Positive Control:
Negative Control:
Recombinant:Article Title: Taxane chemotherapy promotes response to TIM-3 checkpoint blockade via STING-mediated ER stress and HMGB1 secretion.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Anti-mouse Ultra-LEAFTM Purified anti-mouse IFNAR-1 Antibody, clone MAR1-5A3 BioLegend Cat# 127321 RRID:AB_11150409 Anti-human/mouse/rat PERK (clone C33E10) mAb Cell Signaling Technology Cat# 3192 RRID:AB_2095847 Anti-human/mouse/rat Phospho-PERK (Thr981) Polyclonal Antibody, clone PA5-40294 Thermo Scientific Cat# PA540294 RRID:AB_2576881 Anti-human/mouse/rat IRE1α (clone 14C10) Rabbit mAb Cell Signaling Technology Cat# 3294 RRID:AB_823545 Anti-human/mouse/rat Phospho-IRE1 alpha (Ser724) Polyclonal Antibody, clone PA1-16927 Thermo Scientific Cat# PA1-16927 RRID:AB_2262241 Anti-mouse Phospho-STING (Ser365) (clone D1C4T) mAb Cell Signaling Technology Cat# 62912 RRID:AB_2799635 Anti-human/mouse/rat/bovine Calreticulin, Alexa Fluor 488 Novus Biologicals Cat# NB600-101AF488; RRID: AB_3192732 Anti-human/mouse/rat XBP-1s (clone E9V3 E) Rabbit mAb Cell Signaling Technology Cat# 40435 RRID:AB_2891025 Anti-human/mouse/rat/monkey Vinculin Polyclonal Cell Signaling Technology Cat# 4650 RRID:AB_10559207 Anti-mouse CD16/32 Fc-block TruStain FcX PLUS BioLegend Cat# 156604 RRID: AB_2783137 Anti-mouse Ly6G clone 1A8 BUV395 BD Cat# 563978 RRID: AB_2716852 Anti-mouse CD19 clone 1D3 BUV737 BD Cat# 564296 RRID: AB_2716855 Anti-mouse CD8 clone 53.6–7 BUV800 BD Cat# 564920 RRID: AB_2716856 Anti-mouse MHCII clone M5/114.15.2 BV421 BD Cat# 562564 RRID: AB_2716857 Anti-mouse CD11c clone N418 BV605 BioLegend Cat# 117334 RRID: AB_2562415 Anti-mouse CD4 clone RM4-5 BV650 BD Cat# 563747 RRID: AB_2716859 Anti-mouse/human CD11b clone M1/70 BV711 BD Cat# 563168 RRID: AB_2716860 Anti-mouse CD45 clone 30-F11 BV785 BD Cat# 564225 RRID: AB_2716861 Anti-mouse CD3e clone 145-2C11 BB700 BD Cat# 566494 RRID: AB_2744393 Anti-mouse F4/80 clone BM8 FITC BioLegend Cat# 123107 RRID: AB_893502 Anti-mouse PD-1 clone 29 F.1A12 APC/Cy7 BioLegend Cat# 135223 RRID: AB_2563523 Anti-mouse Ly6C clone HK1.4 APC/Cy7 BioLegend Cat# 128025 RRID: AB_10643867 Anti-mouse NK-1.1 clone PK136 PE/Dazzle BioLegend Cat#108747 RRID: AB_2564218 Anti-mouse CD80, clone 16-10A1, BV650 BD Cat# 563687 RRID: AB_2738376 Anti-mouse CD86 clone GL1, PE BD Cat# 553692 RRID: AB_394994 Anti-mouse Ki-67 clone D3B5 Cell Signaling Technology Cat# 12202 RRID: AB_2737021 (Continued on next page) Cell Reports Medicine 7, 102788, May 19, 2026 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins 10× Tris-Buffered Saline (TBS) Bio-Rad Cat# 1706435 4–15% Mini-PROTEAN® TGXTM Precast Protein Gels, 12-well Bio-Rad Cat# 4561085 Antimicrobial Reagent Invivogen Cat# ant-noc BD Cytofix fixation buffer BD Biosciences Cat# 554655 BD Perm/Wash Buffer BD Biosciences Cat# 554723 Niraparib Selleck Chemicals Cat# S2741 Olaparib Selleck Chemicals Cat# S1060 Rucaparib Selleck Chemicals Cat# S4948 Bovine Serum Albumin FisherScientific Cat# BP1600-100 DAPI (4′,6-Diamidino-2-Phenylindole, Dilactate) Biolegend Cat# 422801 DMEM high glucose (4.5g/L) Thermo Fisher Cat# 11965118 DMSO FisherScientific Cat# BP231-100 DMXAA Invivogen Cat# tlrl-dmx Doxorubicin pfizer 0069-3030-20 5-Fluoro-2′-deoxyuridine 5′-monophosphate sodium salt,∼85% Sigma-Aldrich F3503-5MG Fetal bovine serum albumin Peak Serum Cat# PS-FB1 Fungin Antifungal agent Invivogen Cat# ant-fn-1 Hygromycin B Thermo Fisher Cat# 10687010 Trans-Blot® TurboTM Mini PVDF Transfer Packs Bio-Rad Cat#1704156EDU Opti-MEM Thermofisher Cat# 31985062 Penicillin/streptomycin Thermo Fisher Cat# 15140-122 Pierce BCA Protein assay Thermofisher Cat# 23227 PierceTM RIPA Buffer Thermofisher Cat# 89900 polyethylenimine (PEI) 25kDa Polysciences Cat# 23966-2 Precision Plus ProteinTM Dual Color Standards Bio-Rad Cat# 1610374 Puromycin Thermo Fisher Cat# A1113803 Paclitaxel Alvogen 47781-59307-0 Paclitaxel Teva 0703-3213-01 Paclitaxel Actavis 45963-613-56 Docetaxel Meitheal 71288-144-08 Docetaxel Pfizer 00409-0367-01 Docetaxel Armas Pharmaceuticals 7248-0214-01 Gemcitabine Armas Pharmaceuticals 72485-0221-02 Cisplatin Accord Healthcare 16729-0288-11 Cyclophosphamide Baxter 10019-0955-01 TrypLE Thermo Fisher Cat# 12604021 Tween 20 FisherScientific Cat# BP337-500 Zombie NIR Fixable Viability dye BioLegend Cat# 423105 R-Universal Epitope Recovery Buffer Fisher Scientific Cat# 50-192-6580 EverBriteTM Hardset Mounting Medium Biotium Cat# 23003 Corning Matrigel GFR/LDEV-Free Fisher Scientific Cat# CB-40230 BioReagent N-acetyl-L-cysteine, Powder, ≥99% (TLC), Suitable for cell culture Sigma-Aldrich Cat# A9165-5G Tunicamycin from Streptomyces sp. Millipore Sigma Cat# T7765-1MG M62812 TLR4 inhibitor Fisher Scientific