bac-arrays igv7 (5878 bacs) (Integragen sa)
90
Structured Review
Integragen sa
bac-arrays igv7 (5878 bacs)
Bac Arrays Igv7 (5878 Bacs), supplied by Integragen sa, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/array+cgh/cgh+array/pm24559140-78-18-12
Average 90 stars, based on 1 article reviews
Bac Arrays Igv7 (5878 Bacs), supplied by Integragen sa, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/array+cgh/cgh+array/pm24559140-78-18-12
Average 90 stars, based on 1 article reviews
bac-arrays igv7 (5878 bacs) - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
other:Article Title: Homozygous FIBP nonsense variant responsible of syndromic overgrowth, with overgrowth, macrocephaly, retinal coloboma and learning disabilities. Article Snippet: The acidic fibroblast growth factor (FGF) intracellular binding protein (FIBP) interacts directly with the fibroblast growth factor FGF1.. Although FIBP is known to be implicated in the FGF signaling pathway, its precise function remains unclear.. Gain-of-function variants in several FGF receptors (FGFRs) are implicated in a wide spectrum of growth disorders from achondroplasia to overgrowth syndromes. Article Title: Strength of molecular cytogenetic analyses for adjusting the diagnosis of renal cell carcinomas with both clear cells and papillary features: a study of three cases. Article Snippet: Histological features are usually sufficient for providing an accurate diagnosis of renal cell carcinomas (RCC).. However, the morphological appearance might sometimes be misleading.. For instance, RCC with papillary areas and extensive clear cell changes may be difficult to classify either as clear cell renal carcinoma or as papillary renal cell carcinoma (pRCC). Article Title: Circulating tumor cells: potential markers of minimal residual disease in ovarian cancer? a study of the OVCAD consortium Article Snippet: Comparative genomic hybridization (CGH) was performed on tumor DNA from 128 ovarian cancer patients, which was analyzed on two generations of Article Title: Impact of chromosomal instability on colorectal cancer progression and outcome. Article Snippet: The 176 DNA samples were analyzed on two generations of Article Title: KIAA1549‐BRAF Fusions and IDH Mutations Can Coexist in Diffuse Gliomas of Adults Article Snippet: LOH values less than or equal to 0.5 indicate the loss of the longer allele in the tumor, whereas LOH values greater than or equal to 1.5 indicate the loss of the shorter allele (4) . (ii) Comparative genomic hybridization (CGH) array based on 4500 sequence‐validated bacterial Sequencing:Article Title: Methylation profiling identifies 2 groups of gliomas according to their tumorigenesis Article Snippet: .. 30 table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Gene Symbol Forward primer sequence Reverse primer sequence Probe sequence MGMT GCGTTTCGACGTTCGTAGGT CACTCTTCCGAAAACGAAACG 6FAM-CGCAAACGATACGCACCGCGA RASSF1 ATTGAGTTGCGGGAGTTGGT ACACGCTCCAACCGAATACG 6FAM-CCCTTCCCAACGCGCCCA-TAMRA RBP1 CGCGTTGGGAATTTAGTTGTC GATACTACGCGAATAATAAACGACCC 6FAM-ACGCCCTCCGAAAACAAAAAACTCTACG Open in a separate window Short list of genes differentially methylated in both LGGs and GBMs in comparison to Article Title: Methylation profiling identifies 2 groups of gliomas according to their tumorigenesis Article Snippet: .. Methylation:Article Title: Methylation profiling identifies 2 groups of gliomas according to their tumorigenesis Article Snippet: .. 30 table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Gene Symbol Forward primer sequence Reverse primer sequence Probe sequence MGMT GCGTTTCGACGTTCGTAGGT CACTCTTCCGAAAACGAAACG 6FAM-CGCAAACGATACGCACCGCGA RASSF1 ATTGAGTTGCGGGAGTTGGT ACACGCTCCAACCGAATACG 6FAM-CCCTTCCCAACGCGCCCA-TAMRA RBP1 CGCGTTGGGAATTTAGTTGTC GATACTACGCGAATAATAAACGACCC 6FAM-ACGCCCTCCGAAAACAAAAAACTCTACG Open in a separate window Short list of genes differentially methylated in both LGGs and GBMs in comparison to Comparison:Article Title: Methylation profiling identifies 2 groups of gliomas according to their tumorigenesis Article Snippet: .. 30 table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Gene Symbol Forward primer sequence Reverse primer sequence Probe sequence MGMT GCGTTTCGACGTTCGTAGGT CACTCTTCCGAAAACGAAACG 6FAM-CGCAAACGATACGCACCGCGA RASSF1 ATTGAGTTGCGGGAGTTGGT ACACGCTCCAACCGAATACG 6FAM-CCCTTCCCAACGCGCCCA-TAMRA RBP1 CGCGTTGGGAATTTAGTTGTC GATACTACGCGAATAATAAACGACCC 6FAM-ACGCCCTCCGAAAACAAAAAACTCTACG Open in a separate window Short list of genes differentially methylated in both LGGs and GBMs in comparison to Gene Expression:Article Title: Methylation profiling identifies 2 groups of gliomas according to their tumorigenesis Article Snippet: .. 30 table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Gene Symbol Forward primer sequence Reverse primer sequence Probe sequence MGMT GCGTTTCGACGTTCGTAGGT CACTCTTCCGAAAACGAAACG 6FAM-CGCAAACGATACGCACCGCGA RASSF1 ATTGAGTTGCGGGAGTTGGT ACACGCTCCAACCGAATACG 6FAM-CCCTTCCCAACGCGCCCA-TAMRA RBP1 CGCGTTGGGAATTTAGTTGTC GATACTACGCGAATAATAAACGACCC 6FAM-ACGCCCTCCGAAAACAAAAAACTCTACG Open in a separate window Short list of genes differentially methylated in both LGGs and GBMs in comparison to |