Review



mouse tnf α duoset elisa kit  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    R&D Systems mouse tnf α duoset elisa kit
    PLY-EVs induce dendritic cell maturation and inflammatory cytokine release upon internalization (A) Confocal microscopy images showing the internalization of CFSE-labelled PLY (0.1) and naive EVs (green) by THP-1-monocyte-derived DCs at 24 h post-treatment. Scale bars, 25 μm. (B) Flow cytometry histograms ( N = 3) to quantify the DC uptake of CFSE-labeled PLY(0.5)EVs and naive EVs. (C) Dose-dependent uptake of PLY (0.1, 0.5) EVs by DCs. (D) Phase-contrast microscopy images of immature day 5 DCs coincubated with PLY (0.1, 0.5) EVs and naive EVs for 24 h. Arrows indicate matured DCs (magnified in inset). Scale bars, 50 μm. Images are representative of three independent experiments. (E–G) Flow cytometry histograms ( N = 3) to quantify the expression levels of (E) CD80, (F) CD86, and (G) CD83 on THP-1-monocyte-derived DCs treated with PLY(0.5) and naive EVs. (H and I) Flow cytometry histograms ( N = 2) showing the expression levels of DC maturation marker CD83 at 96 h post-incubation of primary human monocytes with (H) PLY(0.5) and naive EVs and (I) naive EVs pre-treated with recombinant PLY protein (naive EVs+rPLY). (J and K) Cytokine <t>ELISA</t> showing the levels of secreted TNF-α from (J) DCs treated with PLY (0.1) EVs or naive EVs alone ( N = 3) for 24 h and (K) DCs pre-treated with PLY (0.1,0.5) or naive EVs for 24 h followed by subsequent infection with S. pneumoniae , T4R strain ( N = 2). Recombinant PLY (0.5 μg/mL) was used as positive control. All data are represented as mean ± SEM. ∗ p < 0.05, ∗∗ p < 0.005, and ∗∗∗ p < 0.001 by one-way ANOVA with Tukey’s multiple comparisons test. n.s., not significant. See also <xref ref-type=Figures S6–S9 . " width="250" height="auto" />
    Mouse Tnf α Duoset Elisa Kit, supplied by R&D Systems, used in various techniques. Bioz Stars score: 97/100, based on 1213 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/Mouse+TNF-alpha+DuoSet+ELISA/pmc11357855-101-0-6
    Average 97 stars, based on 1213 article reviews
    mouse tnf α duoset elisa kit - by Bioz Stars, 2026-10
    97/100 stars

    Images

    1) Product Images from "Bacterial pore-forming toxin pneumolysin drives pathogenicity through host extracellular vesicles released during infection"

    Article Title: Bacterial pore-forming toxin pneumolysin drives pathogenicity through host extracellular vesicles released during infection