Cat# 570510 GLX481304 NOX2/4i Sigma-Aldrich Cat# SML3192-5MG Cytochalasin B MedChemExpress Cat# HY-16928 (Continued on next page) e3 Cell Reports Medicine 7, 102788, May 19, 2026 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Leptomycin B-1mg Selleck Chemicals Cat# S7580 LPS-EB Ultrapure Invivogen Cat# tlrl-3pelps Polyethylene glycol (PEG) Millipore Sigma Cat# N0632 Ponceau S Staining Solution Thermo Fisher Cat# A40000279 Molecular Probes ProLong Gold Antifade Mountant Thermo Fisher Cat# P36934 5,5′-Dimethyl BAPTA, AM Ester Biotium Cat# 50007 Clarity MaxTM Western ECL Substrate Bio-Rad Cat# 1705062 7-AAD Viability Staining Solution Biolegend Cat# 420403 AMG PERK 44, PERK Inhibitor MedChemExpress Cat# HY-12661 A MKC8866 IRE1a RNase Inhibitor MedChemExpress Cat# HY-104040 Hydrogen Peroxide (30%/500mL) Fisher Scientific Cat# BP2633-500 Critical commercial assays In-Fusion® Snap Assembly Master Mix with Competent Cells TakaraBio Cat# 638951 Nucleospin PCR/Gel purification kit TakaraBio Cat# 740609.5 Nucleospin Plasmid miniprep TakaraBio Cat# 740588.5 PureLink HiPure Plasmid Midiprep kit ThermoFisher Cat# K210004 TaqMan Fast Advanced Master Mix ThermoFisher Scientific Cat# 4444557 TaqManTM Gene Expression Cells-to-CTTM Kit Thermo Fisher Cat# AM1728 CellTiter-Glo 2.0 Assay Promega Cat# G9242 Duolink® In Situ Proximity Ligation Assay Starter Kit, Red, Mouse/Rabbit Sigma-Aldrich Cat# DUO92101-1KT NaveniFlex Cell Red Navinci Cat# NC.MR.100 Red HAT activity, HDAC activity, Histone H3 acetylation detection, H4 acetylation detection Epigentek Cat# Q230428PF2 ER-TrackerTM Blue-White DPX, for live-cell imaging Thermo Fisher Scientific Cat# E12353 ELISA MAXTM Deluxe Set Mouse IFN-β BioLegend Cat# 439404 ROS Assay Kit -Highly Sensitive DCFH-DA Dojindo Cat# R252 Experimental models: Organisms/strains KP1 Kay Hänggi Hanggi et al.53 PyMT-B6 David G. DeNardo Meyer et al.80 MDA-MB-231 Robert J. Gillies ATCC HTB-26 LentiX-293 T Takara Bio Cat# 632180 Experimental Models: Organisms/strains Mouse: C57BL/6 J The Jackson Laboratory RRID: IMSR_JAX:000664 Oligonucleotides Mouse sgRNA targeting sequence: sgNTC13 (GCCGCACCTGTTTAGCAGCA) Kay Hänggi et al.Cancer Cell 2024 Hanggi et al.53 Mouse sgRNA targeting sequence: sgNTC49 (GGACATTACATATAAGACCA) Kay Hänggi et al.Cancer Cell 2024 Hanggi et al.53 Mouse sgRNA targeting sequence: sgMb21d1 (CGGGCCGCAGCTTTCCGCGT) Pulido Á de et al.
Saline:Article Title: Taxane chemotherapy promotes response to TIM-3 checkpoint blockade via STING-mediated ER stress and HMGB1 secretion.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Anti-mouse Ultra-LEAFTM Purified anti-mouse IFNAR-1 Antibody, clone MAR1-5A3 BioLegend Cat# 127321 RRID:AB_11150409 Anti-human/mouse/rat PERK (clone C33E10) mAb Cell Signaling Technology Cat# 3192 RRID:AB_2095847 Anti-human/mouse/rat Phospho-PERK (Thr981) Polyclonal Antibody, clone PA5-40294 Thermo Scientific Cat# PA540294 RRID:AB_2576881 Anti-human/mouse/rat IRE1α (clone 14C10) Rabbit mAb Cell Signaling Technology Cat# 3294 RRID:AB_823545 Anti-human/mouse/rat Phospho-IRE1 alpha (Ser724) Polyclonal Antibody, clone PA1-16927 Thermo Scientific Cat# PA1-16927 RRID:AB_2262241 Anti-mouse Phospho-STING (Ser365) (clone D1C4T) mAb Cell Signaling Technology Cat# 62912 RRID:AB_2799635 Anti-human/mouse/rat/bovine Calreticulin, Alexa Fluor 488 Novus Biologicals Cat# NB600-101AF488; RRID: AB_3192732 Anti-human/mouse/rat XBP-1s (clone E9V3 E) Rabbit mAb Cell Signaling Technology Cat# 40435 RRID:AB_2891025 Anti-human/mouse/rat/monkey Vinculin Polyclonal Cell Signaling Technology Cat# 4650 RRID:AB_10559207 Anti-mouse CD16/32 Fc-block TruStain FcX PLUS BioLegend Cat# 156604 RRID: AB_2783137 Anti-mouse Ly6G clone 1A8 BUV395 BD Cat# 563978 RRID: AB_2716852 Anti-mouse CD19 clone 1D3 BUV737 BD Cat# 564296 RRID: AB_2716855 Anti-mouse CD8 clone 53.6–7 BUV800 BD Cat# 564920 RRID: AB_2716856 Anti-mouse MHCII clone M5/114.15.2 BV421 BD Cat# 562564 RRID: AB_2716857 Anti-mouse CD11c clone N418 BV605 BioLegend Cat# 117334 RRID: AB_2562415 Anti-mouse CD4 clone RM4-5 BV650 BD Cat# 563747 RRID: AB_2716859 Anti-mouse/human CD11b clone M1/70 BV711 BD Cat# 563168 RRID: AB_2716860 Anti-mouse CD45 clone 30-F11 BV785 BD Cat# 564225 RRID: AB_2716861 Anti-mouse CD3e clone 145-2C11 BB700 BD Cat# 566494 RRID: AB_2744393 Anti-mouse F4/80 clone BM8 FITC BioLegend Cat# 123107 RRID: AB_893502 Anti-mouse PD-1 clone 29 F.1A12 APC/Cy7 BioLegend Cat# 135223 RRID: AB_2563523 Anti-mouse Ly6C clone HK1.4 APC/Cy7 BioLegend Cat# 128025 RRID: AB_10643867 Anti-mouse NK-1.1 clone PK136 PE/Dazzle BioLegend Cat#108747 RRID: AB_2564218 Anti-mouse CD80, clone 16-10A1, BV650 BD Cat# 563687 RRID: AB_2738376 Anti-mouse CD86 clone GL1, PE BD Cat# 553692 RRID: AB_394994 Anti-mouse Ki-67 clone