Review



filaggrin (flg) elisa kit  (ABclonal Biotechnology)


Bioz Verified Symbol ABclonal Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    ABclonal Biotechnology filaggrin (flg) elisa kit
    Filaggrin (Flg) Elisa Kit, supplied by ABclonal Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/filaggrin++flg++elisa+kit/pm40649389-36-70-74
    Average 90 stars, based on 1 article reviews
    filaggrin (flg) elisa kit - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    CCK-8 Assay:

    Article Title: Bioactive Polysaccharides from Fermented Dendrobium officinale : Structural Insights and Their Role in Skin Barrier Repair.
    Article Snippet: All other reagents used in this study were of analytical grade and purchased from commercial vendors, including the following: cell counting kit-8 (CCK8) assay kit (Beyotime, Shanghai, China, C0038), nitric oxide (NO) assay kit (Beyotime, S0021S), reactive oxygen species (ROS) assay kit (Beyotime, S00033S), monocyte chemoattractant protein-1 (MCP-1) ELISA kit (ABclonal, Woburn, MA, USA, RK00381), tumor necrosis factor-alpha (TNF-α) ELISA kit (ABclonal, RK00027), interleukin-1 beta (IL-1β) ELISA kit (ABclonal, RK00006), filaggrin (FLG) ELISA kit (ABclonal, RK09147), aquaporin 3 (AQP3) ELISA kit (ABclonal, RK00932), transient receptor potential vanilloid 4 (TRPV4) ELISA kit (abbexa, Cambridge, UK, abx383968), cathelicidin antimicrobial peptide (CAMP) ELISA kit (ABclonal, RK09135), adiponectin (ADIPOQ) ELISA kit (ABclonal, RK00060), Dulbecco’s modified eagle medium (DMEM) (Servicebio, Wuhan, China, G4511), fetal bovine serum (FBS) (ExCell Bio, Shanghai, China, FSP500), inhibitor of κB-α (IκB-α) rabbit mAb (Cell Signaling, Danvers, MA, USA, #4812), nuclear factor kappa-B (NF-κB) p65 rabbit mAb (Cell Signaling, #8242), cyclooxygenase-2 (COX-2) rabbit mAb (Cell Signaling, #122812), toll-like receptor 4 rabbit mAb (Cell Signaling, #38519), NOD-like receptor thermal protein domain associated protein 3 (NLRP3) rabbit mAb (Cell Signaling, #15101), and interleukin 18 (IL-18) rabbit mAb (Cell Signaling, #57058).

    ROS Assay:

    Article Title: Bioactive Polysaccharides from Fermented Dendrobium officinale : Structural Insights and Their Role in Skin Barrier Repair.
    Article Snippet: All other reagents used in this study were of analytical grade and purchased from commercial vendors, including the following: cell counting kit-8 (CCK8) assay kit (Beyotime, Shanghai, China, C0038), nitric oxide (NO) assay kit (Beyotime, S0021S), reactive oxygen species (ROS) assay kit (Beyotime, S00033S), monocyte chemoattractant protein-1 (MCP-1) ELISA kit (ABclonal, Woburn, MA, USA, RK00381), tumor necrosis factor-alpha (TNF-α) ELISA kit (ABclonal, RK00027), interleukin-1 beta (IL-1β) ELISA kit (ABclonal, RK00006), filaggrin (FLG) ELISA kit (ABclonal, RK09147), aquaporin 3 (AQP3) ELISA kit (ABclonal, RK00932), transient receptor potential vanilloid 4 (TRPV4) ELISA kit (abbexa, Cambridge, UK, abx383968), cathelicidin antimicrobial peptide (CAMP) ELISA kit (ABclonal, RK09135), adiponectin (ADIPOQ) ELISA kit (ABclonal, RK00060), Dulbecco’s modified eagle medium (DMEM) (Servicebio, Wuhan, China, G4511), fetal bovine serum (FBS) (ExCell Bio, Shanghai, China, FSP500), inhibitor of κB-α (IκB-α) rabbit mAb (Cell Signaling, Danvers, MA, USA, #4812), nuclear factor kappa-B (NF-κB) p65 rabbit mAb (Cell Signaling, #8242), cyclooxygenase-2 (COX-2) rabbit mAb (Cell Signaling, #122812), toll-like receptor 4 rabbit mAb (Cell Signaling, #38519), NOD-like receptor thermal protein domain associated protein 3 (NLRP3) rabbit mAb (Cell Signaling, #15101), and interleukin 18 (IL-18) rabbit mAb (Cell Signaling, #57058).

