Review



arabidopsis microarray data series gsm943445  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher arabidopsis microarray data series gsm943445
    Arabidopsis Microarray Data Series Gsm943445, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/arabidopsis+microarray+data/ath-miR167d/pmc07793952-79-17-18
    Average 90 stars, based on 1 article reviews
    arabidopsis microarray data series gsm943445 - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Genome Wide:

    Article Title: A Network-Based Approach for Improving Annotation of Transcription Factor Functions and Binding Sites in Arabidopsis thaliana .
    Article Snippet: .. The dataset contains genome-wide expressions from various treated/control samples collected at different time intervals from various tissue source sites, spanning approximately 7000 Affymetrix ATH1 profiles. ..

    Article Title: Genetic and Genomic Analysis of Rhizoctonia solani Interactions with Arabidopsis; Evidence of Resistance Mediated through NADPH Oxidases
    Article Snippet: .. Given the novelty of the transcriptional regulation occurring in Arabidopsis following R. solani challenge, genome-wide expression analysis using Affymetrix ATH1 chips were performed to elucidate new pathways that may be mediating the high levels of resistance to R. solani AG8 and susceptibility to AG2-1. ..

    other:

    Article Title: Role of microRNA-199a-5p and discoidin domain receptor 1 in human hepatocellular carcinoma invasion
    Article Snippet: The pMIR- DDR1 -3'-UTR construct (200 ng) together with β-gal expression vector pMIR-REPORT β-gal (200 ng) (Ambion) was cotransfected with Pre-miRTM miRNA Precursor Molecules or negative control miRNA precursors (Ambion).

    Article Title: Exploring the putative microRNAs cross-kingdom transfer in Solanum lycopersicum-Meloidogyne incognita interactions.
    Article Snippet: These microRNAs were obtained from Invitrogen™ Custom Primer Service (BMR Genomics, Padova, Italy) and the relative sequences are given: sly-miR166b (5 ’-UCGGACCAGGCUUCAUUCCCC-3 ’ , STAR strand GGAAUGUUGUCUGGCUCGAGG), s ly-miR156a (5 ’- UUGACAGAAGAUAGAGAGCAC-3’, STAR strand GCUCUCUA Frontiers in Plant Science 04 UGCUUCUGUCAU) sly-miR169f (5’-UAGGCGUUGUCUGAG G C U A A C - 3 ’ , S T A R s t r a n d A U C C G U U A C U GAGGAACCGAUAG).

    Article Title: E3 Ubiquitin Ligase SPL2 Is a Lanthanide-Binding Protein
    Article Snippet: Codon-optimized genes encoding SPL2 (At1g54150) from A. thaliana were purchased from Life Technologies, Poland.

    Article Title: A Combination of Microarray-Based Profiling and Biocomputational Analysis Identified miR331-3p and hsa-let-7d-5p as Potential Biomarkers of Ulcerative Colitis Progression to Colorectal Cancer
    Article Snippet: Real-time quantitative PCR was performed on ViiA7TM Real-time PCR by Applied Biosystems using Fast 96-well format function in ViiATM 7 Software. cDNA and amplified product were synthesized with TaqMan ® microRNA Assay INV SM10 ath-miR159a by Thermo Fisher (CA, USA).

    Expressing:

    Article Title: Genetic and Genomic Analysis of Rhizoctonia solani Interactions with Arabidopsis; Evidence of Resistance Mediated through NADPH Oxidases
    Article Snippet: .. Given the novelty of the transcriptional regulation occurring in Arabidopsis following R. solani challenge, genome-wide expression analysis using Affymetrix ATH1 chips were performed to elucidate new pathways that may be mediating the high levels of resistance to R. solani AG8 and susceptibility to AG2-1. ..



