Review



bca protein array kit  (tiangen biotech co)


Bioz Verified Symbol tiangen biotech co is a verified supplier
Bioz Manufacturer Symbol tiangen biotech co manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    tiangen biotech co bca protein array kit
    Bca Protein Array Kit, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 96/100, based on 1081 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/BCA+Protein+Assay+Kit/pm36913754-78-9-13
    Average 96 stars, based on 1081 article reviews
    bca protein array kit - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Protein Concentration:

    Article Title: Extracellular Vesicles Derived from Human CD24+ Dental Papilla Stem Cells Promote Vascularized Dental Pulp Regeneration
    Article Snippet: .. The protein concentration of EVs was quantified using a BCA protein assay kit (TIANGEN Biotech, Beijing, China). ..

    Article Title: Structural and functional characterization of ZenX, a thermostable hydrolase involved in zearalenone detoxification.
    Article Snippet: Zearalenone (ZEN) is an estrogenic mycotoxin, posing a serious risk to food and feed safety.. In this study, a ZENdegrading bacterium was isolated from soil and, based on phylogenetic and genomic analyses, was identified as a potential novel Microbacterium sp. and designated RD1.. LC-TOF-MS/MS analysis identified a non-estrogenic hydrolysis product, indicating that RD1 degrades ZEN through lactone ring cleavage.

    Article Title: snRNA sequencing-based skeletal muscle analysis of Jiangquan black pigs with different average daily growth rates.
    Article Snippet: Approximately 0.4 g of the tissue sample was lysed using RIPA lysis buffer containing PMSF (Beyotime, catalog number P0013B).The lysate was collected in a 1.5 mL centrifuge tube, mixed thoroughly, and centrifuged at 12,000 rpm and 4°C for 5 min to collect the supernatant. .. The protein concentration of the supernatant was assayed with a BCA protein assay kit (TIANGEN, Cat No. PA115). .. The protein samples were diluted to the same concentration (3 μg /μL) using RIPA buffer, and a proportional volume of 5Х SDS-PAGE buffer (Beyotime, Cat No. P0015).

    Article Title: MdRLKT1-MdRAX2-MdMKS1 Module Positively Regulating Resistance to Cytospora mali in Apple.
    Article Snippet: For Western blotting analysis, total proteins were extracted using the Native Lysis Buffer (Solarbio, Beijing, China) from agro- infiltrated N. benthamiana leaves. .. Protein concentration was determined using the BCA Protein Assay Kit (Tiangen) following the manufacturer's instructions. .. The same amount of total proteins per line was subjected to 10% sodium dodecyl sulphate- polyacrylamide gel electrophoresis (SDS- PAGE), and the proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Roche).

    Article Title: Zebrafish study provides evidence for Porphyromonas gingivalis outer membrane vesicles eliciting Alzheimer’s disease-like pathologies
    Article Snippet: After isolation, OMV particles were washed, suspended in PBS, and subjected to analysis and characterization using a transmission electron microscope (TEM, Hitachi, HT-7700) and a nanoparticle size analyzer (NSA, Nano FCM, N30E). .. The protein concentration of OMVs was determined using the BCA protein concentration kit (TIANGEN, PA115). ..

    Bicinchoninic Acid Protein Assay:

    Article Title: Extracellular Vesicles Derived from Human CD24+ Dental Papilla Stem Cells Promote Vascularized Dental Pulp Regeneration
    Article Snippet: .. The protein concentration of EVs was quantified using a BCA protein assay kit (TIANGEN Biotech, Beijing, China). ..

    Article Title: Structural and functional characterization of ZenX, a thermostable hydrolase involved in zearalenone detoxification.
    Article Snippet: Zearalenone (ZEN) is an estrogenic mycotoxin, posing a serious risk to food and feed safety.. In this study, a ZENdegrading bacterium was isolated from soil and, based on phylogenetic and genomic analyses, was identified as a potential novel Microbacterium sp. and designated RD1.. LC-TOF-MS/MS analysis identified a non-estrogenic hydrolysis product, indicating that RD1 degrades ZEN through lactone ring cleavage.

    Article Title: Elongation Factor Thermo Unstable Secreted Protein from Ligilactobacillus murinus 0516 Against Avian Infectious Bronchitis Virus.
    Article Snippet: quality of laying hens [2].. Currently, there are no effective pharmacological treatments available for managing IB [3], and vaccination remains the primary strategy for controlling this disease.. Currently, IB is considered one of the most significant threats to the global poultry industry, second only to the highly pathogenic avian influenza.

