Review



12k oligonucleotide microarrays  (CustomArray Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    CustomArray Inc 12k oligonucleotide microarrays
    12k Oligonucleotide Microarrays, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12k+cdna+microarray/microarray+surfaces/pmc03627568-144-1-14
    Average 90 stars, based on 1 article reviews
    12k oligonucleotide microarrays - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Synthesized:

    Article Title: Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof
    Article Snippet: Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. A third round of PCR was performed to incorporate overhangs compatible for Gibson Assembly (NEB) into the lentiviral sgRNA AAVS1-targeting vector between the XbaI and NdeI sites.

    Amplification:

    Article Title: Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof
    Article Snippet: Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. A third round of PCR was performed to incorporate overhangs compatible for Gibson Assembly (NEB) into the lentiviral sgRNA AAVS1-targeting vector between the XbaI and NdeI sites.

    Nested PCR:

    Article Title: Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof
    Article Snippet: Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. A third round of PCR was performed to incorporate overhangs compatible for Gibson Assembly (NEB) into the lentiviral sgRNA AAVS1-targeting vector between the XbaI and NdeI sites.

    other:

    Article Title: Development of DNA Microarray for Parallel Detection of Community-Acquired Pneumonia Bacterial Pathogens
    Article Snippet: In the research we used CustomArray microarrays (USA).


    Article Title: CRISPR screens identify cholesterol biosynthesis as a therapeutic target on stemness and drug resistance of colon cancer
    Article Snippet: Pooled Epi-Drug sgRNA library was designed using CRISPR-DO tool by He lab and synthesized as 73-mer oligonucleotides (CustomArray, NJ, USA), amplified by PCR and then cloned into lentiGuide-puro plasmid (a gift form Feng Zhang, Addgene 52963).

    Article Title: Nuclear Control of Mitochondrial Homeostasis and Venetoclax Efficacy in AML via COX4I1.
    Article Snippet: CRISPR and cDNA Molecular Cloning: Guide RNA oligonucleotides were synthesized either via microarray (CustomArray) for library cloning or individually (Integrated DNA Technologies) for single sgRNA constructs.

    Article Title: CRISPRi screens reveal a DNA methylation-mediated 3D genome dependent causal mechanism in prostate cancer
    Article Snippet: sgRNAs were synthesized as 73-mer oligonucleotides (CustomArray, USA), GAAAGGACGAAACACCGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATA GCAAGTTAAAATAAGGC (N’s denote the sgRNA 19–20 nucleotide target sequence) and amplified by PCR as a pool using the following primers: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG (Forward) and ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (Reverse).

    Microarray:

    Article Title: Serially deposited biomolecules
    Article Snippet: .. The 12K CUSTOMARRAY® microarray is commercially available as a custom gene chip that has been used for a variety of genomic assays (e.g., genotyping, gene expression, SNP analysis, etc.). .. CombiMatrix also developed the ELECTRASENSE® microarray and microarray reader based on ECD.

    Gene Expression:

    Article Title: Serially deposited biomolecules
    Article Snippet: .. The 12K CUSTOMARRAY® microarray is commercially available as a custom gene chip that has been used for a variety of genomic assays (e.g., genotyping, gene expression, SNP analysis, etc.). .. CombiMatrix also developed the ELECTRASENSE® microarray and microarray reader based on ECD.



    Similar Products

    12k cdna microarray  (CapitalBio Corporation)
    90
    CapitalBio Corporation 12k cdna microarray
    Hierarchical clustering of DEGs in leaves and roots of transgenic cotton T-34 compared with wild-type Z35 in the <t>microarray</t> analysis. Each column represents a single biological replicate and each row represents a differentially expressed probe set. L1, L2, and L3 represent biological replicates from leaves and R1, R2, and R3 represent biological replicates from roots. S/S represented self-to-self of Z35. The signal ratios were shown in a red–green colour scale, where red indicated up-regulation and green indicated down-regulation.
    12k Cdna Microarray, supplied by CapitalBio Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12k+cdna+microarray/cdna+microarray+analysis/pmc02955741-150-1-7
    Average 90 stars, based on 1 article reviews
    12k cdna microarray - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    12k cdna microarray  (Unigene)
    90
    Unigene 12k cdna microarray
    Hierarchical clustering of DEGs in leaves and roots of transgenic cotton T-34 compared with wild-type Z35 in the <t>microarray</t> analysis. Each column represents a single biological replicate and each row represents a differentially expressed probe set. L1, L2, and L3 represent biological replicates from leaves and R1, R2, and R3 represent biological replicates from roots. S/S represented self-to-self of Z35. The signal ratios were shown in a red–green colour scale, where red indicated up-regulation and green indicated down-regulation.
    12k Cdna Microarray, supplied by Unigene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12k+cdna+microarray/12k+cdna+microarray/pmc02955741-239-8-3
    Average 90 stars, based on 1 article reviews
    12k cdna microarray - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Hierarchical clustering of DEGs in leaves and roots of transgenic cotton T-34 compared with wild-type Z35 in the microarray analysis. Each column represents a single biological replicate and each row represents a differentially expressed probe set. L1, L2, and L3 represent biological replicates from leaves and R1, R2, and R3 represent biological replicates from roots. S/S represented self-to-self of Z35. The signal ratios were shown in a red–green colour scale, where red indicated up-regulation and green indicated down-regulation.