    Similar Products

    86
    TaKaRa arabidopsis dna microarray data
    The tools and databases available at KOMICS (as of November 2013).
    Arabidopsis Dna Microarray Data, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/arabidopsis+microarray+data/pmc04052814-22-7-13
    Average 86 stars, based on 1 article reviews
    arabidopsis dna microarray data - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    86
    Biotechnology Information data arabidopsis microarray
    The tools and databases available at KOMICS (as of November 2013).
    Data Arabidopsis Microarray, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/arabidopsis+microarray+data/data+microarray/10__1094_slash_mpmi___12___25___0165___r-242-5-23
    Average 86 stars, based on 1 article reviews
    data arabidopsis microarray - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    90
    Thermo Fisher arabidopsis microarray expression profile data
    Preferential correlation changes between gene pairs . RSPR-NR was applied to the <t>Arabidopsis</t> expression profile data set. The cosine correlations between each of 80,000 randomly sampled gene pairs before and after RSPR-NR were recorded. The angle corresponding to each cosine correlation value was used in the plots. (A) The angle change from before RSPR-NR to after RSPR-NR is plotted along the angle before RSPR-NR, for the sampled gene pairs. A loess fit curve for the distribution is shown in gray. (B) From (A), the loess fit curve values were made zero (gray line) to normalize the distribution in small ranges of the angle before. The angle change value after this loess-based normalization is called the relative angle change value. This relative-angle-change-vs.-angle-before plot is used in (C) and (D). (C) The gene pairs that share GO process and component terms (Jaccard similarity = 0.5) are plotted. (D) The gene pairs that do not share any GO process and component terms and that have more than 5 GO terms in union among the sampled gene pairs are plotted. In both (C) and (D), the gene pairs with low correlation before RSPR-NR (an angle range between 0.3π and 0.7π) are excluded. The parameters used for RSPR-NR were a subset row number of 200, a repeat number of 20, and an FDR of 0.0316. The dot sizes in the plots were adjusted according to the density of dots in each plot.
    Arabidopsis Microarray Expression Profile Data, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/arabidopsis+microarray+data/pmc02607290-28-5-6
    Average 90 stars, based on 1 article reviews
    arabidopsis microarray expression profile data - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher arabidopsis rice microarray data
    Nomenclature for MAPKs and MAPKKs in <t> Arabidopsis </t> , Brachypodium and Oryza.
    Arabidopsis Rice Microarray Data, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/arabidopsis+microarray+data/pmc03474763-117-1-0
    Average 90 stars, based on 1 article reviews
    arabidopsis rice microarray data - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher arabidopsis thaliana microarray data
    Selected fields of the metadata of the samples of series E-ATMX-31
    Arabidopsis Thaliana Microarray Data, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/arabidopsis+microarray+data/pmc08885756-80-13-15
    Average 90 stars, based on 1 article reviews
    arabidopsis thaliana microarray data - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher arabidopsis microarray data series gsm943445
    Selected fields of the metadata of the samples of series E-ATMX-31
    Arabidopsis Microarray Data Series Gsm943445, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/arabidopsis+microarray+data/ath-miR167d/pmc07793952-79-17-18
    Average 90 stars, based on 1 article reviews
    arabidopsis microarray data series gsm943445 - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Schmid GmbH arabidopsis microarray data
    Selected fields of the metadata of the samples of series E-ATMX-31
    Arabidopsis Microarray Data, supplied by Schmid GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/arabidopsis+microarray+data/arabidopsis+gene+expression+dataset/pm28956163-69-0-40
    Average 90 stars, based on 1 article reviews
    arabidopsis microarray data - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher arabidopsis microarray data series gse6696
    Selected fields of the metadata of the samples of series E-ATMX-31
    Arabidopsis Microarray Data Series Gse6696, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/arabidopsis+microarray+data/pmc05913055-270-12-13
    Average 90 stars, based on 1 article reviews
    arabidopsis microarray data series gse6696 - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Biotechnology Information microarray data for arabidopsis tissues
    Selected fields of the metadata of the samples of series E-ATMX-31
    Microarray Data For Arabidopsis Tissues, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/arabidopsis+microarray+data/microarray+data+for+arabidopsis+tissues/pmc04246260-188-32-40
    Average 90 stars, based on 1 article reviews
    microarray data for arabidopsis tissues - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher arabidopsis microarray data
    Selected fields of the metadata of the samples of series E-ATMX-31
    Arabidopsis Microarray Data, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/arabidopsis+microarray+data/pmc03887838-63-0-1
    Average 90 stars, based on 1 article reviews
    arabidopsis microarray data - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results


    The tools and databases available at KOMICS (as of November 2013).