D3B5 Cell Signaling Technology Cat# 12202 RRID: AB_2737021 (Continued on next page) Cell Reports Medicine 7, 102788, May 19, 2026 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins 10× Tris-Buffered Saline (TBS) Bio-Rad Cat# 1706435 4–15% Mini-PROTEAN® TGXTM Precast Protein Gels, 12-well Bio-Rad Cat# 4561085 Antimicrobial Reagent Invivogen Cat# ant-noc BD Cytofix fixation buffer BD Biosciences Cat# 554655 BD Perm/Wash Buffer BD Biosciences Cat# 554723 Niraparib Selleck Chemicals Cat# S2741 Olaparib Selleck Chemicals Cat# S1060 Rucaparib Selleck Chemicals Cat# S4948 Bovine Serum Albumin FisherScientific Cat# BP1600-100 DAPI (4′,6-Diamidino-2-Phenylindole, Dilactate) Biolegend Cat# 422801 DMEM high glucose (4.5g/L) Thermo Fisher Cat# 11965118 DMSO FisherScientific Cat# BP231-100 DMXAA Invivogen Cat# tlrl-dmx Doxorubicin pfizer 0069-3030-20 5-Fluoro-2′-deoxyuridine 5′-monophosphate sodium salt,∼85% Sigma-Aldrich F3503-5MG Fetal bovine serum albumin Peak Serum Cat# PS-FB1 Fungin Antifungal agent Invivogen Cat# ant-fn-1 Hygromycin B Thermo Fisher Cat# 10687010 Trans-Blot® TurboTM Mini PVDF Transfer Packs Bio-Rad Cat#1704156EDU Opti-MEM Thermofisher Cat# 31985062 Penicillin/streptomycin Thermo Fisher Cat# 15140-122 Pierce BCA Protein assay Thermofisher Cat# 23227 PierceTM RIPA Buffer Thermofisher Cat# 89900 polyethylenimine (PEI) 25kDa Polysciences Cat# 23966-2 Precision Plus ProteinTM Dual Color Standards Bio-Rad Cat# 1610374 Puromycin Thermo Fisher Cat# A1113803 Paclitaxel Alvogen 47781-59307-0 Paclitaxel Teva 0703-3213-01 Paclitaxel Actavis 45963-613-56 Docetaxel Meitheal 71288-144-08 Docetaxel Pfizer 00409-0367-01 Docetaxel Armas Pharmaceuticals 7248-0214-01 Gemcitabine Armas Pharmaceuticals 72485-0221-02 Cisplatin Accord Healthcare 16729-0288-11 Cyclophosphamide Baxter 10019-0955-01 TrypLE Thermo Fisher Cat# 12604021 Tween 20 FisherScientific Cat# BP337-500 Zombie NIR Fixable Viability dye BioLegend Cat# 423105 R-Universal Epitope Recovery Buffer Fisher Scientific Cat# 50-192-6580 EverBriteTM Hardset Mounting Medium Biotium Cat# 23003 Corning Matrigel GFR/LDEV-Free Fisher Scientific Cat# CB-40230 BioReagent N-acetyl-L-cysteine, Powder, ≥99% (TLC), Suitable for cell culture Sigma-Aldrich Cat# A9165-5G Tunicamycin from Streptomyces sp. Millipore Sigma Cat# T7765-1MG M62812 TLR4 inhibitor Fisher Scientific Cat# 570510 GLX481304 NOX2/4i Sigma-Aldrich Cat# SML3192-5MG Cytochalasin B MedChemExpress Cat# HY-16928 (Continued on next page) e3 Cell Reports Medicine 7, 102788, May 19, 2026 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Leptomycin B-1mg Selleck Chemicals Cat# S7580 LPS-EB Ultrapure Invivogen Cat# tlrl-3pelps Polyethylene glycol (PEG) Millipore Sigma Cat# N0632 Ponceau S Staining Solution Thermo Fisher Cat# A40000279 Molecular Probes ProLong Gold Antifade Mountant Thermo Fisher Cat# P36934 5,5′-Dimethyl BAPTA, AM Ester Biotium Cat# 50007 Clarity MaxTM Western ECL Substrate Bio-Rad Cat# 1705062 7-AAD Viability Staining Solution Biolegend Cat# 420403 AMG PERK 44, PERK Inhibitor MedChemExpress Cat# HY-12661 A MKC8866 IRE1a RNase Inhibitor MedChemExpress Cat# HY-104040 Hydrogen Peroxide (30%/500mL) Fisher Scientific Cat# BP2633-500 Critical commercial assays In-Fusion® Snap Assembly Master Mix with Competent Cells TakaraBio Cat# 638951 Nucleospin PCR/Gel purification kit TakaraBio Cat# 740609.5 Nucleospin Plasmid miniprep TakaraBio Cat# 740588.5 PureLink HiPure Plasmid Midiprep kit ThermoFisher Cat# K210004 TaqMan Fast Advanced Master Mix ThermoFisher Scientific Cat# 4444557 TaqManTM Gene Expression Cells-to-CTTM Kit Thermo Fisher Cat# AM1728 CellTiter-Glo 2.0 Assay Promega Cat# G9242 Duolink® In Situ Proximity Ligation Assay Starter Kit, Red, Mouse/Rabbit Sigma-Aldrich Cat# DUO92101-1KT NaveniFlex Cell Red Navinci Cat# NC.MR.100 Red HAT activity, HDAC activity, Histone H3 acetylation detection, H4 acetylation detection Epigentek Cat# Q230428PF2 ER-TrackerTM Blue-White DPX, for live-cell imaging Thermo Fisher Scientific Cat# E12353 ELISA MAXTM Deluxe Set Mouse IFN-β BioLegend Cat# 439404 ROS Assay Kit -Highly Sensitive DCFH-DA Dojindo Cat# R252 Experimental models: Organisms/strains KP1 Kay Hänggi Hanggi et al.53 PyMT-B6 David G. DeNardo Meyer et al.80 MDA-MB-231 Robert J. Gillies ATCC HTB-26 LentiX-293 T Takara Bio Cat# 632180 Experimental Models: Organisms/strains Mouse: C57BL/6 J The Jackson Laboratory RRID: IMSR_JAX:000664 Oligonucleotides Mouse sgRNA targeting sequence: sgNTC13 (GCCGCACCTGTTTAGCAGCA) Kay Hänggi et al.Cancer Cell 2024 Hanggi et al.53 Mouse sgRNA targeting sequence: sgNTC49 (GGACATTACATATAAGACCA) Kay Hänggi et al.Cancer Cell 2024 Hanggi et al.53 Mouse sgRNA targeting sequence: sgMb21d1 (CGGGCCGCAGCTTTCCGCGT) Pulido Á de et al.