    Article Title: snRNA sequencing-based skeletal muscle analysis of Jiangquan black pigs with different average daily growth rates.
    Article Snippet: Approximately 0.4 g of the tissue sample was lysed using RIPA lysis buffer containing PMSF (Beyotime, catalog number P0013B).The lysate was collected in a 1.5 mL centrifuge tube, mixed thoroughly, and centrifuged at 12,000 rpm and 4°C for 5 min to collect the supernatant. .. The protein concentration of the supernatant was assayed with a BCA protein assay kit (TIANGEN, Cat No. PA115). .. The protein samples were diluted to the same concentration (3 μg /μL) using RIPA buffer, and a proportional volume of 5Х SDS-PAGE buffer (Beyotime, Cat No. P0015).

    Article Title: MdRLKT1-MdRAX2-MdMKS1 Module Positively Regulating Resistance to Cytospora mali in Apple.
    Article Snippet: For Western blotting analysis, total proteins were extracted using the Native Lysis Buffer (Solarbio, Beijing, China) from agro- infiltrated N. benthamiana leaves. .. Protein concentration was determined using the BCA Protein Assay Kit (Tiangen) following the manufacturer's instructions. .. The same amount of total proteins per line was subjected to 10% sodium dodecyl sulphate- polyacrylamide gel electrophoresis (SDS- PAGE), and the proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Roche).

    Article Title: Meis1 Negatively Regulates Epithelial-Mesenchymal Transition via Wnt/β-catenin Pathway in Oral Submucous Fibrosis
    Article Snippet: Total protein lysate was prepared using lysis buffer (Epizyme, PC101) supplemented with a protease inhibitor cocktail (MCE, HY-K0010). .. After centrifugation, the supernatant was collected and quantified using a BCA protein assay kit (TIANGEN, PA115). .. Proteins were separated by 10% SDS-PAGE and transferred onto a PVDF membrane (Millipore).

    Molecular Weight:

    Article Title: Structural and functional characterization of ZenX, a thermostable hydrolase involved in zearalenone detoxification.
    Article Snippet: Zearalenone (ZEN) is an estrogenic mycotoxin, posing a serious risk to food and feed safety.. In this study, a ZENdegrading bacterium was isolated from soil and, based on phylogenetic and genomic analyses, was identified as a potential novel Microbacterium sp. and designated RD1.. LC-TOF-MS/MS analysis identified a non-estrogenic hydrolysis product, indicating that RD1 degrades ZEN through lactone ring cleavage.

    Concentration Assay:

    Article Title: Elongation Factor Thermo Unstable Secreted Protein from Ligilactobacillus murinus 0516 Against Avian Infectious Bronchitis Virus.
    Article Snippet: quality of laying hens [2].. Currently, there are no effective pharmacological treatments available for managing IB [3], and vaccination remains the primary strategy for controlling this disease.. Currently, IB is considered one of the most significant threats to the global poultry industry, second only to the highly pathogenic avian influenza.

    Recombinant:

    Article Title: Elongation Factor Thermo Unstable Secreted Protein from Ligilactobacillus murinus 0516 Against Avian Infectious Bronchitis Virus.
    Article Snippet: quality of laying hens [2].. Currently, there are no effective pharmacological treatments available for managing IB [3], and vaccination remains the primary strategy for controlling this disease.. Currently, IB is considered one of the most significant threats to the global poultry industry, second only to the highly pathogenic avian influenza.

    other:

    Article Title: Cerebral organoid exosomes reversed behavioral deficits by repressing NLRP3-mediated neuroinflammation in stress models
    Article Snippet: Cells, OExo or tissues were lysed with RIPA buffer (Beyotime, Shanghai, China; P0013D) to extract proteins, and proteins were quantified by BCA protein assay (Tiangen, Beijing, China; pa115-02).

    Centrifugation:

    Article Title: Meis1 Negatively Regulates Epithelial-Mesenchymal Transition via Wnt/β-catenin Pathway in Oral Submucous Fibrosis
    Article Snippet: Total protein lysate was prepared using lysis buffer (Epizyme, PC101) supplemented with a protease inhibitor cocktail (MCE, HY-K0010). .. After centrifugation, the supernatant was collected and quantified using a BCA protein assay kit (TIANGEN, PA115). .. Proteins were separated by 10% SDS-PAGE and transferred onto a PVDF membrane (Millipore).



