Review



human tmem30a cdna  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    OriGene human tmem30a cdna
    <t> Human TMEM30a </t> partially reconstitutes phospholipid import in ⊗Lem3 S. cerevisiae
    Human Tmem30a Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/pmc03073457-100-0-6?v=OriGene
    Average 90 stars, based on 2 article reviews
    human tmem30a cdna - by Bioz Stars, 2026-08
    90/100 stars

    Images

    1) Product Images from "Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells 1 "

    Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells 1

    Journal:

    doi: 10.4049/jimmunol.1002710

     Human TMEM30a  partially reconstitutes phospholipid import in ⊗Lem3 S. cerevisiae
    Figure Legend Snippet: Human TMEM30a partially reconstitutes phospholipid import in ⊗Lem3 S. cerevisiae

    Techniques Used:

    (A) ΔLem3 S. cerevisiae transformed with empty vector or two isolates transformed with human TMEM30a were grown on glucose or galactose to induce TMEM30a expression. NBD-phosphatidylcholine uptake was determined by flow cytometry. (B) Concentration dependent effect of Edelfosine on colony growth of serially diluted wild-type S. cerevisiae or ΔLem3 transformed with empty vector or two ΔLem3 isolates transformed with human TMEM30a.
    Figure Legend Snippet: (A) ΔLem3 S. cerevisiae transformed with empty vector or two isolates transformed with human TMEM30a were grown on glucose or galactose to induce TMEM30a expression. NBD-phosphatidylcholine uptake was determined by flow cytometry. (B) Concentration dependent effect of Edelfosine on colony growth of serially diluted wild-type S. cerevisiae or ΔLem3 transformed with empty vector or two ΔLem3 isolates transformed with human TMEM30a.

    Techniques Used: Transformation Assay, Plasmid Preparation, Expressing, Flow Cytometry, Concentration Assay

    (A) NBD-phosphatidylcholine uptake determined by flow cytometry for wild-type S. cerevisiae transformed with empty vector or ΔLem3 transformed with Lem3, TMEM30a or a chimera (Table 1) of Lem3 and TMEM30a. (B) Quantitation (n=3) of NBD-phosphatidylcholine uptake by ΔLem3 transformed with Lem3-TMEM30a (LT; see Table 1 for sequence), TMEM30a-Lem3 (TL), or TMEM30a-Lem3-TMEM30a (TLT) chimeras. Western blot (top) for V5 antigen contained in sequences encoding TMEM30a and its chimeras isolated from protein extracts of S. cerevisiae grown in galactose to induce insert expression or non-inducing glucose. (C) Concentration dependent effect of Edelfosine on colony formation on glucose or galactose plates for wild-type S. cerevisiae or ΔLem3 transformed with galactose induced human, yeast or chimeric constructs. (D) Effect of Edelfosine on ΔLem3 viability after introduction of human TMEM30a, yeast Lem3p, or chimeras formed from them. Cell number (OD600) in liquid culture of wildtype or ΔLem3 transformed with the stated vectors at defined concentrations (left) or 12.5 μg/ml (right).
    Figure Legend Snippet: (A) NBD-phosphatidylcholine uptake determined by flow cytometry for wild-type S. cerevisiae transformed with empty vector or ΔLem3 transformed with Lem3, TMEM30a or a chimera (Table 1) of Lem3 and TMEM30a. (B) Quantitation (n=3) of NBD-phosphatidylcholine uptake by ΔLem3 transformed with Lem3-TMEM30a (LT; see Table 1 for sequence), TMEM30a-Lem3 (TL), or TMEM30a-Lem3-TMEM30a (TLT) chimeras. Western blot (top) for V5 antigen contained in sequences encoding TMEM30a and its chimeras isolated from protein extracts of S. cerevisiae grown in galactose to induce insert expression or non-inducing glucose. (C) Concentration dependent effect of Edelfosine on colony formation on glucose or galactose plates for wild-type S. cerevisiae or ΔLem3 transformed with galactose induced human, yeast or chimeric constructs. (D) Effect of Edelfosine on ΔLem3 viability after introduction of human TMEM30a, yeast Lem3p, or chimeras formed from them. Cell number (OD600) in liquid culture of wildtype or ΔLem3 transformed with the stated vectors at defined concentrations (left) or 12.5 μg/ml (right).

    Techniques Used: Flow Cytometry, Transformation Assay, Plasmid Preparation, Quantitation Assay, Sequencing, Western Blot, Isolation, Expressing, Concentration Assay, Construct