    Enzyme-linked Immunosorbent Assay:

    Article Title: Bioactive Polysaccharides from Fermented Dendrobium officinale : Structural Insights and Their Role in Skin Barrier Repair.
    Article Snippet: All other reagents used in this study were of analytical grade and purchased from commercial vendors, including the following: cell counting kit-8 (CCK8) assay kit (Beyotime, Shanghai, China, C0038), nitric oxide (NO) assay kit (Beyotime, S0021S), reactive oxygen species (ROS) assay kit (Beyotime, S00033S), monocyte chemoattractant protein-1 (MCP-1) ELISA kit (ABclonal, Woburn, MA, USA, RK00381), tumor necrosis factor-alpha (TNF-α) ELISA kit (ABclonal, RK00027), interleukin-1 beta (IL-1β) ELISA kit (ABclonal, RK00006), filaggrin (FLG) ELISA kit (ABclonal, RK09147), aquaporin 3 (AQP3) ELISA kit (ABclonal, RK00932), transient receptor potential vanilloid 4 (TRPV4) ELISA kit (abbexa, Cambridge, UK, abx383968), cathelicidin antimicrobial peptide (CAMP) ELISA kit (ABclonal, RK09135), adiponectin (ADIPOQ) ELISA kit (ABclonal, RK00060), Dulbecco’s modified eagle medium (DMEM) (Servicebio, Wuhan, China, G4511), fetal bovine serum (FBS) (ExCell Bio, Shanghai, China, FSP500), inhibitor of κB-α (IκB-α) rabbit mAb (Cell Signaling, Danvers, MA, USA, #4812), nuclear factor kappa-B (NF-κB) p65 rabbit mAb (Cell Signaling, #8242), cyclooxygenase-2 (COX-2) rabbit mAb (Cell Signaling, #122812), toll-like receptor 4 rabbit mAb (Cell Signaling, #38519), NOD-like receptor thermal protein domain associated protein 3 (NLRP3) rabbit mAb (Cell Signaling, #15101), and interleukin 18 (IL-18) rabbit mAb (Cell Signaling, #57058).

    Modification:

    Article Title: Bioactive Polysaccharides from Fermented Dendrobium officinale : Structural Insights and Their Role in Skin Barrier Repair.
    Article Snippet: All other reagents used in this study were of analytical grade and purchased from commercial vendors, including the following: cell counting kit-8 (CCK8) assay kit (Beyotime, Shanghai, China, C0038), nitric oxide (NO) assay kit (Beyotime, S0021S), reactive oxygen species (ROS) assay kit (Beyotime, S00033S), monocyte chemoattractant protein-1 (MCP-1) ELISA kit (ABclonal, Woburn, MA, USA, RK00381), tumor necrosis factor-alpha (TNF-α) ELISA kit (ABclonal, RK00027), interleukin-1 beta (IL-1β) ELISA kit (ABclonal, RK00006), filaggrin (FLG) ELISA kit (ABclonal, RK09147), aquaporin 3 (AQP3) ELISA kit (ABclonal, RK00932), transient receptor potential vanilloid 4 (TRPV4) ELISA kit (abbexa, Cambridge, UK, abx383968), cathelicidin antimicrobial peptide (CAMP) ELISA kit (ABclonal, RK09135), adiponectin (ADIPOQ) ELISA kit (ABclonal, RK00060), Dulbecco’s modified eagle medium (DMEM) (Servicebio, Wuhan, China, G4511), fetal bovine serum (FBS) (ExCell Bio, Shanghai, China, FSP500), inhibitor of κB-α (IκB-α) rabbit mAb (Cell Signaling, Danvers, MA, USA, #4812), nuclear factor kappa-B (NF-κB) p65 rabbit mAb (Cell Signaling, #8242), cyclooxygenase-2 (COX-2) rabbit mAb (Cell Signaling, #122812), toll-like receptor 4 rabbit mAb (Cell Signaling, #38519), NOD-like receptor thermal protein domain associated protein 3 (NLRP3) rabbit mAb (Cell Signaling, #15101), and interleukin 18 (IL-18) rabbit mAb (Cell Signaling, #57058).