    Similar Products

    96
    Bio-Rad bca protein array kit
    Bca Protein Array Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/Bio-Rad+Protein+Assay+Kit+II/10__1158_slash_1078___0432__ccr___25___4767-103-9-14
    Average 96 stars, based on 1 article reviews
    bca protein array kit - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    99
    Thermo Fisher bca protein array kit
    Bca Protein Array Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/BCA+Protein+Assay+Kit/pm41390720-163-24-28
    Average 99 stars, based on 1 article reviews
    bca protein array kit - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher piercetm bca protein array kit
    Piercetm Bca Protein Array Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/BCA+Protein+Assay+Kit/pmc10643271-62-12-17
    Average 99 stars, based on 1 article reviews
    piercetm bca protein array kit - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    96
    tiangen biotech co bca protein array kit
    Bca Protein Array Kit, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/BCA+Protein+Assay+Kit/pm36913754-78-9-13
    Average 96 stars, based on 1 article reviews
    bca protein array kit - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    99
    Thermo Fisher assays bca protein array kit thermo fisher scientific
    Key resources table
    Assays Bca Protein Array Kit Thermo Fisher Scientific, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bca+protein+array+kit/BCA+Protein+Assay+Kit/pmc10067764-515-135-140
    Average 99 stars, based on 1 article reviews
    assays bca protein array kit thermo fisher scientific - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Key resources table

    Journal: iScience

    Article Title: Adiponectin-mediated promotion of CD44 suppresses diabetic vascular inflammatory effects

    doi: 10.1016/j.isci.2023.106428

    Figure Lengend Snippet: Key resources table

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-reptin Cell Signaling Technology Cat#12668S; RRID: AB_2797987 Rabbit monoclonal anti-IgG Cell Signaling Technology Cat#14708S; RRID: AB_2798581 Rabbit monoclonal anti-APPL1 Cell Signaling Technology Cat#3858S; RRID: AB_2056989 Rabbit monoclonal anti-Histone 2A Cell Signaling Technology Cat#7631S; RRID: AB_10860771 Rabbit monoclonal anti-GAPDH Cell Signaling Technology Cat#5174S; RRID: AB_10622025 Rabbit monoclonal anti-β-catenin Cell Signaling Technology Cat#8480S; RRID: AB_11127855 Rabbit monoclonal anti-Non-β-catenin Cell Signaling Technology Cat#8814S; RRID: AB_11127203 NF-κB Pathway Antibody Sampler Kit Cell Signaling Technology Cat#9936T; RRID: AB_561197 Rabbit monoclonal anti-CD44 Cell Signaling Technology Cat#37259S; RRID: AB_2750879 Rabbit monoclonal anti-ICAM-1 Cell Signaling Technology Cat#67836S; RRID: AB_2799738 Biological samples Serum of Healthy control subjects and Diabetes patients Anzhen Hospital, Capital Medical University, Beijing, China https://anzhen.org/ Chemicals, peptides, and recombinant proteins Recombinant Human gAcrp30/Adipolean Peprotech.inc CAS:25-450-21 Recombinant CD44 protein ®Sangon Biotech CAS:D622619 Critical commercial assays BCA Protein Array Kit Thermo Fisher Scientific, Inc. CAS:23227 Qproteome Cell Compartment Kit CAS:37502 The Transcription Factor Activation Profiling Plate Array II Signosis, Sunnyvale, CA CAS: FA-1002 RT2 ProfilerTM PCR Array Human Transcription Factors Qiagen, USA GeneGlobe ID-PAHS-075ZA-24; CAS: 330231 ELISA Kit for Adiponectin (ADPN) Cloud-Clone Corp CAS: SEA605Hu ELISA Kit for CD44 Cloud-Clone Corp CAS: SEA670Hu EZ-Link Sulfo-NHS-LC-Biotinylation kit Thermo Fisher Scientific, Inc. CAS:21435 Deposited data Raw and analyzed data This paper GEO: GSE217607 Experimental models: Cell lines Human umbilical vein endothelial cells (HUVECs): 4201HUM-CCTCC00635 NICR http://cellresource.cn/fdetail.aspx?id=5307/ Experimental models: Organisms/strains Mouse: APPL1 −/− , 8 weeks’s old BRL Medicine Inc. N/A Mouse: APN −/− , 8 weeks’s old Gift N/A Oligonucleotides siRNA targeting sequence: APPL1 #1: UCUCACCUGACUUCGAAACU This paper N/A siRNA targeting sequence: CD44 #1: GAACAAGGAGUCGUCAGAAACUCCA This paper N/A Primers, see Table S2 This paper N/A Software and algorithms GraphPad Prism 8.0 GraphPad Software Inc., San Diego, CA https://www.graphpad.com/ SPSS Statistics 25.0 SPSS Inc., Chicago, IL https://www.ibm.com/ Open in a separate window Key resources table .

    Techniques: Recombinant, Protein Array, Activation Assay, Enzyme-linked Immunosorbent Assay, Sequencing, Software