Bicinchoninic Acid Protein Assay:Article Title: Taxane chemotherapy promotes response to TIM-3 checkpoint blockade via STING-mediated ER stress and HMGB1 secretion.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Anti-mouse Ultra-LEAFTM Purified anti-mouse IFNAR-1 Antibody, clone MAR1-5A3 BioLegend Cat# 127321 RRID:AB_11150409 Anti-human/mouse/rat PERK (clone C33E10) mAb Cell Signaling Technology Cat# 3192 RRID:AB_2095847 Anti-human/mouse/rat Phospho-PERK (Thr981) Polyclonal Antibody, clone PA5-40294 Thermo Scientific Cat# PA540294 RRID:AB_2576881 Anti-human/mouse/rat IRE1α (clone 14C10) Rabbit mAb Cell Signaling Technology Cat# 3294 RRID:AB_823545 Anti-human/mouse/rat Phospho-IRE1 alpha (Ser724) Polyclonal Antibody, clone PA1-16927 Thermo Scientific Cat# PA1-16927 RRID:AB_2262241 Anti-mouse Phospho-STING (Ser365) (clone D1C4T) mAb Cell Signaling Technology Cat# 62912 RRID:AB_2799635 Anti-human/mouse/rat/bovine Calreticulin, Alexa Fluor 488 Novus Biologicals Cat# NB600-101AF488; RRID: AB_3192732 Anti-human/mouse/rat XBP-1s (clone E9V3 E) Rabbit mAb Cell Signaling Technology Cat# 40435 RRID:AB_2891025 Anti-human/mouse/rat/monkey Vinculin Polyclonal Cell Signaling Technology Cat# 4650 RRID:AB_10559207 Anti-mouse CD16/32 Fc-block TruStain FcX PLUS BioLegend Cat# 156604 RRID: AB_2783137 Anti-mouse Ly6G clone 1A8 BUV395 BD Cat# 563978 RRID: AB_2716852 Anti-mouse CD19 clone 1D3 BUV737 BD Cat# 564296 RRID: AB_2716855 Anti-mouse CD8 clone 53.6–7 BUV800 BD Cat# 564920 RRID: AB_2716856 Anti-mouse MHCII clone M5/114.15.2 BV421 BD Cat# 562564 RRID: AB_2716857 Anti-mouse CD11c clone N418 BV605 BioLegend Cat# 117334 RRID: AB_2562415 Anti-mouse CD4 clone RM4-5 BV650 BD Cat# 563747 RRID: AB_2716859 Anti-mouse/human CD11b clone M1/70 BV711 BD Cat# 563168 RRID: AB_2716860 Anti-mouse CD45 clone 30-F11 BV785 BD Cat# 564225 RRID: AB_2716861 Anti-mouse CD3e clone 145-2C11 BB700 BD Cat# 566494 RRID: AB_2744393 Anti-mouse F4/80 clone BM8 FITC BioLegend Cat# 123107 RRID: AB_893502 Anti-mouse PD-1 clone 29 F.1A12 APC/Cy7 BioLegend Cat# 135223 RRID: AB_2563523 Anti-mouse Ly6C clone HK1.4 APC/Cy7 BioLegend Cat# 128025 RRID: AB_10643867 Anti-mouse NK-1.1 clone PK136 PE/Dazzle BioLegend Cat#108747 RRID: AB_2564218 Anti-mouse CD80, clone 16-10A1, BV650 BD Cat# 563687 RRID: AB_2738376 Anti-mouse CD86 clone GL1, PE BD Cat# 553692 RRID: AB_394994 Anti-mouse Ki-67 clone D3B5 Cell Signaling Technology Cat# 12202 RRID: AB_2737021 (Continued on next page) Cell Reports Medicine 7, 102788, May 19, 2026 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins 10× Tris-Buffered Saline (TBS) Bio-Rad Cat# 1706435 4–15% Mini-PROTEAN® TGXTM Precast Protein Gels, 12-well Bio-Rad Cat# 4561085 Antimicrobial Reagent Invivogen Cat# ant-noc BD Cytofix fixation buffer BD Biosciences Cat# 554655 BD Perm/Wash Buffer BD Biosciences Cat# 554723 Niraparib Selleck Chemicals Cat# S2741 Olaparib Selleck Chemicals Cat# S1060 Rucaparib Selleck Chemicals Cat# S4948 Bovine Serum Albumin FisherScientific Cat# BP1600-100 DAPI (4′,6-Diamidino-2-Phenylindole, Dilactate) Biolegend Cat# 422801 DMEM high glucose (4.5g/L) Thermo Fisher Cat# 11965118 DMSO FisherScientific Cat# BP231-100 DMXAA Invivogen Cat# tlrl-dmx Doxorubicin pfizer 0069-3030-20 5-Fluoro-2′-deoxyuridine 5′-monophosphate sodium salt,∼85% Sigma-Aldrich F3503-5MG Fetal bovine serum albumin Peak Serum Cat# PS-FB1 Fungin Antifungal agent Invivogen Cat# ant-fn-1 Hygromycin B Thermo Fisher Cat# 10687010 Trans-Blot® TurboTM Mini PVDF Transfer Packs Bio-Rad Cat#1704156EDU Opti-MEM Thermofisher Cat# 31985062 