCACA IDT This paper NAXD Exon 2 Fwd: GACCATCACTTCCCCAAGAA IDT This paper NAXD Exon 2 Rev: GAAACGATCACTGCACATGG IDT This paper Recombinant DNA Brunello Human CRISPR Knockout Pooled Library Addgene 73179-LV; RRID: Addgene_73179-LV (Continued on next page) ll OPEN ACCESS Cell 189, 1–15.e1–e10, April 30, 2026 e2 Please cite this article in press as: Garg et al., Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease, Cell (2026), https:// doi.org/10.1016/j.cell.2026.01.022 Article

    Cell Viability Assay:

    Article Title: Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Iba1 Genetex GTX100042; RRID:AB_1240434 Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Invitrogen A-21206; RRID:AB_2535792 Chemicals, peptides, and recombinant proteins Vitamin B3 (nicotinamide) (D4, 98%) Cambridge Isotope Laboratories, Inc. DLM-6883-0.5 Mass Spectrometry Metabolite Library of Standards IROA Technologies MSMLS PHGDH Sino Biological 13167-H08E PSAT1 Novus Biologicals NBP1-78827 Nicotinamide Riboside Chloride MedChem Express HY-123033A BAMBANKER® Serum-Free Cell Freezing Media GC LYMPHOTEC Inc. CS-02-001 RNasin Plus Ribonuclease Inhibitor Promega N2611/N2615 Ethidium Homodimer-1 Invitrogen E1169 Rat Collagen Type I Sigma-Aldrich C3867 MEM, HEPES, no glutamine Gibco 12360038 Nutrient Mixture F-12 Ham Sigma-Aldrich N4888-500ML Endothelial Cell Growth Supplement Sigma-Aldrich 02-102 RSL3 Medchem Express HY-100218A Tamoxifen Sigma T5648 L-Ascorbic acid MilliporeSigma A4544 Pyridoxine hydrochloride Sigma-Aldrich P9755 D-Calcium pantothenate Sigma-Aldrich P5155 Thiamine hydrochloride >99% Sigma-Aldrich T1270 i-Inositol Sigma-Aldrich I7508 choline chloride Sigma-Aldrich C7527 Folic acid Sigma-Aldrich F8758 Riboflavin Sigma-Aldrich R9504 Heparin Sigma-Aldrich H3149 Normal Donkey serum Abcam ab7475 Puromycin Sigma-Aldrich P8833 DMEM Gibco 11995073 AMPure XP Beads Beckman Coulter A63880 FBS Corning MT35015CV Penicillin-Streptomycin-Glutamine Corning MT30009CI DMEM w/o Serine and Nicotinamide US Biologicals D9810-02 L-Serine Sigma S4311 Dialyzed FBS Thermo Fisher 26400044 Nicotinamide Sigma N0636 MwoI NEB R0573 Proteinase K NEB P8107S TURBO DNAase Invitrogen AM2238 Dulbecco’s MEM (DMEM) High Glucose, w/L-Glutamine, w/o Phenol Red, Na Pyruvate, Vitamins US Biological Lifesciences D9801-05 (Continued on next page) ll OPEN ACCESS e1 Cell 189, 1–15.e1–e10, April 30, 2026 Please cite this article in press as: Garg et al., Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease, Cell (2026), https:// doi.org/10.1016/j.cell.2026.01.022 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER L-Valine (D8, 98%) Cambridge Isotope Laboratories, Inc. DLM-488-0.25 Ammonium Acetate Honeywell 14267 Critical commercial assays Blood and Cell Culture DNA Maxi Kit Qiagen 13323 In Situ Cell Death Detection Kit, Fluorescein Roche 11684795910 GEM-X Flex Sample Preparation v2 Kit 10X Genomics PN-1000781 GEM-X Flex Mouse Transcriptome Probe Kit 10X Genomics PN-1000902 Agilent High Sensitivity DNA Kit Agilent 5067-4626 Papain Dissociation System, Without EBSS Worthington Biochemical LK003160 CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Deposited data Mouse reference 10x Genomics (GRCm39) - 2024-A https://www.10xgenomics.com/support/ software/cell-ranger/downloads snRNA-seq data GEO: GSE304377 This paper CellMarker 2.0 mouse brain cell marker database Hu et al. 48 http://www.bio-bigdata.center/ CellMarker_download.html Gene Ontology Biological Processes Ashburner et al. 49 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae7 fa0bd6ec/shiny_run/databases/ Mm_20250415.RData WikiPathways Agrawal et al. 50 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae7 fa0bd6ec/shiny_run/databases/ Mm_20250415.RData Pathway annotation databases, PFOCR Shin and Pico 51 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae 7fa0bd6ec/shiny_run/databases/ Mm_20250415.RData KEGG Kanehisa et al. 52 https://www.genome.jp/kegg/ko.html Gene sets: MSigDB Subramanian et al. 53 https://www.gsea-msigdb.org/gsea/msigdb Gene sets: Enrichr Chen et al. 54 https://maayanlab.cloud/Enrichr/ Chromium mouse transcriptome probe set v1.1.1 10x Genomics https://www.10xgenomics.com/support/ flex-gene-expression/documentation/ steps/probe-sets/chromium-frp-mousetranscriptome-probe-set-1-1 Experimental models: Cell lines .. Experimental models: Organisms/strains Mouse: C57BL/6NJ The Jackson Laboratory RRID: IMSR_JAX:005304 Mouse: Gpx4NIKO: Gpx4(f/f);Slick Chen et al. 23 N/A Mouse: Naxd KO This paper N/A Oligonucleotides crRNA: TCTGACGTCGAAGAAGCACA IDT This paper NAXD Exon 2 Fwd: GACCATCACTTCCCCAAGAA IDT This paper NAXD Exon 2 Rev: GAAACGATCACTGCACATGG IDT This paper Recombinant DNA Brunello Human CRISPR Knockout Pooled Library Addgene 73179-LV; RRID: Addgene_73179-LV (Continued on next page) ll OPEN ACCESS Cell 189, 1–15.e1–e10, April 30, 2026 e2 Please cite this article in press as: Garg et al., Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease, Cell (2026), https:// doi.org/10.1016/j.cell.2026.01.022 Article