    Journal: BioMed Research International

    Article Title: Tools and Databases of the KOMICS Web Portal for Preprocessing, Mining, and Dissemination of Metabolomics Data

    doi: 10.1155/2014/194812

    Figure Lengend Snippet: The tools and databases available at KOMICS (as of November 2013).

    Article Snippet: ARTRA , Database of probe information of Arabidopsis DNA microarray data (developed by Takara Bio Inc.). , http://artra.kazusa.or.jp/artra/ARI3_101/ , [ ] .

    Techniques: Transgenic Assay, Microarray

    Preferential correlation changes between gene pairs . RSPR-NR was applied to the Arabidopsis expression profile data set. The cosine correlations between each of 80,000 randomly sampled gene pairs before and after RSPR-NR were recorded. The angle corresponding to each cosine correlation value was used in the plots. (A) The angle change from before RSPR-NR to after RSPR-NR is plotted along the angle before RSPR-NR, for the sampled gene pairs. A loess fit curve for the distribution is shown in gray. (B) From (A), the loess fit curve values were made zero (gray line) to normalize the distribution in small ranges of the angle before. The angle change value after this loess-based normalization is called the relative angle change value. This relative-angle-change-vs.-angle-before plot is used in (C) and (D). (C) The gene pairs that share GO process and component terms (Jaccard similarity = 0.5) are plotted. (D) The gene pairs that do not share any GO process and component terms and that have more than 5 GO terms in union among the sampled gene pairs are plotted. In both (C) and (D), the gene pairs with low correlation before RSPR-NR (an angle range between 0.3π and 0.7π) are excluded. The parameters used for RSPR-NR were a subset row number of 200, a repeat number of 20, and an FDR of 0.0316. The dot sizes in the plots were adjusted according to the density of dots in each plot.

    Journal: BMC Bioinformatics

    Article Title: Unsupervised reduction of random noise in complex data by a row-specific, sorted principal component-guided method

    doi: 10.1186/1471-2105-9-508

    Figure Lengend Snippet: Preferential correlation changes between gene pairs . RSPR-NR was applied to the Arabidopsis expression profile data set. The cosine correlations between each of 80,000 randomly sampled gene pairs before and after RSPR-NR were recorded. The angle corresponding to each cosine correlation value was used in the plots. (A) The angle change from before RSPR-NR to after RSPR-NR is plotted along the angle before RSPR-NR, for the sampled gene pairs. A loess fit curve for the distribution is shown in gray. (B) From (A), the loess fit curve values were made zero (gray line) to normalize the distribution in small ranges of the angle before. The angle change value after this loess-based normalization is called the relative angle change value. This relative-angle-change-vs.-angle-before plot is used in (C) and (D). (C) The gene pairs that share GO process and component terms (Jaccard similarity = 0.5) are plotted. (D) The gene pairs that do not share any GO process and component terms and that have more than 5 GO terms in union among the sampled gene pairs are plotted. In both (C) and (D), the gene pairs with low correlation before RSPR-NR (an angle range between 0.3π and 0.7π) are excluded. The parameters used for RSPR-NR were a subset row number of 200, a repeat number of 20, and an FDR of 0.0316. The dot sizes in the plots were adjusted according to the density of dots in each plot.

    Article Snippet: We applied the method to Arabidopsis Affymetrix microarray expression profile data collected in multiple experiments.

    Techniques: Expressing

    Variance associated with each PC in PCA with the Arabidopsis expression profile data set . (A) The variance associated with each PC (PC1 to PC60) is plotted. (B) A close up view of (A) in the range starting with PC4.

    Journal: BMC Bioinformatics

    Article Title: Unsupervised reduction of random noise in complex data by a row-specific, sorted principal component-guided method

    doi: 10.1186/1471-2105-9-508

    Figure Lengend Snippet: Variance associated with each PC in PCA with the Arabidopsis expression profile data set . (A) The variance associated with each PC (PC1 to PC60) is plotted. (B) A close up view of (A) in the range starting with PC4.