Penicillin/streptomycin Thermo Fisher Cat# 15140-122 Pierce BCA Protein assay Thermofisher Cat# 23227 PierceTM RIPA Buffer Thermofisher Cat# 89900 polyethylenimine (PEI) 25kDa Polysciences Cat# 23966-2 Precision Plus ProteinTM Dual Color Standards Bio-Rad Cat# 1610374 Puromycin Thermo Fisher Cat# A1113803 Paclitaxel Alvogen 47781-59307-0 Paclitaxel Teva 0703-3213-01 Paclitaxel Actavis 45963-613-56 Docetaxel Meitheal 71288-144-08 Docetaxel Pfizer 00409-0367-01 Docetaxel Armas Pharmaceuticals 7248-0214-01 Gemcitabine Armas Pharmaceuticals 72485-0221-02 Cisplatin Accord Healthcare 16729-0288-11 Cyclophosphamide Baxter 10019-0955-01 TrypLE Thermo Fisher Cat# 12604021 Tween 20 FisherScientific Cat# BP337-500 Zombie NIR Fixable Viability dye BioLegend Cat# 423105 R-Universal Epitope Recovery Buffer Fisher Scientific Cat# 50-192-6580 EverBriteTM Hardset Mounting Medium Biotium Cat# 23003 Corning Matrigel GFR/LDEV-Free Fisher Scientific Cat# CB-40230 BioReagent N-acetyl-L-cysteine, Powder, ≥99% (TLC), Suitable for cell culture Sigma-Aldrich Cat# A9165-5G Tunicamycin from Streptomyces sp. Millipore Sigma Cat# T7765-1MG M62812 TLR4 inhibitor Fisher Scientific Cat# 570510 GLX481304 NOX2/4i Sigma-Aldrich Cat# SML3192-5MG Cytochalasin B MedChemExpress Cat# HY-16928 (Continued on next page) e3 Cell Reports Medicine 7, 102788, May 19, 2026 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Leptomycin B-1mg Selleck Chemicals Cat# S7580 LPS-EB Ultrapure Invivogen Cat# tlrl-3pelps Polyethylene glycol (PEG) Millipore Sigma Cat# N0632 Ponceau S Staining Solution Thermo Fisher Cat# A40000279 Molecular Probes ProLong Gold Antifade Mountant Thermo Fisher Cat# P36934 5,5′-Dimethyl BAPTA, AM Ester Biotium Cat# 50007 Clarity MaxTM Western ECL Substrate Bio-Rad Cat# 1705062 7-AAD Viability Staining Solution Biolegend Cat# 420403 AMG PERK 44, PERK Inhibitor MedChemExpress Cat# HY-12661 A MKC8866 IRE1a RNase Inhibitor MedChemExpress Cat# HY-104040 Hydrogen Peroxide (30%/500mL) Fisher Scientific Cat# BP2633-500 Critical commercial assays In-Fusion® Snap Assembly Master Mix with Competent Cells TakaraBio Cat# 638951 Nucleospin PCR/Gel purification kit TakaraBio Cat# 740609.5 Nucleospin Plasmid miniprep TakaraBio Cat# 740588.5 PureLink HiPure Plasmid Midiprep kit ThermoFisher Cat# K210004 TaqMan Fast Advanced Master Mix ThermoFisher Scientific Cat# 4444557 TaqManTM Gene Expression Cells-to-CTTM Kit Thermo Fisher Cat# AM1728 CellTiter-Glo 2.0 Assay Promega Cat# G9242 Duolink® In Situ Proximity Ligation Assay Starter Kit, Red, Mouse/Rabbit Sigma-Aldrich Cat# DUO92101-1KT NaveniFlex Cell Red Navinci Cat# NC.MR.100 Red HAT activity, HDAC activity, Histone H3 acetylation detection, H4 acetylation detection Epigentek Cat# Q230428PF2 ER-TrackerTM Blue-White DPX, for live-cell imaging Thermo Fisher Scientific Cat# E12353 ELISA MAXTM Deluxe Set Mouse IFN-β BioLegend Cat# 439404 ROS Assay Kit -Highly Sensitive DCFH-DA Dojindo Cat# R252 Experimental models: Organisms/strains KP1 Kay Hänggi Hanggi et al.53 PyMT-B6 David G. DeNardo Meyer et al.80 MDA-MB-231 Robert J. Gillies ATCC HTB-26 LentiX-293 T Takara Bio Cat# 632180 Experimental Models: Organisms/strains Mouse: C57BL/6 J The Jackson Laboratory RRID: IMSR_JAX:000664 Oligonucleotides Mouse sgRNA targeting sequence: sgNTC13 (GCCGCACCTGTTTAGCAGCA) Kay Hänggi et al.Cancer Cell 2024 Hanggi et al.53 Mouse sgRNA targeting sequence: sgNTC49 (GGACATTACATATAAGACCA) Kay Hänggi et al.Cancer Cell 2024 Hanggi et al.53 Mouse sgRNA targeting sequence: sgMb21d1 (CGGGCCGCAGCTTTCCGCGT) Pulido Á de et al.