    Journal: iScience

    doi: 10.1016/j.isci.2024.110589

    PLY-EVs induce dendritic cell maturation and inflammatory cytokine release upon internalization (A) Confocal microscopy images showing the internalization of CFSE-labelled PLY (0.1) and naive EVs (green) by THP-1-monocyte-derived DCs at 24 h post-treatment. Scale bars, 25 μm. (B) Flow cytometry histograms ( N = 3) to quantify the DC uptake of CFSE-labeled PLY(0.5)EVs and naive EVs. (C) Dose-dependent uptake of PLY (0.1, 0.5) EVs by DCs. (D) Phase-contrast microscopy images of immature day 5 DCs coincubated with PLY (0.1, 0.5) EVs and naive EVs for 24 h. Arrows indicate matured DCs (magnified in inset). Scale bars, 50 μm. Images are representative of three independent experiments. (E–G) Flow cytometry histograms ( N = 3) to quantify the expression levels of (E) CD80, (F) CD86, and (G) CD83 on THP-1-monocyte-derived DCs treated with PLY(0.5) and naive EVs. (H and I) Flow cytometry histograms ( N = 2) showing the expression levels of DC maturation marker CD83 at 96 h post-incubation of primary human monocytes with (H) PLY(0.5) and naive EVs and (I) naive EVs pre-treated with recombinant PLY protein (naive EVs+rPLY). (J and K) Cytokine ELISA showing the levels of secreted TNF-α from (J) DCs treated with PLY (0.1) EVs or naive EVs alone ( N = 3) for 24 h and (K) DCs pre-treated with PLY (0.1,0.5) or naive EVs for 24 h followed by subsequent infection with S. pneumoniae , T4R strain ( N = 2). Recombinant PLY (0.5 μg/mL) was used as positive control. All data are represented as mean ± SEM. ∗ p < 0.05, ∗∗ p < 0.005, and ∗∗∗ p < 0.001 by one-way ANOVA with Tukey’s multiple comparisons test. n.s., not significant. See also <xref ref-type=Figures S6–S9 . " title="... PLY protein (naive EVs+rPLY). (J and K) Cytokine ELISA showing the levels of secreted TNF-α from (J) ..." property="contentUrl" width="100%" height="100%"/>
    Figure Legend Snippet: PLY-EVs induce dendritic cell maturation and inflammatory cytokine release upon internalization (A) Confocal microscopy images showing the internalization of CFSE-labelled PLY (0.1) and naive EVs (green) by THP-1-monocyte-derived DCs at 24 h post-treatment. Scale bars, 25 μm. (B) Flow cytometry histograms ( N = 3) to quantify the DC uptake of CFSE-labeled PLY(0.5)EVs and naive EVs. (C) Dose-dependent uptake of PLY (0.1, 0.5) EVs by DCs. (D) Phase-contrast microscopy images of immature day 5 DCs coincubated with PLY (0.1, 0.5) EVs and naive EVs for 24 h. Arrows indicate matured DCs (magnified in inset). Scale bars, 50 μm. Images are representative of three independent experiments. (E–G) Flow cytometry histograms ( N = 3) to quantify the expression levels of (E) CD80, (F) CD86, and (G) CD83 on THP-1-monocyte-derived DCs treated with PLY(0.5) and naive EVs. (H and I) Flow cytometry histograms ( N = 2) showing the expression levels of DC maturation marker CD83 at 96 h post-incubation of primary human monocytes with (H) PLY(0.5) and naive EVs and (I) naive EVs pre-treated with recombinant PLY protein (naive EVs+rPLY). (J and K) Cytokine ELISA showing the levels of secreted TNF-α from (J) DCs treated with PLY (0.1) EVs or naive EVs alone ( N = 3) for 24 h and (K) DCs pre-treated with PLY (0.1,0.5) or naive EVs for 24 h followed by subsequent infection with S. pneumoniae , T4R strain ( N = 2). Recombinant PLY (0.5 μg/mL) was used as positive control. All data are represented as mean ± SEM. ∗ p < 0.05, ∗∗ p < 0.005, and ∗∗∗ p < 0.001 by one-way ANOVA with Tukey’s multiple comparisons test. n.s., not significant. See also Figures S6–S9 .

    Techniques Used: Confocal Microscopy, Derivative Assay, Flow Cytometry, Labeling, Microscopy, Expressing, Marker, Incubation, Recombinant, Enzyme-linked Immunosorbent Assay, Infection, Positive Control