    Software:

    Article Title: Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Iba1 Genetex GTX100042; RRID:AB_1240434 Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Invitrogen A-21206; RRID:AB_2535792 Chemicals, peptides, and recombinant proteins Vitamin B3 (nicotinamide) (D4, 98%) Cambridge Isotope Laboratories, Inc. DLM-6883-0.5 Mass Spectrometry Metabolite Library of Standards IROA Technologies MSMLS PHGDH Sino Biological 13167-H08E PSAT1 Novus Biologicals NBP1-78827 Nicotinamide Riboside Chloride MedChem Express HY-123033A BAMBANKER® Serum-Free Cell Freezing Media GC LYMPHOTEC Inc. CS-02-001 RNasin Plus Ribonuclease Inhibitor Promega N2611/N2615 Ethidium Homodimer-1 Invitrogen E1169 Rat Collagen Type I Sigma-Aldrich C3867 MEM, HEPES, no glutamine Gibco 12360038 Nutrient Mixture F-12 Ham Sigma-Aldrich N4888-500ML Endothelial Cell Growth Supplement Sigma-Aldrich 02-102 RSL3 Medchem Express HY-100218A Tamoxifen Sigma T5648 L-Ascorbic acid MilliporeSigma A4544 Pyridoxine hydrochloride Sigma-Aldrich P9755 D-Calcium pantothenate Sigma-Aldrich P5155 Thiamine hydrochloride >99% Sigma-Aldrich T1270 i-Inositol Sigma-Aldrich I7508 choline chloride Sigma-Aldrich C7527 Folic acid Sigma-Aldrich F8758 Riboflavin Sigma-Aldrich R9504 Heparin Sigma-Aldrich H3149 Normal Donkey serum Abcam ab7475 Puromycin Sigma-Aldrich P8833 DMEM Gibco 11995073 AMPure XP Beads Beckman Coulter A63880 FBS Corning MT35015CV Penicillin-Streptomycin-Glutamine Corning MT30009CI DMEM w/o Serine and Nicotinamide US Biologicals D9810-02 L-Serine Sigma S4311 Dialyzed FBS Thermo Fisher 26400044 Nicotinamide Sigma N0636 MwoI NEB R0573 Proteinase K NEB P8107S TURBO DNAase Invitrogen AM2238 Dulbecco’s MEM (DMEM) High Glucose, w/L-Glutamine, w/o Phenol Red, Na Pyruvate, Vitamins US Biological Lifesciences D9801-05 (Continued on next page) ll OPEN ACCESS e1 Cell 189, 1–15.e1–e10, April 30, 2026 Please cite this article in press as: Garg et al., Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease, Cell (2026), https:// doi.org/10.1016/j.cell.2026.01.022 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER L-Valine (D8, 98%) Cambridge Isotope Laboratories, Inc. DLM-488-0.25 Ammonium Acetate Honeywell 14267 Critical commercial assays Blood and Cell Culture DNA Maxi Kit Qiagen 13323 In Situ Cell Death Detection Kit, Fluorescein Roche 11684795910 GEM-X Flex Sample Preparation v2 Kit 10X Genomics PN-1000781 GEM-X Flex Mouse Transcriptome Probe Kit 10X Genomics PN-1000902 Agilent High Sensitivity DNA Kit Agilent 5067-4626 Papain Dissociation System, Without EBSS Worthington Biochemical LK003160 CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Deposited data Mouse reference 10x Genomics (GRCm39) - 2024-A https://www.10xgenomics.com/support/ software/cell-ranger/downloads snRNA-seq data GEO: GSE304377 This paper CellMarker 2.0 mouse brain cell marker database Hu et al. 48 http://www.bio-bigdata.center/ CellMarker_download.html Gene Ontology Biological Processes Ashburner et al. 49 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae7 fa0bd6ec/shiny_run/databases/ Mm_20250415.RData WikiPathways Agrawal et al. 50 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae7 fa0bd6ec/shiny_run/databases/ Mm_20250415.RData Pathway annotation databases, PFOCR Shin and Pico 51 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae 7fa0bd6ec/shiny_run/databases/ Mm_20250415.RData KEGG Kanehisa et al. 52 https://www.genome.jp/kegg/ko.html Gene sets: MSigDB Subramanian et al. 53 https://www.gsea-msigdb.org/gsea/msigdb Gene sets: Enrichr Chen et al. 54 https://maayanlab.cloud/Enrichr/ Chromium mouse transcriptome probe set v1.1.1 10x Genomics https://www.10xgenomics.com/support/ flex-gene-expression/documentation/ steps/probe-sets/chromium-frp-mousetranscriptome-probe-set-1-1 Experimental models: Cell lines .. Experimental models: Organisms/strains Mouse: C57BL/6NJ The Jackson Laboratory RRID: IMSR_JAX:005304 Mouse: Gpx4NIKO: Gpx4(f/f);Slick Chen et al. 23 N/A Mouse: Naxd KO This paper N/A Oligonucleotides crRNA: TCTGACGTCGAAGAAGCACA IDT This paper NAXD Exon 2 Fwd: GACCATCACTTCCCCAAGAA IDT This paper NAXD Exon 2 Rev: GAAACGATCACTGCACATGG IDT This paper Recombinant DNA Brunello Human CRISPR Knockout Pooled Library Addgene 73179-LV; RRID: Addgene_73179-LV (Continued on next page) ll OPEN ACCESS Cell 189, 1–15.e1–e10, April 30, 2026 e2 Please cite this article in press as: Garg et al., Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease, Cell (2026), https:// doi.org/10.1016/j.cell.2026.01.022 Article

    Marker:

