randomisation list (Eppendorf AG)
Eppendorf AG is a verified supplier 
96
Structured Review
Eppendorf AG
randomisation list
Randomisation List, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 96/100, based on 1367 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/block+randomisation/Block/pmc11788315-162-3-29
Average 96 stars, based on 1367 article reviews
Randomisation List, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 96/100, based on 1367 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/block+randomisation/Block/pmc11788315-162-3-29
Average 96 stars, based on 1367 article reviews
randomisation list - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Isolation:Article Title: CSPG4 + extracellular vesicles carry fibronectin and interleukin-11 and reflect radiographic severity in knee osteoarthritis Article Snippet: .. Thereafter, EVs were isolated from the cleared plasma and SF with SF digested in hyaluronidase from Streptomyces hyalurolyticus (Sigma-Aldrich, Saint Louis, MO, USA), 10 unit/mL, 1 h, 37 °C in an Eppendorf Clinical Proteomics:Article Title: CSPG4 + extracellular vesicles carry fibronectin and interleukin-11 and reflect radiographic severity in knee osteoarthritis Article Snippet: .. Thereafter, EVs were isolated from the cleared plasma and SF with SF digested in hyaluronidase from Streptomyces hyalurolyticus (Sigma-Aldrich, Saint Louis, MO, USA), 10 unit/mL, 1 h, 37 °C in an Eppendorf Blocking Assay:Article Title: CSPG4 + extracellular vesicles carry fibronectin and interleukin-11 and reflect radiographic severity in knee osteoarthritis Article Snippet: .. Thereafter, EVs were isolated from the cleared plasma and SF with SF digested in hyaluronidase from Streptomyces hyalurolyticus (Sigma-Aldrich, Saint Louis, MO, USA), 10 unit/mL, 1 h, 37 °C in an Eppendorf Article Title: Enterotoxin-encoding genes and antibiogram of Staphylococcus aureus isolated from nasal cavity of restaurant workers at the Taraba State University, Jalingo, Taraba State Article Snippet: Using a sterile applicator stick, three to five identical colonies were added to an Eppendorf tube containing solution of 50vμl lysostaphin (150 μg/ml) and 10 μl RNase (10 μg/ml). .. The tube was incubated at 37°C in the Article Title: Preparation and Assembly of the Axial Invasion Chamber for Live-Cell Invadopodia Imaging Article Snippet: .. While the ECM top and bottom layer mix aliquots are thawing, turn on the Article Title: Preparation and Assembly of the Axial Invasion Chamber for Live-Cell Invadopodia Imaging Article Snippet: Hotplate (Thermo Fisher Scientific, catalog number: 1152049H) 11. .. Article Title: A Simple and Fast Protocol to Detect Nucleophosmin 1 ( NPM1 ) Mutation and Fms-like Tyrosine Kinase 3 Internal Tandem Duplication ( FLT3 /ITD): Optimizing Laboratory Routine. Article Snippet: .. Before starting: • Heat the Article Title: Profiling large-scale protein occupancy on bacterial genomes using IPOD-HR. Article Snippet: Identifying genomic regions bound by individual proteins such as transcription factors is essential to understanding bacterial gene regulation; however, comprehensive understanding of the effect of protein occupancy on gene regulation would be prohibitively laborious and expensive to achieve using methods such as chromatin immunoprecipitation with sequencing (ChIP-seq) and ChIP with exonuclease treatment (ChIP-exo) for every protein and condition of interest.. Here we describe a protocol for performing in vivo protein occupancy display–high resolution (IPOD-HR), a powerful method for genome-wide profiling of protein-bound DNA in prokaryotic systems.. Although assay for transposase-accessible chromatin with sequencing (ATAC-seq) is the method of choice for assaying general protein occupancy in eukaryotic systems, bacterial nucleoid-associated proteins can affect ATAC-seq, rendering it unsuitable for use in bacteria. Article Title: Decoding how RNase E membrane targeting controls RNA degradosome activity in Pseudomonas aeruginosa Article Snippet: .. A slow 5-min cool-down was then done by leaving the tubes lying on top of the Incubation:Article Title: Enterotoxin-encoding genes and antibiogram of Staphylococcus aureus isolated from nasal cavity of restaurant workers at the Taraba State University, Jalingo, Taraba State Article Snippet: Using a sterile applicator stick, three to five identical colonies were added to an Eppendorf tube containing solution of 50vμl lysostaphin (150 μg/ml) and 10 μl RNase (10 μg/ml). .. The tube was incubated at 37°C in the other:Article Title: Redox regulation of neuroinflammatory pathways contributes to damage in Alzheimer's disease brain. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse IFN-β primers: 5’ TCCGAGCAGAGATCTTCAGGA 3’ (Forward) and 5’ TGCAACCACCACTCATTCTGAG 3’ (Reverse) This study N/A Human 18s primers: 5’ GTCGTAGTTCCGACCATA 3’ (Forward) and 5’ GCCCTTCCGTCAATTCCTTT 3’ (Reverse) This study N/A Mouse 18s primers: 5’ GGACCAGAGCGAAAGCATTTGCC 3’ (Forward) and 5’ TCAATCTCGGGTGGCTGAACGC 3’ (Reverse) This study N/A Recombinant DNA Human STING C148A expression plasmid VectorBuilder N/A Human STING wild-type expression plasmid VectorBuilder N/A Lentiviral vector encoding tdTomato-tagged human STING WT VectorBuilder N/A Lentiviral vector encoding tdTomato-tagged human STING C148A VectorBuilder N/A Software and algorithms GraphPad Prism GraphPad https://www.graphpad.com/features Image Studio LiCOR https://www.licorbio.com/image-studio-liteN/A Image J NIH https://imagej.net/ij/download.htmlN/A ll Article e3 Cell Chemical Biology 33, 1–13.e1–e8, July 16, 2026 apolipoprotein E allele, and Braak stage were included for patients in Table S1. Aerosol:Article Title: Profiling large-scale protein occupancy on bacterial genomes using IPOD-HR. Article Snippet: Identifying genomic regions bound by individual proteins such as transcription factors is essential to understanding bacterial gene regulation; however, comprehensive understanding of the effect of protein occupancy on gene regulation would be prohibitively laborious and expensive to achieve using methods such as chromatin immunoprecipitation with sequencing (ChIP-seq) and ChIP with exonuclease treatment (ChIP-exo) for every protein and condition of interest.. Here we describe a protocol for performing in vivo protein occupancy display–high resolution (IPOD-HR), a powerful method for genome-wide profiling of protein-bound DNA in prokaryotic systems.. Although assay for transposase-accessible chromatin with sequencing (ATAC-seq) is the method of choice for assaying general protein occupancy in eukaryotic systems, bacterial nucleoid-associated proteins can affect ATAC-seq, rendering it unsuitable for use in bacteria. Transferring:Article Title: Profiling large-scale protein occupancy on bacterial genomes using IPOD-HR. Article Snippet: Identifying genomic regions bound by individual proteins such as transcription factors is essential to understanding bacterial gene regulation; however, comprehensive understanding of the effect of protein occupancy on gene regulation would be prohibitively laborious and expensive to achieve using methods such as chromatin immunoprecipitation with sequencing (ChIP-seq) and ChIP with exonuclease treatment (ChIP-exo) for every protein and condition of interest.. Here we describe a protocol for performing in vivo protein occupancy display–high resolution (IPOD-HR), a powerful method for genome-wide profiling of protein-bound DNA in prokaryotic systems.. Although assay for transposase-accessible chromatin with sequencing (ATAC-seq) is the method of choice for assaying general protein occupancy in eukaryotic systems, bacterial nucleoid-associated proteins can affect ATAC-seq, rendering it unsuitable for use in bacteria. Spectrophotometry:Article Title: Profiling large-scale protein occupancy on bacterial genomes using IPOD-HR. Article Snippet: Identifying genomic regions bound by individual proteins such as transcription factors is essential to understanding bacterial gene regulation; however, comprehensive understanding of the effect of protein occupancy on gene regulation would be prohibitively laborious and expensive to achieve using methods such as chromatin immunoprecipitation with sequencing (ChIP-seq) and ChIP with exonuclease treatment (ChIP-exo) for every protein and condition of interest.. Here we describe a protocol for performing in vivo protein occupancy display–high resolution (IPOD-HR), a powerful method for genome-wide profiling of protein-bound DNA in prokaryotic systems.. Although assay for transposase-accessible chromatin with sequencing (ATAC-seq) is the method of choice for assaying general protein occupancy in eukaryotic systems, bacterial nucleoid-associated proteins can affect ATAC-seq, rendering it unsuitable for use in bacteria. Polymerase Chain Reaction:Article Title: Profiling large-scale protein occupancy on bacterial genomes using IPOD-HR. Article Snippet: Identifying genomic regions bound by individual proteins such as transcription factors is essential to understanding bacterial gene regulation; however, comprehensive understanding of the effect of protein occupancy on gene regulation would be prohibitively laborious and expensive to achieve using methods such as chromatin immunoprecipitation with sequencing (ChIP-seq) and ChIP with exonuclease treatment (ChIP-exo) for every protein and condition of interest.. Here we describe a protocol for performing in vivo protein occupancy display–high resolution (IPOD-HR), a powerful method for genome-wide profiling of protein-bound DNA in prokaryotic systems.. Although assay for transposase-accessible chromatin with sequencing (ATAC-seq) is the method of choice for assaying general protein occupancy in eukaryotic systems, bacterial nucleoid-associated proteins can affect ATAC-seq, rendering it unsuitable for use in bacteria. Stripping Membranes:Article Title: Profiling large-scale protein occupancy on bacterial genomes using IPOD-HR. Article Snippet: Identifying genomic regions bound by individual proteins such as transcription factors is essential to understanding bacterial gene regulation; however, comprehensive understanding of the effect of protein occupancy on gene regulation would be prohibitively laborious and expensive to achieve using methods such as chromatin immunoprecipitation with sequencing (ChIP-seq) and ChIP with exonuclease treatment (ChIP-exo) for every protein and condition of interest.. Here we describe a protocol for performing in vivo protein occupancy display–high resolution (IPOD-HR), a powerful method for genome-wide profiling of protein-bound DNA in prokaryotic systems.. Although assay for transposase-accessible chromatin with sequencing (ATAC-seq) is the method of choice for assaying general protein occupancy in eukaryotic systems, bacterial nucleoid-associated proteins can affect ATAC-seq, rendering it unsuitable for use in bacteria. |
