pklv u6 sgrna pgkpuro 2a bfp backbone vector (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
pklv u6 sgrna pgkpuro 2a bfp backbone vector
Pklv U6 Sgrna Pgkpuro 2a Bfp Backbone Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 171 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone+vector/pKLV-U6gRNA(BbsI)-PGKpuro2ABFP+(Plasmid+%2350946)/pm41841741-385-8-11
Average 96 stars, based on 171 article reviews
Pklv U6 Sgrna Pgkpuro 2a Bfp Backbone Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 171 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone+vector/pKLV-U6gRNA(BbsI)-PGKpuro2ABFP+(Plasmid+%2350946)/pm41841741-385-8-11
Average 96 stars, based on 171 article reviews
pklv u6 sgrna pgkpuro 2a bfp backbone vector - by Bioz Stars,
2026-11
96/100 stars
Images
Related Articles
Clone Assay:Article Title: Locus-specific proteomics identifies novel regulators of Epstein-Barr virus lytic reactivation. Article Snippet: .. The oligonucleotides were annealed and cloned into the Article Title: Mbd4 and MutSα protect cells from spontaneous deamination of 5-methylcytosine Article Snippet: Cell lines were transduced with FUCas9Cherry (Addgene #70182, a gift from Marco Herold) to drive expression of Cas9-mCherry and enable CRISPR/Cas9 editing [ ]. .. Single guide RNA (sgRNA) sequences targeting mouse Msh6 (TTGGCAAAGGCGCTCCAAAG) and Mbd4 (GATTTTACTGTACTGCCGAA) were cloned into Article Title: DOT1L provides transcriptional memory through PRC1.1 antagonism. Article Snippet: .. sgRNA oligonucleotides (IDT) were cloned into Plasmid Preparation:Article Title: Locus-specific proteomics identifies novel regulators of Epstein-Barr virus lytic reactivation. Article Snippet: .. The oligonucleotides were annealed and cloned into the Article Title: DNA sequence quantitatively encodes CTCF-binding affinity at genome scale Article Snippet: .. To assemble the nicking guide RNA (ngRNA) expression vector, the Article Title: Cell-type-specific adaptations to mitochondrial stress underly the neurological presentations of MTRFR mutations Article Snippet: .. Surviving pools were expanded and knockdown efficiency was assessed by RT-qPCR for MTRFR . pKLV-U6gRNA( Expressing:Article Title: DNA sequence quantitatively encodes CTCF-binding affinity at genome scale Article Snippet: .. To assemble the nicking guide RNA (ngRNA) expression vector, the Article Title: DOT1L provides transcriptional memory through PRC1.1 antagonism Article Snippet: .. Library sgRNAs were expressed in a modified pKLV-U6gRNA(BbsI)- EF1a puro 2A BFP lentiviral sgRNA expression vector that encodes puromycin and BFP selection markers obtained from Article Title: DOT1L provides transcriptional memory through PRC1.1 antagonism. Article Snippet: .. sgRNA oligonucleotides (IDT) were cloned into Article Title: DOT1L provides transcriptional memory through PRC1.1 antagonism. Article Snippet: .. Library sgRNAs were expressed in a modified pKLV-U6gRNA(BbsI)-EF1apuro2ABFP lentiviral sgRNA expression vector that encodes puromycin and BFP selection markers obtained from Modification:Article Title: DOT1L provides transcriptional memory through PRC1.1 antagonism Article Snippet: .. Library sgRNAs were expressed in a modified pKLV-U6gRNA(BbsI)- EF1a puro 2A BFP lentiviral sgRNA expression vector that encodes puromycin and BFP selection markers obtained from Article Title: DOT1L provides transcriptional memory through PRC1.1 antagonism. Article Snippet: .. Library sgRNAs were expressed in a modified pKLV-U6gRNA(BbsI)-EF1apuro2ABFP lentiviral sgRNA expression vector that encodes puromycin and BFP selection markers obtained from Selection:Article Title: DOT1L provides transcriptional memory through PRC1.1 antagonism Article Snippet: .. Library sgRNAs were expressed in a modified pKLV-U6gRNA(BbsI)- EF1a puro 2A BFP lentiviral sgRNA expression vector that encodes puromycin and BFP selection markers obtained from Article Title: DOT1L provides transcriptional memory through PRC1.1 antagonism. Article Snippet: .. Library sgRNAs were expressed in a modified pKLV-U6gRNA(BbsI)-EF1apuro2ABFP lentiviral sgRNA expression vector that encodes puromycin and BFP selection markers obtained from Knockdown:Article Title: Cell-type-specific adaptations to mitochondrial stress underly the neurological presentations of MTRFR mutations Article Snippet: .. Surviving pools were expanded and knockdown efficiency was assessed by RT-qPCR for MTRFR . pKLV-U6gRNA( Quantitative RT-PCR:Article Title: Cell-type-specific adaptations to mitochondrial stress underly the neurological presentations of MTRFR mutations Article Snippet: .. Surviving pools were expanded and knockdown efficiency was assessed by RT-qPCR for MTRFR . pKLV-U6gRNA( |