Thin Layer Chromatography:Article Title: Taxane chemotherapy promotes response to TIM-3 checkpoint blockade via STING-mediated ER stress and HMGB1 secretion.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Anti-mouse Ultra-LEAFTM Purified anti-mouse IFNAR-1 Antibody, clone MAR1-5A3 BioLegend Cat# 127321 RRID:AB_11150409 Anti-human/mouse/rat PERK (clone C33E10) mAb Cell Signaling Technology Cat# 3192 RRID:AB_2095847 Anti-human/mouse/rat Phospho-PERK (Thr981) Polyclonal Antibody, clone PA5-40294 Thermo Scientific Cat# PA540294 RRID:AB_2576881 Anti-human/mouse/rat IRE1α (clone 14C10) Rabbit mAb Cell Signaling Technology Cat# 3294 RRID:AB_823545 Anti-human/mouse/rat Phospho-IRE1 alpha (Ser724) Polyclonal Antibody, clone PA1-16927 Thermo Scientific Cat# PA1-16927 RRID:AB_2262241 Anti-mouse Phospho-STING (Ser365) (clone D1C4T) mAb Cell Signaling Technology Cat# 62912 RRID:AB_2799635 Anti-human/mouse/rat/bovine Calreticulin, Alexa Fluor 488 Novus Biologicals Cat# NB600-101AF488; RRID: AB_3192732 Anti-human/mouse/rat XBP-1s (clone E9V3 E) Rabbit mAb Cell Signaling Technology Cat# 40435 RRID:AB_2891025 Anti-human/mouse/rat/monkey Vinculin Polyclonal Cell Signaling Technology Cat# 4650 RRID:AB_10559207 Anti-mouse CD16/32 Fc-block TruStain FcX PLUS BioLegend Cat# 156604 RRID: AB_2783137 Anti-mouse Ly6G clone 1A8 BUV395 BD Cat# 563978 RRID: AB_2716852 Anti-mouse CD19 clone 1D3 BUV737 BD Cat# 564296 RRID: AB_2716855 Anti-mouse CD8 clone 53.6–7 BUV800 BD Cat# 564920 RRID: AB_2716856 Anti-mouse MHCII clone M5/114.15.2 BV421 BD Cat# 562564 RRID: AB_2716857 Anti-mouse CD11c clone N418 BV605 BioLegend Cat# 117334 RRID: AB_2562415 Anti-mouse CD4 clone RM4-5 BV650 BD Cat# 563747 RRID: AB_2716859 Anti-mouse/human CD11b clone M1/70 BV711 BD Cat# 563168 RRID: AB_2716860 Anti-mouse CD45 clone 30-F11 BV785 BD Cat# 564225 RRID: AB_2716861 Anti-mouse CD3e clone 145-2C11 BB700 BD Cat# 566494 RRID: AB_2744393 Anti-mouse F4/80 clone BM8 FITC BioLegend Cat# 123107 RRID: AB_893502 Anti-mouse PD-1 clone 29 F.1A12 APC/Cy7 BioLegend Cat# 135223 RRID: AB_2563523 Anti-mouse Ly6C clone HK1.4 APC/Cy7 BioLegend Cat# 128025 RRID: AB_10643867 Anti-mouse NK-1.1 clone PK136 PE/Dazzle BioLegend Cat#108747 RRID: AB_2564218 Anti-mouse CD80, clone 16-10A1, BV650 BD Cat# 563687 RRID: AB_2738376 Anti-mouse CD86 clone GL1, PE BD Cat# 553692 RRID: AB_394994 Anti-mouse Ki-67 clone D3B5 Cell Signaling Technology Cat# 12202 RRID: AB_2737021 (Continued on next page) Cell Reports Medicine 7, 102788, May 19, 2026 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins 10× Tris-Buffered Saline (TBS) Bio-Rad Cat# 1706435 4–15% Mini-PROTEAN® TGXTM Precast Protein Gels, 12-well Bio-Rad Cat# 4561085 Antimicrobial Reagent Invivogen Cat# ant-noc BD Cytofix fixation buffer BD Biosciences Cat# 554655 BD Perm/Wash Buffer BD Biosciences Cat# 554723 Niraparib Selleck Chemicals Cat# S2741 Olaparib Selleck Chemicals Cat# S1060 Rucaparib Selleck Chemicals Cat# S4948 Bovine Serum Albumin FisherScientific Cat# BP1600-100 DAPI (4′,6-Diamidino-2-Phenylindole, Dilactate) Biolegend Cat# 422801 DMEM high glucose (4.5g/L) Thermo Fisher Cat# 11965118 DMSO FisherScientific Cat# BP231-100 DMXAA Invivogen Cat# tlrl-dmx Doxorubicin pfizer 0069-3030-20 5-Fluoro-2′-deoxyuridine 5′-monophosphate sodium salt,∼85% Sigma-Aldrich F3503-5MG Fetal bovine serum albumin Peak Serum Cat# PS-FB1 Fungin Antifungal agent Invivogen Cat# ant-fn-1 Hygromycin B Thermo Fisher Cat# 10687010 Trans-Blot® TurboTM Mini PVDF Transfer Packs Bio-Rad Cat#1704156EDU Opti-MEM Thermofisher Cat# 31985062 Penicillin/streptomycin Thermo Fisher Cat# 15140-122 Pierce BCA Protein assay Thermofisher Cat# 23227 PierceTM RIPA Buffer Thermofisher Cat# 89900 polyethylenimine (PEI) 25kDa Polysciences Cat# 23966-2 Precision Plus ProteinTM Dual Color Standards Bio-Rad Cat# 1610374 Puromycin Thermo Fisher Cat# A1113803 Paclitaxel Alvogen 47781-59307-0 Paclitaxel Teva 0703-3213-01 Paclitaxel Actavis 45963-613-56 Docetaxel Meitheal 71288-144-08 Docetaxel Pfizer 00409-0367-01 Docetaxel Armas Pharmaceuticals 7248-0214-01 Gemcitabine Armas Pharmaceuticals 72485-0221-02 Cisplatin Accord Healthcare 16729-0288-11 Cyclophosphamide Baxter 10019-0955-01 TrypLE Thermo Fisher Cat# 12604021 Tween 20 FisherScientific Cat# BP337-500 Zombie NIR Fixable Viability dye BioLegend Cat# 423105 R-Universal Epitope Recovery Buffer Fisher Scientific Cat# 50-192-6580 EverBriteTM Hardset Mounting Medium Biotium Cat# 23003 Corning Matrigel GFR/LDEV-Free Fisher Scientific Cat# CB-40230 BioReagent N-acetyl-L-cysteine, Powder, ≥99% (TLC), Suitable for cell culture Sigma-Aldrich Cat# A9165-5G Tunicamycin from Streptomyces sp. Millipore Sigma Cat# T7765-1MG M62812 TLR4 inhibitor Fisher Scientific Cat# 570510 GLX481304 