    Adoptive transfer of EVs from infected mice drives inflammation and pathology in a PLY-dependent manner (A) C57BL/6 mice were intranasally administered with 4 × 10 6 CFU of serotype 4 strain, T4 or the isogenic PLY mutant strain, T4Δply. At day 4 post-infection, EVs isolated from BALF were labeled and administered to healthy recipient mice at 35 μg/mice. The EV retention in murine respiratory tract was imaged by IVIS imaging and immune infiltration into lungs, and cytokine levels in BALF was measured. (B) Bacterial load in murine BALF ( N = 5 mice/group) upon infection with T4 and T4Δply strains was measured by CFU dilution assay. ∗∗ in (B) indicates p < 0.01 by Mann-Whitney test. (C) Quantification of relative total EV protein content from mice ( N = 3 mice/group) infected with T4 and T4Δply strains by BCA protein assay. PBS-treated mice served as control. ∗ and ∗∗ in (C) indicates p < 0.05 and p < 0.005, respectively, by unpaired t test. (D) IVIS imaging of mice intranasally administered with Nile-red-labeled EVs isolated from mice infected with T4 (EVs-T4) or T4Δply (EVs-T4Δply). EVs from PBS-treated mice (naive EVs) served as control. ROI intensity values indicate the total flux (photons/sec) recorded from the given region showing higher intensity of EVs from T4-infected mice in the respiratory tract. The color scale (photons/sec/cm 2 ) indicates the relative intensities of individual signals. (E and F) Flow cytometry analysis of inflammatory macrophages (F4/80 + ) and neutrophils (Ly6G + ) in BALF of mice ( N = 6 mice/group) administered with EVs from infected or untreated mice at 18 h. (G) TNF-α levels in the BALF of mice ( N = 5 mice/group) treated with EVs isolated from infected or untreated mice were measured post-sacrifice at 18 h by ELISA. ∗∗ and ∗∗∗ in (G) indicates p < 0.01 and p < 0.001, respectively, by unpaired t test. (H) Hematoxylin and eosin (H&E) staining of mouse lungs ( N = 6 mice/group) at 18 h post-administration of EVs from infected or PBS-treated mice. Mice treated with EVs from T4-infected mice showed tissue microlesions (MLEs) and immune cell infiltration in the alveolar interstitium indicative of PLY-induced tissue damage (magnified in the inset). BR, bronchiole; MLE, microlesions. Scale bars, 200 μm. Blind histopathological scoring was performed based on presence or absence of cellularity in alveolar interstitium and lesions. A score of “0” was given when no lesions were found, and a score of “1” was given to tissue showing increasing cellularity and lesions. Mouse BALF flow cytometry and histology data are representative of three independent experiments. All data are represented as mean ± SEM. See also <xref ref-type=Figure S12 . " title="... mice were measured post-sacrifice at 18 h by ELISA. ∗∗ and ∗∗∗ in (G) indicates p < ..." property="contentUrl" width="100%" height="100%"/>
    Figure Legend Snippet: Adoptive transfer of EVs from infected mice drives inflammation and pathology in a PLY-dependent manner (A) C57BL/6 mice were intranasally administered with 4 × 10 6 CFU of serotype 4 strain, T4 or the isogenic PLY mutant strain, T4Δply. At day 4 post-infection, EVs isolated from BALF were labeled and administered to healthy recipient mice at 35 μg/mice. The EV retention in murine respiratory tract was imaged by IVIS imaging and immune infiltration into lungs, and cytokine levels in BALF was measured. (B) Bacterial load in murine BALF ( N = 5 mice/group) upon infection with T4 and T4Δply strains was measured by CFU dilution assay. ∗∗ in (B) indicates p < 0.01 by Mann-Whitney test. (C) Quantification of relative total EV protein content from mice ( N = 3 mice/group) infected with T4 and T4Δply strains by BCA protein assay. PBS-treated mice served as control. ∗ and ∗∗ in (C) indicates p < 0.05 and p < 0.005, respectively, by unpaired t test. (D) IVIS imaging of mice intranasally administered with Nile-red-labeled EVs isolated from mice infected with T4 (EVs-T4) or T4Δply (EVs-T4Δply). EVs from PBS-treated mice (naive EVs) served as control. ROI intensity values indicate the total flux (photons/sec) recorded from the given region showing higher intensity of EVs from T4-infected mice in the respiratory tract. The color scale (photons/sec/cm 2 ) indicates the relative intensities of individual signals. (E and F) Flow cytometry analysis of inflammatory macrophages (F4/80 + ) and neutrophils (Ly6G + ) in BALF of mice ( N = 6 mice/group) administered with EVs from infected or untreated mice at 18 h. (G) TNF-α levels in the BALF of mice ( N = 5 mice/group) treated with EVs isolated from infected or untreated mice were measured post-sacrifice at 18 h by ELISA. ∗∗ and ∗∗∗ in (G) indicates p < 0.01 and p < 0.001, respectively, by unpaired t test. (H) Hematoxylin and eosin (H&E) staining of mouse lungs ( N = 6 mice/group) at 18 h post-administration of EVs from infected or PBS-treated mice. Mice treated with EVs from T4-infected mice showed tissue microlesions (MLEs) and immune cell infiltration in the alveolar interstitium indicative of PLY-induced tissue damage (magnified in the inset). BR, bronchiole; MLE, microlesions. Scale bars, 200 μm. Blind histopathological scoring was performed based on presence or absence of cellularity in alveolar interstitium and lesions. A score of “0” was given when no lesions were found, and a score of “1” was given to tissue showing increasing cellularity and lesions. Mouse BALF flow cytometry and histology data are representative of three independent experiments. All data are represented as mean ± SEM. See also Figure S12 .