    Article Title: Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Iba1 Genetex GTX100042; RRID:AB_1240434 Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Invitrogen A-21206; RRID:AB_2535792 Chemicals, peptides, and recombinant proteins Vitamin B3 (nicotinamide) (D4, 98%) Cambridge Isotope Laboratories, Inc. DLM-6883-0.5 Mass Spectrometry Metabolite Library of Standards IROA Technologies MSMLS PHGDH Sino Biological 13167-H08E PSAT1 Novus Biologicals NBP1-78827 Nicotinamide Riboside Chloride MedChem Express HY-123033A BAMBANKER® Serum-Free Cell Freezing Media GC LYMPHOTEC Inc. CS-02-001 RNasin Plus Ribonuclease Inhibitor Promega N2611/N2615 Ethidium Homodimer-1 Invitrogen E1169 Rat Collagen Type I Sigma-Aldrich C3867 MEM, HEPES, no glutamine Gibco 12360038 Nutrient Mixture F-12 Ham Sigma-Aldrich N4888-500ML Endothelial Cell Growth Supplement Sigma-Aldrich 02-102 RSL3 Medchem Express HY-100218A Tamoxifen Sigma T5648 L-Ascorbic acid MilliporeSigma A4544 Pyridoxine hydrochloride Sigma-Aldrich P9755 D-Calcium pantothenate Sigma-Aldrich P5155 Thiamine hydrochloride >99% Sigma-Aldrich T1270 i-Inositol Sigma-Aldrich I7508 choline chloride Sigma-Aldrich C7527 Folic acid Sigma-Aldrich F8758 Riboflavin Sigma-Aldrich R9504 Heparin Sigma-Aldrich H3149 Normal Donkey serum Abcam ab7475 Puromycin Sigma-Aldrich P8833 DMEM Gibco 11995073 AMPure XP Beads Beckman Coulter A63880 FBS Corning MT35015CV Penicillin-Streptomycin-Glutamine Corning MT30009CI DMEM w/o Serine and Nicotinamide US Biologicals D9810-02 L-Serine Sigma S4311 Dialyzed FBS Thermo Fisher 26400044 Nicotinamide Sigma N0636 MwoI NEB R0573 Proteinase K NEB P8107S TURBO DNAase Invitrogen AM2238 Dulbecco’s MEM (DMEM) High Glucose, w/L-Glutamine, w/o Phenol Red, Na Pyruvate, Vitamins US Biological Lifesciences D9801-05 (Continued on next page) ll OPEN ACCESS e1 Cell 189, 1–15.e1–e10, April 30, 2026 Please cite this article in press as: Garg et al., Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease, Cell (2026), https:// doi.org/10.1016/j.cell.2026.01.022 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER L-Valine (D8, 98%) Cambridge Isotope Laboratories, Inc. DLM-488-0.25 Ammonium Acetate Honeywell 14267 Critical commercial assays Blood and Cell Culture DNA Maxi Kit Qiagen 13323 In Situ Cell Death Detection Kit, Fluorescein Roche 11684795910 GEM-X Flex Sample Preparation v2 Kit 10X Genomics PN-1000781 GEM-X Flex Mouse Transcriptome Probe Kit 10X Genomics PN-1000902 Agilent High Sensitivity DNA Kit Agilent 5067-4626 Papain Dissociation System, Without EBSS Worthington Biochemical LK003160 CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Deposited data Mouse reference 10x Genomics (GRCm39) - 2024-A https://www.10xgenomics.com/support/ software/cell-ranger/downloads snRNA-seq data GEO: GSE304377 This paper CellMarker 2.0 mouse brain cell marker database Hu et al. 48 http://www.bio-bigdata.center/ CellMarker_download.html Gene Ontology Biological Processes Ashburner et al. 49 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae7 fa0bd6ec/shiny_run/databases/ Mm_20250415.RData WikiPathways Agrawal et al. 50 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae7 fa0bd6ec/shiny_run/databases/ Mm_20250415.RData Pathway annotation databases, PFOCR Shin and Pico 51 https://github.com/gladstone-institutes/ Interactive-Enrichment-Analysis/blob/ b79df2998e4634e78a8b4d3934598ae 7fa0bd6ec/shiny_run/databases/ Mm_20250415.RData KEGG Kanehisa et al. 52 https://www.genome.jp/kegg/ko.html Gene sets: MSigDB Subramanian et al. 53 https://www.gsea-msigdb.org/gsea/msigdb Gene sets: Enrichr Chen et al. 54 https://maayanlab.cloud/Enrichr/ Chromium mouse transcriptome probe set v1.1.1 10x Genomics https://www.10xgenomics.com/support/ flex-gene-expression/documentation/ steps/probe-sets/chromium-frp-mousetranscriptome-probe-set-1-1 Experimental models: Cell lines .. Experimental models: Organisms/strains Mouse: C57BL/6NJ The Jackson Laboratory RRID: IMSR_JAX:005304 Mouse: Gpx4NIKO: Gpx4(f/f);Slick Chen et al. 23 N/A Mouse: Naxd KO This paper N/A Oligonucleotides crRNA: TCTGACGTCGAAGAAGCACA IDT This paper NAXD Exon 2 Fwd: GACCATCACTTCCCCAAGAA IDT This paper NAXD Exon 2 Rev: GAAACGATCACTGCACATGG IDT This paper Recombinant DNA Brunello Human CRISPR Knockout Pooled Library Addgene 73179-LV; RRID: Addgene_73179-LV (Continued on next page) ll OPEN ACCESS Cell 189, 1–15.e1–e10, April 30, 2026 e2 Please cite this article in press as: Garg et al., Vitamin B2 and B3 nutrigenomics reveals a therapy for NAXD disease, Cell (2026), https:// doi.org/10.1016/j.cell.2026.01.022 Article