    Similar Products

    bca protein array kit  (Bio-Rad)
    96
    Bio-Rad bca protein array kit
    Bca Protein Array Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/Bio-Rad+Protein+Assay+Kit+II/10__1158_slash_1078___0432__ccr___25___4767-103-9-14
    Average 96 stars, based on 1 article reviews
    bca protein array kit - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    bca protein array kit  (Thermo Fisher)
    99
    Thermo Fisher bca protein array kit
    Bca Protein Array Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/BCA+Protein+Assay+Kit/pm41390720-163-24-28
    Average 99 stars, based on 1 article reviews
    bca protein array kit - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    piercetm bca protein array kit  (Thermo Fisher)
    99
    Thermo Fisher piercetm bca protein array kit
    Piercetm Bca Protein Array Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/BCA+Protein+Assay+Kit/pmc10643271-62-12-17
    Average 99 stars, based on 1 article reviews
    piercetm bca protein array kit - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    bca protein array kit  (tiangen biotech co)
    96
    tiangen biotech co bca protein array kit
    Bca Protein Array Kit, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/BCA+Protein+Assay+Kit/pm36913754-78-9-13
    Average 96 stars, based on 1 article reviews
    bca protein array kit - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    assays bca protein array kit thermo fisher scientific  (Thermo Fisher)
    99
    Thermo Fisher assays bca protein array kit thermo fisher scientific
    Key resources table
    Assays Bca Protein Array Kit Thermo Fisher Scientific, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/BCA+Protein+Assay+Kit/pmc10067764-515-135-140
    Average 99 stars, based on 1 article reviews
    assays bca protein array kit thermo fisher scientific - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Key resources table

    Journal: iScience

    Article Title: Adiponectin-mediated promotion of CD44 suppresses diabetic vascular inflammatory effects

    doi: 10.1016/j.isci.2023.106428

    Figure Lengend Snippet: Key resources table

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-reptin Cell Signaling Technology Cat#12668S; RRID: AB_2797987 Rabbit monoclonal anti-IgG Cell Signaling Technology Cat#14708S; RRID: AB_2798581 Rabbit monoclonal anti-APPL1 Cell Signaling Technology Cat#3858S; RRID: AB_2056989 Rabbit monoclonal anti-Histone 2A Cell Signaling Technology Cat#7631S; RRID: AB_10860771 Rabbit monoclonal anti-GAPDH Cell Signaling Technology Cat#5174S; RRID: AB_10622025 Rabbit monoclonal anti-β-catenin Cell Signaling Technology Cat#8480S; RRID: AB_11127855 Rabbit monoclonal anti-Non-β-catenin Cell Signaling Technology Cat#8814S; RRID: AB_11127203 NF-κB Pathway Antibody Sampler Kit Cell Signaling Technology Cat#9936T; RRID: AB_561197 Rabbit monoclonal anti-CD44 Cell Signaling Technology Cat#37259S; RRID: AB_2750879 Rabbit monoclonal anti-ICAM-1 Cell Signaling Technology Cat#67836S; RRID: AB_2799738 Biological samples Serum of Healthy control subjects and Diabetes patients Anzhen Hospital, Capital Medical University, Beijing, China https://anzhen.org/ Chemicals, peptides, and recombinant proteins Recombinant Human gAcrp30/Adipolean Peprotech.inc CAS:25-450-21 Recombinant CD44 protein ®Sangon Biotech CAS:D622619 Critical commercial assays BCA Protein Array Kit Thermo Fisher Scientific, Inc. CAS:23227 Qproteome Cell Compartment Kit CAS:37502 The Transcription Factor Activation Profiling Plate Array II Signosis, Sunnyvale, CA CAS: FA-1002 RT2 ProfilerTM PCR Array Human Transcription Factors Qiagen, USA GeneGlobe ID-PAHS-075ZA-24; CAS: 330231 ELISA Kit for Adiponectin (ADPN) Cloud-Clone Corp CAS: SEA605Hu ELISA Kit for CD44 Cloud-Clone Corp CAS: SEA670Hu EZ-Link Sulfo-NHS-LC-Biotinylation kit Thermo Fisher Scientific, Inc. CAS:21435 Deposited data Raw and analyzed data This paper GEO: GSE217607 Experimental models: Cell lines Human umbilical vein endothelial cells (HUVECs): 4201HUM-CCTCC00635 NICR http://cellresource.cn/fdetail.aspx?id=5307/ Experimental models: Organisms/strains Mouse: APPL1 −/− , 8 weeks’s old BRL Medicine Inc. N/A Mouse: APN −/− , 8 weeks’s old Gift N/A Oligonucleotides siRNA targeting sequence: APPL1 #1: UCUCACCUGACUUCGAAACU This paper N/A siRNA targeting sequence: CD44 #1: GAACAAGGAGUCGUCAGAAACUCCA This paper N/A Primers, see Table S2 This paper N/A Software and algorithms GraphPad Prism 8.0 GraphPad Software Inc., San Diego, CA https://www.graphpad.com/ SPSS Statistics 25.0 SPSS Inc., Chicago, IL https://www.ibm.com/ Open in a separate window Key resources table .

    Techniques: Recombinant, Protein Array, Activation Assay, Enzyme-linked Immunosorbent Assay, Sequencing, Software