    (A) CHO cells stably transfected with TMEM30a-GFP and then stained with CellMask™ Orange Plasma Membrane to mark the plasma membrane (top) then imaged by confocal microscopy. Co-expression of the appropriate orange fluorescent protein Organelle Light defined endoplasmic reticulum (row 2), or Golgi (row 3). TMEM30a-GFP expressing CHO cells were labeled with MitoTracker Red to identify polarized mitochondria (bottom). (B) Western blot for GFP or plasma membrane Na/K ATPase in density gradient fractions from HepG2 cells stably expressing TMEM30a-GFP. (C) Fluorescent intensity of TMEM30a-Jurkat cells during flow cytometry after 10 min incubation in the presence of NBD-phosphatidylcholine (1 μM) alone or additionally with 5 μM Az-LPAF or Edelfosine.
    Figure Legend Snippet: (A) CHO cells stably transfected with TMEM30a-GFP and then stained with CellMask™ Orange Plasma Membrane to mark the plasma membrane (top) then imaged by confocal microscopy. Co-expression of the appropriate orange fluorescent protein Organelle Light defined endoplasmic reticulum (row 2), or Golgi (row 3). TMEM30a-GFP expressing CHO cells were labeled with MitoTracker Red to identify polarized mitochondria (bottom). (B) Western blot for GFP or plasma membrane Na/K ATPase in density gradient fractions from HepG2 cells stably expressing TMEM30a-GFP. (C) Fluorescent intensity of TMEM30a-Jurkat cells during flow cytometry after 10 min incubation in the presence of NBD-phosphatidylcholine (1 μM) alone or additionally with 5 μM Az-LPAF or Edelfosine.

    Techniques Used: Stable Transfection, Transfection, Staining, Confocal Microscopy, Expressing, Labeling, Western Blot, Flow Cytometry, Incubation

    (A) NBD-phosphatidylcholine uptake by CHO cells transfected with empty vector or a TMEM30a vector assessed by confocal microscopy (40X). Inset, 60X. (B) Uptake of [3H]PAF by CHO cells expressing TMEM30a containing a GFP or Lumio tag (n=3). (C) Phosphatidylserine surface expression is not reduced in TMEM30a transfected CHO cells. Surface phosphatidylserine was detected (n=3) by flow cytometry with annexin V conjugated with Alexa647 as described in “Methods.”
    Figure Legend Snippet: (A) NBD-phosphatidylcholine uptake by CHO cells transfected with empty vector or a TMEM30a vector assessed by confocal microscopy (40X). Inset, 60X. (B) Uptake of [3H]PAF by CHO cells expressing TMEM30a containing a GFP or Lumio tag (n=3). (C) Phosphatidylserine surface expression is not reduced in TMEM30a transfected CHO cells. Surface phosphatidylserine was detected (n=3) by flow cytometry with annexin V conjugated with Alexa647 as described in “Methods.”

    Techniques Used: Transfection, Plasmid Preparation, Confocal Microscopy, Expressing, Flow Cytometry

    (A) Quantitative PCR for TMEM30a mRNA after transfection by empty vector or one containing TMEM30a shRNA (n=3). (B) Jurkat viability to Edelfosine exposure after transfection with an empty vector or TMEM30a shRNA (n=3). (C) Jurkat cell uptake of fluorescent NBD-phosphatidylcholine (upper) or NBD-phosphatidylethanolamine (lower) by cells expressing TMEM30a shRNA or its vector (n=3). (D) Quantitation of NBD-phosphatidylcholine accumulation by Jurkat cells expressing TMEM30a shRNA or empty vector (n=3). (E) Uptake of [3H]PAF by Jurkat cells is reduced by TMEM30a shRNA knockdown (n=4). All quantitative measures used triplicate determinations in each experiment.
    Figure Legend Snippet: (A) Quantitative PCR for TMEM30a mRNA after transfection by empty vector or one containing TMEM30a shRNA (n=3). (B) Jurkat viability to Edelfosine exposure after transfection with an empty vector or TMEM30a shRNA (n=3). (C) Jurkat cell uptake of fluorescent NBD-phosphatidylcholine (upper) or NBD-phosphatidylethanolamine (lower) by cells expressing TMEM30a shRNA or its vector (n=3). (D) Quantitation of NBD-phosphatidylcholine accumulation by Jurkat cells expressing TMEM30a shRNA or empty vector (n=3). (E) Uptake of [3H]PAF by Jurkat cells is reduced by TMEM30a shRNA knockdown (n=4). All quantitative measures used triplicate determinations in each experiment.

    Techniques Used: Real-time Polymerase Chain Reaction, Transfection, Plasmid Preparation, shRNA, Expressing, Quantitation Assay

    (A) Flow cytometric analysis of JC-1 green fluorescence (FL1, x axis) and orange/red fluorescence (FL2, y axis) in the presence of the stated azelaoyl lysoPAF concentration in vector and TMEM30a shRNA transfected Jurkat cells. The cationic dye JC1 in functional, polarized mitochondria is aggregated and fluoresces red/orange, while monomeric dye free in the cytoplasm fluoresces green. (B) Flow cytometric analysis of JC-1 fluorescence in the stated concentration of Edelfosine.
    Figure Legend Snippet: (A) Flow cytometric analysis of JC-1 green fluorescence (FL1, x axis) and orange/red fluorescence (FL2, y axis) in the presence of the stated azelaoyl lysoPAF concentration in vector and TMEM30a shRNA transfected Jurkat cells. The cationic dye JC1 in functional, polarized mitochondria is aggregated and fluoresces red/orange, while monomeric dye free in the cytoplasm fluoresces green. (B) Flow cytometric analysis of JC-1 fluorescence in the stated concentration of Edelfosine.