    Techniques Used: Adoptive Transfer Assay, Infection, Mutagenesis, Isolation, Labeling, Imaging, Dilution Assay, MANN-WHITNEY, Bicinchoninic Acid Protein Assay, Control, Flow Cytometry, Enzyme-linked Immunosorbent Assay, Staining


    Figure Legend Snippet:

    Techniques Used: Virus, Mutagenesis, Isolation, Recombinant, Modification, Saline, Labeling, Staining, Electron Microscopy, Lysis, Western Blot, Buffer Exchange, Bicinchoninic Acid Protein Assay, Enzyme-linked Immunosorbent Assay, Clone Assay, Software, Membrane

    Related Articles

    Enzyme-linked Immunosorbent Assay:

    Article Title: Glycated and Non-Glycated Human Alpha-1 Antitrypsin in Hyperglycemic Wound Healing: In Vivo and In Vitro Models
    Article Snippet: .. Eight-hour TNFα levels were determined by DuoSet ELISA (Cat#DY410, R&D systems, Minneapolis, MN, USA). ..

    Article Title: Loss of Fgr41 in Candida albicans attenuates virulence and increases proinflammatory immune responses in a manner that is dependent on β(1,3)-glucan but not dectin-1
    Article Snippet: CellBrite Green stain was purchased from Biotium (30021). .. Mouse TNF-α ELISA kits were purchased from R&D Systems (DY410). ..

    Article Title: Terpenic compounds possess anthelmintic and immunomodulatory properties with potential for controlling equine cyathostomin infections
    Article Snippet: .. The cells were then incubated at +37 °C (5% CO 2 ) for 24 h. After incubation, the concentration of TNF-α in the medium for each condition was quantified by ELISA using mouse TNF-α paired antibodies (R and D Systems DY410). .. To obtain the PBMCs, 20 mL of blood was collected in K2 EDTA tubes (Dutscher 367525A) from four different Welsh ponies.

    Article Title: Single-cell atlas reveals age-related cellular shifts underlying fibrosis in murine synovium
    Article Snippet: .. Mouse TNFα (DY410, R&D Systems) and IL-6 (DY406, R&D Systems) concentrations in serum samples and cell culture supernatants were measured by ELISA according to the manufacturer’s instructions. ..

    Article Title: Biphasic modulation of large-fiber excitability accompanied by dynamic nerve-intrinsic immune activation following CFA-induced peripheral inflammation in mice.
    Article Snippet: .. Serum Inflammatory Marker Analysis C-reactive protein (CRP), tumor necrosis factor α (TNF-α), and C5a were measured by ELISA (CRP: dy1829; TNF-α: dy410; C5a: dy2150, DuoSet, R&D Systems, Minneapolis, MN, USA). .. Plates were coated with capture antibodies, then blocked with 1% bovine serum albumin (BSA, A7030; Sigma-Aldrich; SaintLouis, MI, USA) in phosphate-buffered saline (PBS, pH 7.2-7.4), and incubated with diluted serum samples (1:20,000 for CRP, 1:2 for TNF-α, 1:25 for C5a).

    Incubation:

    Article Title: Terpenic compounds possess anthelmintic and immunomodulatory properties with potential for controlling equine cyathostomin infections
    Article Snippet: .. The cells were then incubated at +37 °C (5% CO 2 ) for 24 h. After incubation, the concentration of TNF-α in the medium for each condition was quantified by ELISA using mouse TNF-α paired antibodies (R and D Systems DY410). .. To obtain the PBMCs, 20 mL of blood was collected in K2 EDTA tubes (Dutscher 367525A) from four different Welsh ponies.

