Review



5×promega mmlv reverse transcriptase buffer  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Promega 5×promega mmlv reverse transcriptase buffer
    5×Promega Mmlv Reverse Transcriptase Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/5%C3%97promega+mmlv+reverse+transcriptase+buffer/us11280028-111-51-77
    Average 90 stars, based on 1 article reviews
    5×promega mmlv reverse transcriptase buffer - by Bioz Stars, 2026-11
    90/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Unbiased and simultaneous amplification method for preparing a double-stranded DNA library from a sample of more than one type of nucleic acid
    Article Snippet: .. To identify potential background amplification, 0.4 μl of 5 μM of any one of N6 (CAGACTACCATGACCTGAGTC) (SEQ ID NO: 10), B6 (CAGACTACCATGACCTGAGTCBBBBBB) (SEQ ID NO: 1), D6 (CAGACTACCATGACCTGAGTCDDDDDD) (SEQ ID NO: 11) or H6 (CAGACTACCATGACCTGAGTCHHHHHH) (SEQ ID NO: 12) was mixed with 0.2 μl of 25 mM dNTPs, 1.0 μl of 5×PROMEGA MMLV reverse transcriptase buffer and 3.1 μl of water, heated to 70° C. for 30 seconds and cooled to 4° C. Then 0.5 μl of PROMEGA MMLV reverse transcriptase was added and the reactions incubated at 40° C. for 15 minutes, followed by 70° C. for 5 minutes. .. 1.5 μl NEB Isothermal Buffer, 0.75 μl 25 mM MgSO4, 1.5 μl 2 mM dNTP, 0.5 μl Bst3.0, 4.8 μl water and 1.0 μl of N8 (GTCAGAGTCGAATGCGTACTG) (SEQ ID NO: 13), B8 (GTCAGAGTCGAATGCGTACTGBBBBBBBB) (SEQ ID NO: 3), D8 (GTCAGAGTCGAATGCGTACTGDDDDDDDD) (SEQ ID NO: 14) or H6 (GTCAGAGTCGAATGCGTACTGHHHHHHHH) (SEQ ID NO: 15) was added to the respective sample tubes as described above.

    Reverse Transcription:

    Article Title: Unbiased and simultaneous amplification method for preparing a double-stranded DNA library from a sample of more than one type of nucleic acid
    Article Snippet: .. To identify potential background amplification, 0.4 μl of 5 μM of any one of N6 (CAGACTACCATGACCTGAGTC) (SEQ ID NO: 10), B6 (CAGACTACCATGACCTGAGTCBBBBBB) (SEQ ID NO: 1), D6 (CAGACTACCATGACCTGAGTCDDDDDD) (SEQ ID NO: 11) or H6 (CAGACTACCATGACCTGAGTCHHHHHH) (SEQ ID NO: 12) was mixed with 0.2 μl of 25 mM dNTPs, 1.0 μl of 5×PROMEGA MMLV reverse transcriptase buffer and 3.1 μl of water, heated to 70° C. for 30 seconds and cooled to 4° C. Then 0.5 μl of PROMEGA MMLV reverse transcriptase was added and the reactions incubated at 40° C. for 15 minutes, followed by 70° C. for 5 minutes. .. 1.5 μl NEB Isothermal Buffer, 0.75 μl 25 mM MgSO4, 1.5 μl 2 mM dNTP, 0.5 μl Bst3.0, 4.8 μl water and 1.0 μl of N8 (GTCAGAGTCGAATGCGTACTG) (SEQ ID NO: 13), B8 (GTCAGAGTCGAATGCGTACTGBBBBBBBB) (SEQ ID NO: 3), D8 (GTCAGAGTCGAATGCGTACTGDDDDDDDD) (SEQ ID NO: 14) or H6 (GTCAGAGTCGAATGCGTACTGHHHHHHHH) (SEQ ID NO: 15) was added to the respective sample tubes as described above.

    Incubation:

    Article Title: Unbiased and simultaneous amplification method for preparing a double-stranded DNA library from a sample of more than one type of nucleic acid
    Article Snippet: .. To identify potential background amplification, 0.4 μl of 5 μM of any one of N6 (CAGACTACCATGACCTGAGTC) (SEQ ID NO: 10), B6 (CAGACTACCATGACCTGAGTCBBBBBB) (SEQ ID NO: 1), D6 (CAGACTACCATGACCTGAGTCDDDDDD) (SEQ ID NO: 11) or H6 (CAGACTACCATGACCTGAGTCHHHHHH) (SEQ ID NO: 12) was mixed with 0.2 μl of 25 mM dNTPs, 1.0 μl of 5×PROMEGA MMLV reverse transcriptase buffer and 3.1 μl of water, heated to 70° C. for 30 seconds and cooled to 4° C. Then 0.5 μl of PROMEGA MMLV reverse transcriptase was added and the reactions incubated at 40° C. for 15 minutes, followed by 70° C. for 5 minutes. .. 1.5 μl NEB Isothermal Buffer, 0.75 μl 25 mM MgSO4, 1.5 μl 2 mM dNTP, 0.5 μl Bst3.0, 4.8 μl water and 1.0 μl of N8 (GTCAGAGTCGAATGCGTACTG) (SEQ ID NO: 13), B8 (GTCAGAGTCGAATGCGTACTGBBBBBBBB) (SEQ ID NO: 3), D8 (GTCAGAGTCGAATGCGTACTGDDDDDDDD) (SEQ ID NO: 14) or H6 (GTCAGAGTCGAATGCGTACTGHHHHHHHH) (SEQ ID NO: 15) was added to the respective sample tubes as described above.