    Techniques Used: Fluorescence, Concentration Assay, Plasmid Preparation, shRNA, Transfection, Functional Assay



    Similar Products

    96
    Bio-Rad bca protein array kit
    Bca Protein Array Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/10__1158_slash_1078___0432__ccr___25___4767-103-9-14?v=Bio-Rad
    Average 96 stars, based on 1 article reviews
    bca protein array kit - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    99
    Thermo Fisher bca protein array kit
    Bca Protein Array Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/pm41390720-163-24-28?v=Thermo+Fisher
    Average 99 stars, based on 1 article reviews
    bca protein array kit - by Bioz Stars, 2026-08
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher piercetm bca protein array kit
    Piercetm Bca Protein Array Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/pmc10643271-62-12-17?v=Thermo+Fisher
    Average 99 stars, based on 1 article reviews
    piercetm bca protein array kit - by Bioz Stars, 2026-08
    99/100 stars
      Buy from Supplier

    96
    tiangen biotech co bca protein array kit
    Bca Protein Array Kit, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/pm36913754-78-9-13?v=tiangen+biotech+co
    Average 96 stars, based on 1 article reviews
    bca protein array kit - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    99
    Thermo Fisher assays bca protein array kit thermo fisher scientific
    Key resources table
    Assays Bca Protein Array Kit Thermo Fisher Scientific, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/pmc10067764-515-135-140?v=Thermo+Fisher
    Average 99 stars, based on 1 article reviews
    assays bca protein array kit thermo fisher scientific - by Bioz Stars, 2026-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    Key resources table

    Journal: iScience

    Article Title: Adiponectin-mediated promotion of CD44 suppresses diabetic vascular inflammatory effects

    doi: 10.1016/j.isci.2023.106428

    Figure Lengend Snippet: Key resources table

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-reptin Cell Signaling Technology Cat#12668S; RRID: AB_2797987 Rabbit monoclonal anti-IgG Cell Signaling Technology Cat#14708S; RRID: AB_2798581 Rabbit monoclonal anti-APPL1 Cell Signaling Technology Cat#3858S; RRID: AB_2056989 Rabbit monoclonal anti-Histone 2A Cell Signaling Technology Cat#7631S; RRID: AB_10860771 Rabbit monoclonal anti-GAPDH Cell Signaling Technology Cat#5174S; RRID: AB_10622025 Rabbit monoclonal anti-β-catenin Cell Signaling Technology Cat#8480S; RRID: AB_11127855 Rabbit monoclonal anti-Non-β-catenin Cell Signaling Technology Cat#8814S; RRID: AB_11127203 NF-κB Pathway Antibody Sampler Kit Cell Signaling Technology Cat#9936T; RRID: AB_561197 Rabbit monoclonal anti-CD44 Cell Signaling Technology Cat#37259S; RRID: AB_2750879 Rabbit monoclonal anti-ICAM-1 Cell Signaling Technology Cat#67836S; RRID: AB_2799738 Biological samples Serum of Healthy control subjects and Diabetes patients Anzhen Hospital, Capital Medical University, Beijing, China https://anzhen.org/ Chemicals, peptides, and recombinant proteins Recombinant Human gAcrp30/Adipolean Peprotech.inc CAS:25-450-21 Recombinant CD44 protein ®Sangon Biotech CAS:D622619 Critical commercial assays BCA Protein Array Kit Thermo Fisher Scientific, Inc. CAS:23227 Qproteome Cell Compartment Kit CAS:37502 The Transcription Factor Activation Profiling Plate Array II Signosis, Sunnyvale, CA CAS: FA-1002 RT2 ProfilerTM PCR Array Human Transcription Factors Qiagen, USA GeneGlobe ID-PAHS-075ZA-24; CAS: 330231 ELISA Kit for Adiponectin (ADPN) Cloud-Clone Corp CAS: SEA605Hu ELISA Kit for CD44 Cloud-Clone Corp CAS: SEA670Hu EZ-Link Sulfo-NHS-LC-Biotinylation kit Thermo Fisher Scientific, Inc. CAS:21435 Deposited data Raw and analyzed data This paper GEO: GSE217607 Experimental models: Cell lines Human umbilical vein endothelial cells (HUVECs): 4201HUM-CCTCC00635 NICR http://cellresource.cn/fdetail.aspx?id=5307/ Experimental models: Organisms/strains Mouse: APPL1 −/− , 8 weeks’s old BRL Medicine Inc. N/A Mouse: APN −/− , 8 weeks’s old Gift N/A Oligonucleotides siRNA targeting sequence: APPL1 #1: UCUCACCUGACUUCGAAACU This paper N/A siRNA targeting sequence: CD44 #1: GAACAAGGAGUCGUCAGAAACUCCA This paper N/A Primers, see Table S2 This paper N/A Software and algorithms GraphPad Prism 8.0 GraphPad Software Inc., San Diego, CA https://www.graphpad.com/ SPSS Statistics 25.0 SPSS Inc., Chicago, IL https://www.ibm.com/ Open in a separate window Key resources table .

    Techniques: Recombinant, Protein Array, Activation Assay, Enzyme-linked Immunosorbent Assay, Sequencing, Software