    Article Snippet: We applied the method to Arabidopsis Affymetrix microarray expression profile data collected in multiple experiments.

    Techniques: Expressing

    Nomenclature for MAPKs and MAPKKs in  Arabidopsis  , Brachypodium and Oryza.

    Journal: PLoS ONE

    Article Title: Genome-Wide Identification and Analysis of MAPK and MAPKK Gene Families in Brachypodium distachyon

    doi: 10.1371/journal.pone.0046744

    Figure Lengend Snippet: Nomenclature for MAPKs and MAPKKs in Arabidopsis , Brachypodium and Oryza.

    Article Snippet: Affymetrix Arabidopsis and rice microarray data were downloaded from ArrayExpress , PLEXdb and Rice Oligonucleotide Databases .

    Techniques:

    (a) Phylogenetic relationships of B. distachyon , Arabidopsis and rice MAPK genes. The phylogenetic tree was constructed by NJ (Neighbor-joining) method using the MEGA 4 program. Different color patternings indicate different gene clusters or superclusters. (b) Comparison of CD domain among four BdMAPKs (c) Schematic diagram of amino acid motifs of B. distachyon MAPKs from different groups. Motif analysis was performed using MEME 4.0 software as described in the methods. The black solid line represents the corresponding BdMAPK and its length. The different-colored boxes represent different motifs and their position in each BdMAPK sequence. A detailed motif introduction for all the B. distachyon MAPKs is shown in .

    Journal: PLoS ONE

    Article Title: Genome-Wide Identification and Analysis of MAPK and MAPKK Gene Families in Brachypodium distachyon

    doi: 10.1371/journal.pone.0046744

    Figure Lengend Snippet: (a) Phylogenetic relationships of B. distachyon , Arabidopsis and rice MAPK genes. The phylogenetic tree was constructed by NJ (Neighbor-joining) method using the MEGA 4 program. Different color patternings indicate different gene clusters or superclusters. (b) Comparison of CD domain among four BdMAPKs (c) Schematic diagram of amino acid motifs of B. distachyon MAPKs from different groups. Motif analysis was performed using MEME 4.0 software as described in the methods. The black solid line represents the corresponding BdMAPK and its length. The different-colored boxes represent different motifs and their position in each BdMAPK sequence. A detailed motif introduction for all the B. distachyon MAPKs is shown in .

    Article Snippet: Affymetrix Arabidopsis and rice microarray data were downloaded from ArrayExpress , PLEXdb and Rice Oligonucleotide Databases .

    Techniques: Construct, Software, Sequencing

    (a) Phylogenetic relationships of B. distachyon , Arabidopsis and rice MAPKK genes. The phylogenetic tree was constructed by NJ (Neighbor–joining) method using the MEGA 4 program. Different color patternings indicate different gene clusters or superclusters. (b) Schematic diagram of amino acid motifs of B. distachyon MAPKKs. The black solid line represents the corresponding BdMAPKK and its length. The different-colored boxes represent different motifs and their position in each BdMAPKK sequence.

    Journal: PLoS ONE

    Article Title: Genome-Wide Identification and Analysis of MAPK and MAPKK Gene Families in Brachypodium distachyon

    doi: 10.1371/journal.pone.0046744

    Figure Lengend Snippet: (a) Phylogenetic relationships of B. distachyon , Arabidopsis and rice MAPKK genes. The phylogenetic tree was constructed by NJ (Neighbor–joining) method using the MEGA 4 program. Different color patternings indicate different gene clusters or superclusters. (b) Schematic diagram of amino acid motifs of B. distachyon MAPKKs. The black solid line represents the corresponding BdMAPKK and its length. The different-colored boxes represent different motifs and their position in each BdMAPKK sequence.

    Article Snippet: Affymetrix Arabidopsis and rice microarray data were downloaded from ArrayExpress , PLEXdb and Rice Oligonucleotide Databases .

    Techniques: Construct, Sequencing

    To identify the species of origin for each chromosome, a species acronym is included before the chromosome name: At, Arabidopsis thaliana ; Os, Oryza sativa ; Bd, B.distachyon . Different color bars connect syntenic regions between B. distachyon and the other two plant species of Arabidopsis and rice chromosomes. The region of B. distachyon tightly linked cluster likely to be syntenic with that of the rice tightly linked cluster by translocation, insertion or other events was indicated with the ellipse in the same color.