    Virus:

    Article Title: Transcriptomic and spatial organization of mouse spinal cord projection neurons.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Life Technology Cat#A11122; RRID: AB_221569 Rabbit anti-DsRed Clontech Cat#632496; RRID: AB_10013483 Rabbit anti-c-Fos Synaptic System Cat#226008; RRID: AB_2891278 Donkey anti-rabbit IgG-Cy3 Jackson ImmunoResearch Laboratories Cat#711-165-152; RRID: AB_2307443 Donkey anti-rabbit IgG-Alexa 488 Jackson ImmunoResearch Laboratories Cat#711-545-152; RRID: AB_2313584 Bacterial and virus strains scAAV2/2-retro-hSyn-Cre Shanghai Taitool Inc S0292-2R AAV2/9-CAG-FLEX-mRuby3 Shanghai Taitool Inc S0653-9 AAV2/8-hSyn-DIO-synaptophysin-tdTomato Shanghai Taitool Inc XT140 AAV2/8-hEF1α-DIO-hChR2(H134R)-EYFP Shanghai Taitool Inc S0199 AAV2/9-hEF1a-DIO-EYFP Shanghai Taitool Inc S0196-9 AAV2/9-hEF1a-fDIO-hM4Di-mCherry Shanghai Taitool Inc S0336-9 AAV2/9-hEF1a-fDIO-mCherry Shanghai Taitool Inc S0553-9 AAV2/1-CMV_bGI-Cre-EGFP Shanghai Taitool Inc S0231-1 Biological samples Mouse spinal cord This paper N/A Mouse brain This paper N/A Chemicals, peptides, and recombinant proteins Streptavidin, Alexa Fluor 488 conjugate Invitrogen Cat#S11223 CTB555 Invitrogen Cat#C34776 TrypLE Express Gibco Cat#12604-013 DNase I Worthington Biochemical CatLK003163 NBQX Tocris Cat#0373 CPP Tocris Cat#0247 BSA Solarbio Cat#A8010 Debris removal solution Miltenyi Cat#130-109-398 Actinomycin D CST Cat#15021S Triptolide MCE Cat#HY-32735 Anisomycin MCE Cat#HY-18982 Biocytin Sigma Cat#B4261 Picrotoxin Tocris Cat#1128 Strychnine Tocris Cat#2785 RNAscope Probe-Slc17a6-C3 (Vglut2) Advanced Cell Diagnostics Cat#319171-C3 RNAscope Probe-Slc32a1-C2 (Vgat) Advanced Cell Diagnostics Cat#319191-C2 RNAscope Probe-Sncg Advanced Cell Diagnostics Cat#482741-C2 RNAscope Probe-Fos Advanced Cell Diagnostics Cat#316921-C3 RNAscope Probe-Qrfpr Advanced Cell Diagnostics Cat#566341 RNAscope Probe-Nmu Advanced Cell Diagnostics Cat#446831 Critical commercial assays TSA Cyanine 3 Plus Evaluation Kit PerkinElmer Cat#NEL744E001KT TSA Cyanine 5 Plus Evaluation Kit PerkinElmer Cat#NEL745E001KT TSA Fluorescein Plus Evaluation Kit PerkinElmer Cat#NEL741E001KT Papain dissociation system Worthington Biochemical Cat#LK003163 (Continued on next page) 18 Cell Reports 45, 116717, January 27, 2026 ..

