virus encoding cas9 (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
virus encoding cas9
Virus Encoding Cas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1656 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/blast++sequence+alignment+software+package/lentiCas9-Blast+(Plasmid+%2352962)/pmc07197326-857-22-25
Average 96 stars, based on 1656 article reviews
Virus Encoding Cas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1656 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/blast++sequence+alignment+software+package/lentiCas9-Blast+(Plasmid+%2352962)/pmc07197326-857-22-25
Average 96 stars, based on 1656 article reviews
virus encoding cas9 - by Bioz Stars,
2026-10
96/100 stars
Images
1) Product Images from "Vitamin B6 addiction in acute myeloid leukemia"
Article Title: Vitamin B6 addiction in acute myeloid leukemia
Journal: Cancer cell
doi: 10.1016/j.ccell.2019.12.002
Figure Legend Snippet: KEY RESOURCES TABLE
Techniques Used: Plasmid Preparation, Recombinant, Mutagenesis, RNA Extraction, Gel Extraction, Clone Assay, Purification, Flow Cytometry, Sequencing, CRISPR, Functional Assay, shRNA, Software
Related Articles
Gene Knockout:Article Title: METTL1-mediated m 7 G modification of valine tRNAs drives metabolic adaptation in pancreatic ductal adenocarcinoma cells Article Snippet: The sgRNAs targeting METTL1 were designed and purchased from Applied Biological Materials. .. Lentiviruses for KO of METTL1 were generated by cotransfecting the second-generation lentiviral packaging vectors (2.25 μg psPAX2 and 0.75 μg pMD2.G), 3 μg Generated:Article Title: METTL1-mediated m 7 G modification of valine tRNAs drives metabolic adaptation in pancreatic ductal adenocarcinoma cells Article Snippet: The sgRNAs targeting METTL1 were designed and purchased from Applied Biological Materials. .. Lentiviruses for KO of METTL1 were generated by cotransfecting the second-generation lentiviral packaging vectors (2.25 μg psPAX2 and 0.75 μg pMD2.G), 3 μg Article Title: MitoPerturb-Seq identifies gene-specific single-cell responses to mitochondrial DNA depletion and heteroplasmy. Article Snippet: Primary m.5024C>T MEFs were described previously11, isolated from individual E13.5 embryos and immortalized by transfection with the SV40 large T antigen (pBSSVD2005, a gift from D. Ron; Addgene, plasmid 21826). .. Cas9-expressing Article Title: Genome-wide profiling identifies the genetic dependencies of cell death following EGFR inhibition. Article Snippet: .. 508 509 Generation of PC9-Cas9 cell line 510 PC9-Cas9 cells were generated using a virus containing Plasmid Preparation:Article Title: METTL1-mediated m 7 G modification of valine tRNAs drives metabolic adaptation in pancreatic ductal adenocarcinoma cells Article Snippet: The sgRNAs targeting METTL1 were designed and purchased from Applied Biological Materials. .. Lentiviruses for KO of METTL1 were generated by cotransfecting the second-generation lentiviral packaging vectors (2.25 μg psPAX2 and 0.75 μg pMD2.G), 3 μg Article Title: Persistent chromatin alterations and gene expression reprogramming follow widespread DNA damage in glioblastoma. Article Snippet: FgH1tUTCherry was a gift from Marco Herold (received through Addgene plasmid # 85552). .. Article Title: Computationally guided discovery of Ly6e/LY6E-dependent AAV capsid variants Article Snippet: 620 The following gRNA sequences (5’-3’) were used for CRISPR-Cas9 genome editing: Jo urn al Pr e-p roo f 33 GCCCTTCTGGGTGTGGAGCG (PAM: AGG) The gRNA was inserted into the U6-sgRNA backbone derived from AAV:ITR-U6-621 sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR (Addgene plasmid #60229). .. For lentiviral 622 backbone construction, Article Title: Integrated stress response activation in combination PG3 and cisplatin-treated TP53 -mutated head and neck squamous carcinoma cells induces potent apoptotic response Article Snippet: Lentivirus was produced by transfecting Lenti-X-293T cells (Takara #632180) with the following plasmids: transfer plasmid, pRSV-Rev (Addgene #12253), pMDLg/pRRE (Addgene #12251), and pMD2.G (Addgene #12259) using Lipofectamine 2000 (ThermoFisher 11668019) per the manufacturer’s protocol. .. The transfer plasmid used are as follows: Transfection:Article Title: METTL1-mediated m 7 G modification of valine tRNAs drives metabolic adaptation in pancreatic ductal adenocarcinoma cells Article Snippet: The sgRNAs targeting METTL1 were designed and purchased from Applied Biological Materials. .. Lentiviruses for KO of METTL1 were generated by cotransfecting the second-generation lentiviral packaging vectors (2.25 μg psPAX2 and 0.75 μg pMD2.G), 3 μg Virus:Article Title: Genome-wide profiling identifies the genetic dependencies of cell death following EGFR inhibition. Article Snippet: .. 508 509 Generation of PC9-Cas9 cell line 510 PC9-Cas9 cells were generated using a virus containing Modification:Article Title: Computationally guided discovery of Ly6e/LY6E-dependent AAV capsid variants Article Snippet: 620 The following gRNA sequences (5’-3’) were used for CRISPR-Cas9 genome editing: Jo urn al Pr e-p roo f 33 GCCCTTCTGGGTGTGGAGCG (PAM: AGG) The gRNA was inserted into the U6-sgRNA backbone derived from AAV:ITR-U6-621 sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR (Addgene plasmid #60229). .. For lentiviral 622 backbone construction, Control:Article Title: Integrated stress response activation in combination PG3 and cisplatin-treated TP53 -mutated head and neck squamous carcinoma cells induces potent apoptotic response Article Snippet: Lentivirus was produced by transfecting Lenti-X-293T cells (Takara #632180) with the following plasmids: transfer plasmid, pRSV-Rev (Addgene #12253), pMDLg/pRRE (Addgene #12251), and pMD2.G (Addgene #12259) using Lipofectamine 2000 (ThermoFisher 11668019) per the manufacturer’s protocol. .. The transfer plasmid used are as follows: |