    Journal: PLoS ONE

    Article Title: Genome-Wide Identification and Analysis of MAPK and MAPKK Gene Families in Brachypodium distachyon

    doi: 10.1371/journal.pone.0046744

    Figure Lengend Snippet: To identify the species of origin for each chromosome, a species acronym is included before the chromosome name: At, Arabidopsis thaliana ; Os, Oryza sativa ; Bd, B.distachyon . Different color bars connect syntenic regions between B. distachyon and the other two plant species of Arabidopsis and rice chromosomes. The region of B. distachyon tightly linked cluster likely to be syntenic with that of the rice tightly linked cluster by translocation, insertion or other events was indicated with the ellipse in the same color.

    Article Snippet: Affymetrix Arabidopsis and rice microarray data were downloaded from ArrayExpress , PLEXdb and Rice Oligonucleotide Databases .

    Techniques: Translocation Assay

    Selected fields of the metadata of the samples of series E-ATMX-31

    Journal: STAR Protocols

    Article Title: Gene coexpression analysis in Arabidopsis thaliana based on public microarray data

    doi: 10.1016/j.xpro.2022.101208

    Figure Lengend Snippet: Selected fields of the metadata of the samples of series E-ATMX-31

    Article Snippet: The protocol below describes the specific steps for performing gene coexpression analysis on Arabidopsis thaliana Affymetrix microarray data.

    Techniques: Cell Culture

    Selected fields of the metadata of the samples of series E-ATMX-20

    Journal: STAR Protocols

    Article Title: Gene coexpression analysis in Arabidopsis thaliana based on public microarray data

    doi: 10.1016/j.xpro.2022.101208

    Figure Lengend Snippet: Selected fields of the metadata of the samples of series E-ATMX-20

    Article Snippet: The protocol below describes the specific steps for performing gene coexpression analysis on Arabidopsis thaliana Affymetrix microarray data.

    Techniques:

    Selected fields of the metadata of the samples of series E-GEOD-50526

    Journal: STAR Protocols

    Article Title: Gene coexpression analysis in Arabidopsis thaliana based on public microarray data

    doi: 10.1016/j.xpro.2022.101208

    Figure Lengend Snippet: Selected fields of the metadata of the samples of series E-GEOD-50526

    Article Snippet: The protocol below describes the specific steps for performing gene coexpression analysis on Arabidopsis thaliana Affymetrix microarray data.

    Techniques:

    Arabidopsis thaliana gene coexpression trees as viewed by Dendroscope (A and B) Node labels are the AGI codes of the Arabidopsis thaliana genes. (A) Coexpression tree containing all Arabidopsis thaliana genes. The leaves highlighted in red denote the region where CTL2 ( AT3G16920 ) coexpression subtree is located (B) Gene coexpression subtree containing CTL2 and its coexpressed genes.

    Journal: STAR Protocols

    Article Title: Gene coexpression analysis in Arabidopsis thaliana based on public microarray data

    doi: 10.1016/j.xpro.2022.101208

    Figure Lengend Snippet: Arabidopsis thaliana gene coexpression trees as viewed by Dendroscope (A and B) Node labels are the AGI codes of the Arabidopsis thaliana genes. (A) Coexpression tree containing all Arabidopsis thaliana genes. The leaves highlighted in red denote the region where CTL2 ( AT3G16920 ) coexpression subtree is located (B) Gene coexpression subtree containing CTL2 and its coexpressed genes.

    Article Snippet: The protocol below describes the specific steps for performing gene coexpression analysis on Arabidopsis thaliana Affymetrix microarray data.

    Techniques:

    Journal: STAR Protocols

    Article Title: Gene coexpression analysis in Arabidopsis thaliana based on public microarray data

    doi: 10.1016/j.xpro.2022.101208

    Figure Lengend Snippet:

    Article Snippet: The protocol below describes the specific steps for performing gene coexpression analysis on Arabidopsis thaliana Affymetrix microarray data.

    Techniques: Microarray, Software, Western Blot