    Recombinant:

    Article Title: Transcriptomic and spatial organization of mouse spinal cord projection neurons.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Life Technology Cat#A11122; RRID: AB_221569 Rabbit anti-DsRed Clontech Cat#632496; RRID: AB_10013483 Rabbit anti-c-Fos Synaptic System Cat#226008; RRID: AB_2891278 Donkey anti-rabbit IgG-Cy3 Jackson ImmunoResearch Laboratories Cat#711-165-152; RRID: AB_2307443 Donkey anti-rabbit IgG-Alexa 488 Jackson ImmunoResearch Laboratories Cat#711-545-152; RRID: AB_2313584 Bacterial and virus strains scAAV2/2-retro-hSyn-Cre Shanghai Taitool Inc S0292-2R AAV2/9-CAG-FLEX-mRuby3 Shanghai Taitool Inc S0653-9 AAV2/8-hSyn-DIO-synaptophysin-tdTomato Shanghai Taitool Inc XT140 AAV2/8-hEF1α-DIO-hChR2(H134R)-EYFP Shanghai Taitool Inc S0199 AAV2/9-hEF1a-DIO-EYFP Shanghai Taitool Inc S0196-9 AAV2/9-hEF1a-fDIO-hM4Di-mCherry Shanghai Taitool Inc S0336-9 AAV2/9-hEF1a-fDIO-mCherry Shanghai Taitool Inc S0553-9 AAV2/1-CMV_bGI-Cre-EGFP Shanghai Taitool Inc S0231-1 Biological samples Mouse spinal cord This paper N/A Mouse brain This paper N/A Chemicals, peptides, and recombinant proteins Streptavidin, Alexa Fluor 488 conjugate Invitrogen Cat#S11223 CTB555 Invitrogen Cat#C34776 TrypLE Express Gibco Cat#12604-013 DNase I Worthington Biochemical CatLK003163 NBQX Tocris Cat#0373 CPP Tocris Cat#0247 BSA Solarbio Cat#A8010 Debris removal solution Miltenyi Cat#130-109-398 Actinomycin D CST Cat#15021S Triptolide MCE Cat#HY-32735 Anisomycin MCE Cat#HY-18982 Biocytin Sigma Cat#B4261 Picrotoxin Tocris Cat#1128 Strychnine Tocris Cat#2785 RNAscope Probe-Slc17a6-C3 (Vglut2) Advanced Cell Diagnostics Cat#319171-C3 RNAscope Probe-Slc32a1-C2 (Vgat) Advanced Cell Diagnostics Cat#319191-C2 RNAscope Probe-Sncg Advanced Cell Diagnostics Cat#482741-C2 RNAscope Probe-Fos Advanced Cell Diagnostics Cat#316921-C3 RNAscope Probe-Qrfpr Advanced Cell Diagnostics Cat#566341 RNAscope Probe-Nmu Advanced Cell Diagnostics Cat#446831 Critical commercial assays TSA Cyanine 3 Plus Evaluation Kit PerkinElmer Cat#NEL744E001KT TSA Cyanine 5 Plus Evaluation Kit PerkinElmer Cat#NEL745E001KT TSA Fluorescein Plus Evaluation Kit PerkinElmer Cat#NEL741E001KT Papain dissociation system Worthington Biochemical Cat#LK003163 (Continued on next page) 18 Cell Reports 45, 116717, January 27, 2026 ..