NOX2/4i Sigma-Aldrich Cat# SML3192-5MG Cytochalasin B MedChemExpress Cat# HY-16928 (Continued on next page) e3 Cell Reports Medicine 7, 102788, May 19, 2026 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Leptomycin B-1mg Selleck Chemicals Cat# S7580 LPS-EB Ultrapure Invivogen Cat# tlrl-3pelps Polyethylene glycol (PEG) Millipore Sigma Cat# N0632 Ponceau S Staining Solution Thermo Fisher Cat# A40000279 Molecular Probes ProLong Gold Antifade Mountant Thermo Fisher Cat# P36934 5,5′-Dimethyl BAPTA, AM Ester Biotium Cat# 50007 Clarity MaxTM Western ECL Substrate Bio-Rad Cat# 1705062 7-AAD Viability Staining Solution Biolegend Cat# 420403 AMG PERK 44, PERK Inhibitor MedChemExpress Cat# HY-12661 A MKC8866 IRE1a RNase Inhibitor MedChemExpress Cat# HY-104040 Hydrogen Peroxide (30%/500mL) Fisher Scientific Cat# BP2633-500 Critical commercial assays In-Fusion® Snap Assembly Master Mix with Competent Cells TakaraBio Cat# 638951 Nucleospin PCR/Gel purification kit TakaraBio Cat# 740609.5 Nucleospin Plasmid miniprep TakaraBio Cat# 740588.5 PureLink HiPure Plasmid Midiprep kit ThermoFisher Cat# K210004 TaqMan Fast Advanced Master Mix ThermoFisher Scientific Cat# 4444557 TaqManTM Gene Expression Cells-to-CTTM Kit Thermo Fisher Cat# AM1728 CellTiter-Glo 2.0 Assay Promega Cat# G9242 Duolink® In Situ Proximity Ligation Assay Starter Kit, Red, Mouse/Rabbit Sigma-Aldrich Cat# DUO92101-1KT NaveniFlex Cell Red Navinci Cat# NC.MR.100 Red HAT activity, HDAC activity, Histone H3 acetylation detection, H4 acetylation detection Epigentek Cat# Q230428PF2 ER-TrackerTM Blue-White DPX, for live-cell imaging Thermo Fisher Scientific Cat# E12353 ELISA MAXTM Deluxe Set Mouse IFN-β BioLegend Cat# 439404 ROS Assay Kit -Highly Sensitive DCFH-DA Dojindo Cat# R252 Experimental models: Organisms/strains KP1 Kay Hänggi Hanggi et al.53 PyMT-B6 David G. DeNardo Meyer et al.80 MDA-MB-231 Robert J. Gillies ATCC HTB-26 LentiX-293 T Takara Bio Cat# 632180 Experimental Models: Organisms/strains Mouse: C57BL/6 J The Jackson Laboratory RRID: IMSR_JAX:000664 Oligonucleotides Mouse sgRNA targeting sequence: sgNTC13 (GCCGCACCTGTTTAGCAGCA) Kay Hänggi et al.Cancer Cell 2024 Hanggi et al.53 Mouse sgRNA targeting sequence: sgNTC49 (GGACATTACATATAAGACCA) Kay Hänggi et al.Cancer Cell 2024 Hanggi et al.53 Mouse sgRNA targeting sequence: sgMb21d1 (CGGGCCGCAGCTTTCCGCGT) Pulido Á de et al.
Cell Culture:Article Title: Taxane chemotherapy promotes response to TIM-3 checkpoint blockade via STING-mediated ER stress and HMGB1 secretion.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Anti-mouse Ultra-LEAFTM Purified anti-mouse IFNAR-1 Antibody, clone MAR1-5A3 BioLegend Cat# 127321 RRID:AB_11150409 Anti-human/mouse/rat PERK (clone C33E10) mAb Cell Signaling Technology Cat# 3192 RRID:AB_2095847 Anti-human/mouse/rat Phospho-PERK (Thr981) Polyclonal Antibody, clone PA5-40294 Thermo Scientific Cat# PA540294 RRID:AB_2576881 Anti-human/mouse/rat IRE1α (clone 14C10) Rabbit mAb Cell Signaling Technology Cat# 3294 RRID:AB_823545 Anti-human/mouse/rat Phospho-IRE1 alpha (Ser724) Polyclonal Antibody, clone PA1-16927 Thermo Scientific Cat# PA1-16927 RRID:AB_2262241 Anti-mouse Phospho-STING (Ser365) (clone D1C4T) mAb Cell Signaling Technology Cat# 62912 RRID:AB_2799635 Anti-human/mouse/rat/bovine Calreticulin, Alexa Fluor 488 Novus Biologicals Cat# NB600-101AF488; RRID: AB_3192732 Anti-human/mouse/rat XBP-1s (clone E9V3 E) Rabbit mAb Cell Signaling Technology Cat# 40435 RRID:AB_2891025 Anti-human/mouse/rat/monkey Vinculin Polyclonal Cell Signaling Technology Cat# 4650 RRID:AB_10559207 Anti-mouse CD16/32 Fc-block TruStain FcX PLUS BioLegend Cat# 156604 RRID: AB_2783137 Anti-mouse Ly6G clone 1A8 BUV395 BD Cat# 563978 RRID: AB_2716852 Anti-mouse CD19 clone 1D3 BUV737 BD Cat# 564296 RRID: AB_2716855 Anti-mouse CD8 clone 53.6–7 BUV800 BD Cat# 564920 RRID: AB_2716856 Anti-mouse MHCII clone M5/114.15.2 BV421 BD Cat# 562564 RRID: AB_2716857 Anti-mouse CD11c clone N418 BV605 BioLegend Cat# 117334 RRID: AB_2562415 Anti-mouse CD4 clone RM4-5 BV650 BD Cat# 563747 RRID: AB_2716859 Anti-mouse/human CD11b clone M1/70 BV711 BD Cat# 563168 RRID: AB_2716860 Anti-mouse CD45 clone 30-F11 BV785 BD Cat# 564225 RRID: AB_2716861 Anti-mouse CD3e clone 145-2C11 BB700 BD Cat# 566494 RRID: AB_2744393 Anti-mouse F4/80 clone BM8 FITC BioLegend Cat# 123107 RRID: AB_893502 Anti-mouse PD-1 clone 29 F.1A12 APC/Cy7 BioLegend Cat# 135223 RRID: AB_2563523 Anti-mouse Ly6C clone HK1.4 APC/Cy7 BioLegend Cat# 128025 RRID: AB_10643867 Anti-mouse NK-1.1 clone PK136 PE/Dazzle BioLegend Cat#108747 RRID: AB_2564218 Anti-mouse CD80, clone 16-10A1, BV650 BD Cat# 563687 RRID: AB_2738376 Anti-mouse CD86 clone GL1, PE BD Cat# 553692 RRID: AB_394994 Anti-mouse Ki-67 clone D3B5 