    Concentration Assay:

    Article Title: Terpenic compounds possess anthelmintic and immunomodulatory properties with potential for controlling equine cyathostomin infections
    Article Snippet: .. The cells were then incubated at +37 °C (5% CO 2 ) for 24 h. After incubation, the concentration of TNF-α in the medium for each condition was quantified by ELISA using mouse TNF-α paired antibodies (R and D Systems DY410). .. To obtain the PBMCs, 20 mL of blood was collected in K2 EDTA tubes (Dutscher 367525A) from four different Welsh ponies.

    Sandwich ELISA:

    Article Title: Vibrio vulnificus MARTX cytotoxin triggers necroptosis-driven macrophage cell death.
    Article Snippet: .. The concentrations of TNF-α (DY410, R&D Systems, Minneapolis, MN, USA) and secretory HMGB1 (sHMGB1, IT5108, G-Biosciences, St. Louis, MO, USA) were subsequently quantified using the sandwich ELISA kits by following the manufacturer's instructions. .. To visualize the localization of MARTX and lipid rafts in cells, RAW264.7 cells (2 × 106) were seeded in 6-cm dishes and incubated for 12 h. Cells were infected with V. vulnificus ΔvvhA (FJ201) or ΔrtxA1/ ΔvvhA (HL114) at an MOI of 10 and incubated at 37 ◦C for 2 h. Cells were washed with PBS and fixed with 4% paraformaldehyde (SigmaAldrich) for 90 min.

    Cell Culture:

    Article Title: Single-cell atlas reveals age-related cellular shifts underlying fibrosis in murine synovium
    Article Snippet: .. Mouse TNFα (DY410, R&D Systems) and IL-6 (DY406, R&D Systems) concentrations in serum samples and cell culture supernatants were measured by ELISA according to the manufacturer’s instructions. ..

    Marker:

    Article Title: Biphasic modulation of large-fiber excitability accompanied by dynamic nerve-intrinsic immune activation following CFA-induced peripheral inflammation in mice.
    Article Snippet: .. Serum Inflammatory Marker Analysis C-reactive protein (CRP), tumor necrosis factor α (TNF-α), and C5a were measured by ELISA (CRP: dy1829; TNF-α: dy410; C5a: dy2150, DuoSet, R&D Systems, Minneapolis, MN, USA). .. Plates were coated with capture antibodies, then blocked with 1% bovine serum albumin (BSA, A7030; Sigma-Aldrich; SaintLouis, MI, USA) in phosphate-buffered saline (PBS, pH 7.2-7.4), and incubated with diluted serum samples (1:20,000 for CRP, 1:2 for TNF-α, 1:25 for C5a).



    Similar Products

    bca protein array kit  (Bio-Rad)
    96
    Bio-Rad bca protein array kit
    Bca Protein Array Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/Bio-Rad+Protein+Assay+Kit+II/10__1158_slash_1078___0432__ccr___25___4767-103-9-14
    Average 96 stars, based on 1 article reviews
    bca protein array kit - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    bca protein array kit  (Thermo Fisher)
    99
    Thermo Fisher bca protein array kit
    Bca Protein Array Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/BCA+Protein+Assay+Kit/pm41390720-163-24-28
    Average 99 stars, based on 1 article reviews
    bca protein array kit - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    piercetm bca protein array kit  (Thermo Fisher)
    99
    Thermo Fisher piercetm bca protein array kit
    Piercetm Bca Protein Array Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/BCA+Protein+Assay+Kit/pmc10643271-62-12-17
    Average 99 stars, based on 1 article reviews
    piercetm bca protein array kit - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    bca protein array kit  (tiangen biotech co)
    96
    tiangen biotech co bca protein array kit
    Bca Protein Array Kit, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/BCA+Protein+Assay+Kit/pm36913754-78-9-13
    Average 96 stars, based on 1 article reviews
    bca protein array kit - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    assays bca protein array kit thermo fisher scientific  (Thermo Fisher)
    99
    Thermo Fisher assays bca protein array kit thermo fisher scientific
    Key resources table
    Assays Bca Protein Array Kit Thermo Fisher Scientific, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/BCA+Protein+Assay+Kit/pmc10067764-515-135-140
    Average 99 stars, based on 1 article reviews
    assays bca protein array kit thermo fisher scientific - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Key resources table