    RNAscope:

    Article Title: Transcriptomic and spatial organization of mouse spinal cord projection neurons.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Life Technology Cat#A11122; RRID: AB_221569 Rabbit anti-DsRed Clontech Cat#632496; RRID: AB_10013483 Rabbit anti-c-Fos Synaptic System Cat#226008; RRID: AB_2891278 Donkey anti-rabbit IgG-Cy3 Jackson ImmunoResearch Laboratories Cat#711-165-152; RRID: AB_2307443 Donkey anti-rabbit IgG-Alexa 488 Jackson ImmunoResearch Laboratories Cat#711-545-152; RRID: AB_2313584 Bacterial and virus strains scAAV2/2-retro-hSyn-Cre Shanghai Taitool Inc S0292-2R AAV2/9-CAG-FLEX-mRuby3 Shanghai Taitool Inc S0653-9 AAV2/8-hSyn-DIO-synaptophysin-tdTomato Shanghai Taitool Inc XT140 AAV2/8-hEF1α-DIO-hChR2(H134R)-EYFP Shanghai Taitool Inc S0199 AAV2/9-hEF1a-DIO-EYFP Shanghai Taitool Inc S0196-9 AAV2/9-hEF1a-fDIO-hM4Di-mCherry Shanghai Taitool Inc S0336-9 AAV2/9-hEF1a-fDIO-mCherry Shanghai Taitool Inc S0553-9 AAV2/1-CMV_bGI-Cre-EGFP Shanghai Taitool Inc S0231-1 Biological samples Mouse spinal cord This paper N/A Mouse brain This paper N/A Chemicals, peptides, and recombinant proteins Streptavidin, Alexa Fluor 488 conjugate Invitrogen Cat#S11223 CTB555 Invitrogen Cat#C34776 TrypLE Express Gibco Cat#12604-013 DNase I Worthington Biochemical CatLK003163 NBQX Tocris Cat#0373 CPP Tocris Cat#0247 BSA Solarbio Cat#A8010 Debris removal solution Miltenyi Cat#130-109-398 Actinomycin D CST Cat#15021S Triptolide MCE Cat#HY-32735 Anisomycin MCE Cat#HY-18982 Biocytin Sigma Cat#B4261 Picrotoxin Tocris Cat#1128 Strychnine Tocris Cat#2785 RNAscope Probe-Slc17a6-C3 (Vglut2) Advanced Cell Diagnostics Cat#319171-C3 RNAscope Probe-Slc32a1-C2 (Vgat) Advanced Cell Diagnostics Cat#319191-C2 RNAscope Probe-Sncg Advanced Cell Diagnostics Cat#482741-C2 RNAscope Probe-Fos Advanced Cell Diagnostics Cat#316921-C3 RNAscope Probe-Qrfpr Advanced Cell Diagnostics Cat#566341 RNAscope Probe-Nmu Advanced Cell Diagnostics Cat#446831 Critical commercial assays TSA Cyanine 3 Plus Evaluation Kit PerkinElmer Cat#NEL744E001KT TSA Cyanine 5 Plus Evaluation Kit PerkinElmer Cat#NEL745E001KT TSA Fluorescein Plus Evaluation Kit PerkinElmer Cat#NEL741E001KT Papain dissociation system Worthington Biochemical Cat#LK003163 (Continued on next page) 18 Cell Reports 45, 116717, January 27, 2026 ..

    other:

    Article Title: Protocol to sequentially isolate mouse oligodendrocytes, microglia, endothelial cells, astrocytes, and neurons via magnetic cell sorting
    Article Snippet: Worthington Papain Dissociation Kit albumin ovomucoid inhibitor • Add 32 mL of EBSS (vial 1) to the albumin ovomucoid inhibitor mixture (vial 4).