Cell Signaling Technology Cat# 12202 RRID: AB_2737021 (Continued on next page) Cell Reports Medicine 7, 102788, May 19, 2026 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins 10× Tris-Buffered Saline (TBS) Bio-Rad Cat# 1706435 4–15% Mini-PROTEAN® TGXTM Precast Protein Gels, 12-well Bio-Rad Cat# 4561085 Antimicrobial Reagent Invivogen Cat# ant-noc BD Cytofix fixation buffer BD Biosciences Cat# 554655 BD Perm/Wash Buffer BD Biosciences Cat# 554723 Niraparib Selleck Chemicals Cat# S2741 Olaparib Selleck Chemicals Cat# S1060 Rucaparib Selleck Chemicals Cat# S4948 Bovine Serum Albumin FisherScientific Cat# BP1600-100 DAPI (4′,6-Diamidino-2-Phenylindole, Dilactate) Biolegend Cat# 422801 DMEM high glucose (4.5g/L) Thermo Fisher Cat# 11965118 DMSO FisherScientific Cat# BP231-100 DMXAA Invivogen Cat# tlrl-dmx Doxorubicin pfizer 0069-3030-20 5-Fluoro-2′-deoxyuridine 5′-monophosphate sodium salt,∼85% Sigma-Aldrich F3503-5MG Fetal bovine serum albumin Peak Serum Cat# PS-FB1 Fungin Antifungal agent Invivogen Cat# ant-fn-1 Hygromycin B Thermo Fisher Cat# 10687010 Trans-Blot® TurboTM Mini PVDF Transfer Packs Bio-Rad Cat#1704156EDU Opti-MEM Thermofisher Cat# 31985062 Penicillin/streptomycin Thermo Fisher Cat# 15140-122 Pierce BCA Protein assay Thermofisher Cat# 23227 PierceTM RIPA Buffer Thermofisher Cat# 89900 polyethylenimine (PEI) 25kDa Polysciences Cat# 23966-2 Precision Plus ProteinTM Dual Color Standards Bio-Rad Cat# 1610374 Puromycin Thermo Fisher Cat# A1113803 Paclitaxel Alvogen 47781-59307-0 Paclitaxel Teva 0703-3213-01 Paclitaxel Actavis 45963-613-56 Docetaxel Meitheal 71288-144-08 Docetaxel Pfizer 00409-0367-01 Docetaxel Armas Pharmaceuticals 7248-0214-01 Gemcitabine Armas Pharmaceuticals 72485-0221-02 Cisplatin Accord Healthcare 16729-0288-11 Cyclophosphamide Baxter 10019-0955-01 TrypLE Thermo Fisher Cat# 12604021 Tween 20 FisherScientific Cat# BP337-500 Zombie NIR Fixable Viability dye BioLegend Cat# 423105 R-Universal Epitope Recovery Buffer Fisher Scientific Cat# 50-192-6580 EverBriteTM Hardset Mounting Medium Biotium Cat# 23003 Corning Matrigel GFR/LDEV-Free Fisher Scientific Cat# CB-40230 BioReagent N-acetyl-L-cysteine, Powder, ≥99% (TLC), Suitable for cell culture Sigma-Aldrich Cat# A9165-5G Tunicamycin from Streptomyces sp. Millipore Sigma Cat# T7765-1MG M62812 TLR4 inhibitor Fisher Scientific Cat# 570510 GLX481304 NOX2/4i Sigma-Aldrich Cat# SML3192-5MG Cytochalasin B MedChemExpress Cat# HY-16928 (Continued on next page) e3 Cell Reports Medicine 7, 102788, May 19, 2026 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Leptomycin B-1mg Selleck Chemicals Cat# S7580 LPS-EB Ultrapure Invivogen Cat# tlrl-3pelps Polyethylene glycol (PEG) Millipore Sigma Cat# N0632 Ponceau S Staining Solution Thermo Fisher Cat# A40000279 Molecular Probes ProLong Gold Antifade Mountant Thermo Fisher Cat# P36934 5,5′-Dimethyl BAPTA, AM Ester Biotium Cat# 50007 Clarity MaxTM Western ECL Substrate Bio-Rad Cat# 1705062 7-AAD Viability Staining Solution Biolegend Cat# 420403 AMG PERK 44, PERK Inhibitor MedChemExpress Cat# HY-12661 A MKC8866 IRE1a RNase Inhibitor MedChemExpress Cat# HY-104040 Hydrogen Peroxide (30%/500mL) Fisher Scientific Cat# BP2633-500 Critical commercial assays In-Fusion® Snap Assembly Master Mix with Competent Cells TakaraBio Cat# 638951 Nucleospin PCR/Gel purification kit TakaraBio Cat# 740609.5 Nucleospin Plasmid miniprep TakaraBio Cat# 740588.5 PureLink HiPure Plasmid Midiprep kit ThermoFisher Cat# K210004 TaqMan Fast Advanced Master Mix ThermoFisher Scientific Cat# 4444557 TaqManTM Gene Expression Cells-to-CTTM Kit Thermo Fisher Cat# AM1728 CellTiter-Glo 2.0 Assay Promega Cat# G9242 Duolink® In Situ Proximity Ligation Assay Starter Kit, Red, Mouse/Rabbit Sigma-Aldrich Cat# DUO92101-1KT NaveniFlex Cell Red Navinci Cat# NC.MR.100 Red HAT activity, HDAC activity, Histone H3 acetylation detection, H4 acetylation detection Epigentek Cat# Q230428PF2 ER-TrackerTM Blue-White DPX, for live-cell imaging Thermo Fisher Scientific Cat# E12353 ELISA MAXTM Deluxe Set Mouse IFN-β BioLegend Cat# 439404 ROS Assay Kit -Highly Sensitive DCFH-DA Dojindo Cat# R252 Experimental models: Organisms/strains KP1 Kay Hänggi Hanggi et al.53 PyMT-B6 David G. DeNardo Meyer et al.80 MDA-MB-231 Robert J. Gillies ATCC HTB-26 LentiX-293 T Takara Bio Cat# 632180 Experimental Models: Organisms/strains Mouse: C57BL/6 J The Jackson Laboratory RRID: IMSR_JAX:000664 Oligonucleotides Mouse sgRNA targeting sequence: sgNTC13 (GCCGCACCTGTTTAGCAGCA) Kay Hänggi et al.Cancer Cell 2024 Hanggi et al.53 Mouse sgRNA targeting sequence: sgNTC49 (GGACATTACATATAAGACCA) Kay Hänggi et al.Cancer Cell 2024 Hanggi et al.53 Mouse sgRNA targeting sequence: sgMb21d1 (CGGGCCGCAGCTTTCCGCGT) Pulido Á de et al.
|