    Similar Products

    5×neb reverse transcription buffer  (New England Biolabs)
    98
    New England Biolabs 5×neb reverse transcription buffer
    5×Neb Reverse Transcription Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/ProtoScript+II+Reverse+Transcriptase/us12467102-259-22-28
    Average 98 stars, based on 1 article reviews
    5×neb reverse transcription buffer - by Bioz Stars, 2026-11
    98/100 stars
    		  Buy from Supplier
    5 × hifair® iii reverse transcriptase buffer 15662es  (Yeasen Biotechnology)
    90
    Yeasen Biotechnology 5 × hifair® iii reverse transcriptase buffer 15662es
    5 × Hifair® Iii Reverse Transcriptase Buffer 15662es, supplied by Yeasen Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/primescript+reagent+kit+15662es/pmc12059478-57-8-14
    Average 90 stars, based on 1 article reviews
    5 × hifair® iii reverse transcriptase buffer 15662es - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    maxima h minus reverse transcriptase (200u/μl) with 5×rt buffer  (Thermo Fisher)
    90
    Thermo Fisher maxima h minus reverse transcriptase (200u/μl) with 5×rt buffer

    Maxima H Minus Reverse Transcriptase (200u/μl) With 5×Rt Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/maxima+h+minus+reverse+transcriptase/pmc11539149-15-7-10
    Average 90 stars, based on 1 article reviews
    maxima h minus reverse transcriptase (200u/μl) with 5×rt buffer - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    5 × m‐mlv reverse transcriptase buffer  (Promega)
    90
    Promega 5 × m‐mlv reverse transcriptase buffer

    5 × M‐Mlv Reverse Transcriptase Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/mgcl2/pmc11193114-93-10-14
    Average 90 stars, based on 1 article reviews
    5 × m‐mlv reverse transcriptase buffer - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    reverse transcriptase 5 × reaction buffer  (Promega)
    90
    Promega reverse transcriptase 5 × reaction buffer

    Reverse Transcriptase 5 × Reaction Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/reverse+transcriptase+5+%C3%97+reaction+buffer/pmc11288740-112-39-45
    Average 90 stars, based on 1 article reviews
    reverse transcriptase 5 × reaction buffer - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    5×hifair®cultra reverse transcriptase reaction buffer  (Yeasen Biotechnology)
    90
    Yeasen Biotechnology 5×hifair®cultra reverse transcriptase reaction buffer

    5×Hifair®Cultra Reverse Transcriptase Reaction Buffer, supplied by Yeasen Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/5%C3%97hifair+cultra+reverse+transcriptase+reaction+buffer/ppr0762890-54-33-40
    Average 90 stars, based on 1 article reviews
    5×hifair®cultra reverse transcriptase reaction buffer - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    8 µl of 5× maxima h minus reverse transcriptase buffer  (Thermo Fisher)
    90
    Thermo Fisher 8 µl of 5× maxima h minus reverse transcriptase buffer

    8 µl Of 5× Maxima H Minus Reverse Transcriptase Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/pm37024678-308-25-40
    Average 90 stars, based on 1 article reviews
    8 µl of 5× maxima h minus reverse transcriptase buffer - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    smartscribe 5× first strand buffer  (TaKaRa)
    96
    TaKaRa smartscribe 5× first strand buffer

    Smartscribe 5× First Strand Buffer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/SMARTScribe+Reverse+Transcriptase/pmc09901934-194-8-12
    Average 96 stars, based on 1 article reviews
    smartscribe 5× first strand buffer - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    smartscribe 5×first strand buffer  (TaKaRa)
    96
    TaKaRa smartscribe 5×first strand buffer

    Smartscribe 5×First Strand Buffer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/SMARTScribe+Reverse+Transcriptase/pmc08692905-40-67-70
    Average 96 stars, based on 1 article reviews
    smartscribe 5×first strand buffer - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    mumlv-rt reverse transcriptase 5× buffer  (Promega)
    90
    Promega mumlv-rt reverse transcriptase 5× buffer

    Mumlv Rt Reverse Transcriptase 5× Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/reverse+transcriptase+enzyme/pmc02453129-358-53-27
    Average 90 stars, based on 1 article reviews
    mumlv-rt reverse transcriptase 5× buffer - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: iScience

    Article Title: Time course transcriptomic profiling suggests Crp/Fnr transcriptional regulation of nosZ gene in a N 2 O-reducing thermophile

    doi: 10.1016/j.isci.2024.111074

    Figure Lengend Snippet:

    Article Snippet: Maxima H Minus Reverse Transcriptase (200U/μL) with 5×RT Buffer , ThermoFisher , Cat# EP0751.

    Techniques: Virus, Recombinant, Reverse Transcription, Isolation, Control, Sequencing, Mass Spectrometry, Software, In Silico, Targeted Proteomics