    Article Title: Protocol to sequentially isolate mouse oligodendrocytes, microglia, endothelial cells, astrocytes, and neurons via magnetic cell sorting
    Article Snippet: Worthington Papain Dissociation Kit albumin papain/DNAse solution • Add 5 mL of supplemented EBSS solution to the papain vial (vial 2).



    Similar Products

    ebss buffer  (Worthington Biochemical)
    94
    Worthington Biochemical ebss buffer
    Ebss Buffer, supplied by Worthington Biochemical, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+ebss/Deoxyribonuclease+I%2C+Recombinant/pmc12625545-63-9-11
    Average 94 stars, based on 1 article reviews
    ebss buffer - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    earl’s buffered salt solution (ebss)  (Thermo Fisher)
    90
    Thermo Fisher earl’s buffered salt solution (ebss)

    Earl’s Buffered Salt Solution (Ebss), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+ebss/chemicals+and+buffers/pmc11578587-227-6-10
    Average 90 stars, based on 1 article reviews
    earl’s buffered salt solution (ebss) - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    ebss buffer  (Servicebio Inc)
    86
    Servicebio Inc ebss buffer

    Ebss Buffer, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+ebss/buffer+ebss/pm41476177-305-9-12
    Average 86 stars, based on 1 article reviews
    ebss buffer - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    l amino acidfree ebss buffer  (Sangon Biotech)
    86
    Sangon Biotech l amino acidfree ebss buffer

    L Amino Acidfree Ebss Buffer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+ebss/acidfree+amino+buffer+ebss+l/10__15302_slash_vita__2026__03__0017-298-1-11
    Average 86 stars, based on 1 article reviews
    l amino acidfree ebss buffer - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    buffer ebss  (R&D Systems)
    93
    R&D Systems buffer ebss

    Buffer Ebss, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+ebss/EBSS%2C+Ca+and+Mg+salts%2C+no+phenol+red/pmc12575911__43556_2025_329_MOESM1_ESM-29-5-8
    Average 93 stars, based on 1 article reviews
    buffer ebss - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    earle’s balanced salt solution (ebss, starvation buffer)  (Servicebio Inc)
    90
    Servicebio Inc earle’s balanced salt solution (ebss, starvation buffer)

    Earle’s Balanced Salt Solution (Ebss, Starvation Buffer), supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+ebss/earle%E2%80%99s+balanced+salt+solution++ebss++starvation+buffer+/pm40588669-151-16-23
    Average 90 stars, based on 1 article reviews
    earle’s balanced salt solution (ebss, starvation buffer) - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    ebss buffer  (US Biological Life Sciences)
    90
    US Biological Life Sciences ebss buffer

    Ebss Buffer, supplied by US Biological Life Sciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+ebss/ebss+buffer/pm40156554-325-7-19
    Average 90 stars, based on 1 article reviews
    ebss buffer - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    dissociation buffer  (Worthington Biochemical)
    99
    Worthington Biochemical dissociation buffer

    Dissociation Buffer, supplied by Worthington Biochemical, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+ebss/Papain+Dissociation+System%2C+Without+EBSS/pmc11502789-300-9-19
    Average 99 stars, based on 1 article reviews
    dissociation buffer - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: eLife

    Article Title: Motor neurons are dispensable for the assembly of a sensorimotor circuit for gaze stabilization

    doi: 10.7554/eLife.96893

    Figure Lengend Snippet:

    Article Snippet: Chemical compound, drug , Earl’s Buffered Salt Solution (EBSS) , Thermo Fisher Scientific , 24010043 , .

    Techniques: Electron Microscopy, Recombinant, In Situ Hybridization, Isolation, Purification, Sequencing, Software, CRISPR, Flow Cytometry