    Journal: iScience

    Article Title: Adiponectin-mediated promotion of CD44 suppresses diabetic vascular inflammatory effects

    doi: 10.1016/j.isci.2023.106428

    Figure Lengend Snippet: Key resources table

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-reptin Cell Signaling Technology Cat#12668S; RRID: AB_2797987 Rabbit monoclonal anti-IgG Cell Signaling Technology Cat#14708S; RRID: AB_2798581 Rabbit monoclonal anti-APPL1 Cell Signaling Technology Cat#3858S; RRID: AB_2056989 Rabbit monoclonal anti-Histone 2A Cell Signaling Technology Cat#7631S; RRID: AB_10860771 Rabbit monoclonal anti-GAPDH Cell Signaling Technology Cat#5174S; RRID: AB_10622025 Rabbit monoclonal anti-β-catenin Cell Signaling Technology Cat#8480S; RRID: AB_11127855 Rabbit monoclonal anti-Non-β-catenin Cell Signaling Technology Cat#8814S; RRID: AB_11127203 NF-κB Pathway Antibody Sampler Kit Cell Signaling Technology Cat#9936T; RRID: AB_561197 Rabbit monoclonal anti-CD44 Cell Signaling Technology Cat#37259S; RRID: AB_2750879 Rabbit monoclonal anti-ICAM-1 Cell Signaling Technology Cat#67836S; RRID: AB_2799738 Biological samples Serum of Healthy control subjects and Diabetes patients Anzhen Hospital, Capital Medical University, Beijing, China https://anzhen.org/ Chemicals, peptides, and recombinant proteins Recombinant Human gAcrp30/Adipolean Peprotech.inc CAS:25-450-21 Recombinant CD44 protein ®Sangon Biotech CAS:D622619 Critical commercial assays BCA Protein Array Kit Thermo Fisher Scientific, Inc. CAS:23227 Qproteome Cell Compartment Kit CAS:37502 The Transcription Factor Activation Profiling Plate Array II Signosis, Sunnyvale, CA CAS: FA-1002 RT2 ProfilerTM PCR Array Human Transcription Factors Qiagen, USA GeneGlobe ID-PAHS-075ZA-24; CAS: 330231 ELISA Kit for Adiponectin (ADPN) Cloud-Clone Corp CAS: SEA605Hu ELISA Kit for CD44 Cloud-Clone Corp CAS: SEA670Hu EZ-Link Sulfo-NHS-LC-Biotinylation kit Thermo Fisher Scientific, Inc. CAS:21435 Deposited data Raw and analyzed data This paper GEO: GSE217607 Experimental models: Cell lines Human umbilical vein endothelial cells (HUVECs): 4201HUM-CCTCC00635 NICR http://cellresource.cn/fdetail.aspx?id=5307/ Experimental models: Organisms/strains Mouse: APPL1 −/− , 8 weeks’s old BRL Medicine Inc. N/A Mouse: APN −/− , 8 weeks’s old Gift N/A Oligonucleotides siRNA targeting sequence: APPL1 #1: UCUCACCUGACUUCGAAACU This paper N/A siRNA targeting sequence: CD44 #1: GAACAAGGAGUCGUCAGAAACUCCA This paper N/A Primers, see Table S2 This paper N/A Software and algorithms GraphPad Prism 8.0 GraphPad Software Inc., San Diego, CA https://www.graphpad.com/ SPSS Statistics 25.0 SPSS Inc., Chicago, IL https://www.ibm.com/ Open in a separate window Key resources table .

    Techniques: Recombinant, Protein Array, Activation Assay, Enzyme-linked Immunosorbent Assay, Sequencing, Software