Review



microarray service  (Phalanx Biotech)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Phalanx Biotech microarray service
    Microarray Service, supplied by Phalanx Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/biotech+microarray+service/microarray+service/pmc03270034-93-0-5
    Average 90 stars, based on 1 article reviews
    microarray service - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Microarray:

    Article Title: Contribution of Increased Expression of Yin Yang 2 to Development of Cardiomyopathy
    Article Snippet: .. Microarray service was provided by Phalanx Biotech (OneArray Express, San Diego, CA, United States). ..

    Article Title: Enhanced desumoylation in murine hearts by overexpressed SENP2 leads to congenital heart defects and cardiac dysfunction.
    Article Snippet: .. Microarray service was provided by Phalanx Biotech (OneArray Express). .. Reverse transcription reaction was performed using 1 μg total RNA per reaction and cloned reverse transcriptase, followed by either semiquantitative PCR or qPCR (MX3000, Stratagene) using the following gene-specific primers: SENP2: forward, 5′ GCTAAGGTTCTCGGCACCATT 3′; reverse, 5′ ATTACAAGCAGAAGACACCATG 3′.

    Article Title: Conditional Ablation of Ezh2 in Murine Hearts Reveals Its Essential Roles in Endocardial Cushion Formation, Cardiomyocyte Proliferation and Survival
    Article Snippet: .. Microarray service was provided by Phalanx Biotech (OneArray Express) with three samples per group, and each sample was analyzed in triplicate. .. Reverse transcription reaction was carried out using 1 μg total RNA, cloned reverse transcriptase (Invitrogen) and Oligo dT, which generated a final 50 μl volume reaction to generate the complementary DNA (cDNA).



    Similar Products

    biotech microarray service  (Miltenyi Biotec)
    90
    Miltenyi Biotec biotech microarray service
    Biotech Microarray Service, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/biotech+microarray+service/agilent+human+genome+oligo+microarrays/pm37835445-42-7-9
    Average 90 stars, based on 1 article reviews
    biotech microarray service - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results