    Journal: Journal of Experimental Botany

    Article Title: Transcriptome analysis of Hpa1 Xoo transformed cotton revealed constitutive expression of genes in multiple signalling pathways related to disease resistance

    doi: 10.1093/jxb/erq227

    Figure Lengend Snippet: Hierarchical clustering of DEGs in leaves and roots of transgenic cotton T-34 compared with wild-type Z35 in the microarray analysis. Each column represents a single biological replicate and each row represents a differentially expressed probe set. L1, L2, and L3 represent biological replicates from leaves and R1, R2, and R3 represent biological replicates from roots. S/S represented self-to-self of Z35. The signal ratios were shown in a red–green colour scale, where red indicated up-regulation and green indicated down-regulation.

    Article Snippet: The 12k cDNA microarray was conduced at CapitalBio Corp. (Beijing, China) using the method described by Shi et al. (2006) .

    Techniques: Transgenic Assay, Microarray

    Correlation coefficients of microarray hybridization with total RNA from leaves of transgenic cotton T-34 and wild-type Z35

    Journal: Journal of Experimental Botany

    Article Title: Transcriptome analysis of Hpa1 Xoo transformed cotton revealed constitutive expression of genes in multiple signalling pathways related to disease resistance

    doi: 10.1093/jxb/erq227

    Figure Lengend Snippet: Correlation coefficients of microarray hybridization with total RNA from leaves of transgenic cotton T-34 and wild-type Z35

    Article Snippet: The 12k cDNA microarray was conduced at CapitalBio Corp. (Beijing, China) using the method described by Shi et al. (2006) .

    Techniques: Microarray, Hybridization, Transgenic Assay

    The functional annotation of 530 DEGs in leaves of transgenic T-34 identified in the microarray analysis ( P <0.001).

    Journal: Journal of Experimental Botany

    Article Title: Transcriptome analysis of Hpa1 Xoo transformed cotton revealed constitutive expression of genes in multiple signalling pathways related to disease resistance

    doi: 10.1093/jxb/erq227

    Figure Lengend Snippet: The functional annotation of 530 DEGs in leaves of transgenic T-34 identified in the microarray analysis ( P <0.001).

    Article Snippet: The 12k cDNA microarray was conduced at CapitalBio Corp. (Beijing, China) using the method described by Shi et al. (2006) .

    Techniques: Functional Assay, Transgenic Assay, Microarray

    Hierarchical clustering of DEGs in leaves and roots of transgenic cotton T-34 compared with wild-type Z35 in the microarray analysis. Each column represents a single biological replicate and each row represents a differentially expressed probe set. L1, L2, and L3 represent biological replicates from leaves and R1, R2, and R3 represent biological replicates from roots. S/S represented self-to-self of Z35. The signal ratios were shown in a red–green colour scale, where red indicated up-regulation and green indicated down-regulation.

    Journal: Journal of Experimental Botany

    Article Title: Transcriptome analysis of Hpa1 Xoo transformed cotton revealed constitutive expression of genes in multiple signalling pathways related to disease resistance

    doi: 10.1093/jxb/erq227

    Figure Lengend Snippet: Hierarchical clustering of DEGs in leaves and roots of transgenic cotton T-34 compared with wild-type Z35 in the microarray analysis. Each column represents a single biological replicate and each row represents a differentially expressed probe set. L1, L2, and L3 represent biological replicates from leaves and R1, R2, and R3 represent biological replicates from roots. S/S represented self-to-self of Z35. The signal ratios were shown in a red–green colour scale, where red indicated up-regulation and green indicated down-regulation.

    Article Snippet: Among 11 236 unigene ESTs included in the 12k cDNA microarray, 4.7% and 0.57% of ESTs were differentially expressed in leaves and roots of transgenic T-34, respectively.

    Techniques: Transgenic Assay, Microarray

    Correlation coefficients of microarray hybridization with total RNA from leaves of transgenic cotton T-34 and wild-type Z35

    Journal: Journal of Experimental Botany

    Article Title: Transcriptome analysis of Hpa1 Xoo transformed cotton revealed constitutive expression of genes in multiple signalling pathways related to disease resistance

    doi: 10.1093/jxb/erq227

    Figure Lengend Snippet: Correlation coefficients of microarray hybridization with total RNA from leaves of transgenic cotton T-34 and wild-type Z35

    Article Snippet: Among 11 236 unigene ESTs included in the 12k cDNA microarray, 4.7% and 0.57% of ESTs were differentially expressed in leaves and roots of transgenic T-34, respectively.

    Techniques: Microarray, Hybridization, Transgenic Assay

    The functional annotation of 530 DEGs in leaves of transgenic T-34 identified in the microarray analysis ( P <0.001).

    Journal: Journal of Experimental Botany

    Article Title: Transcriptome analysis of Hpa1 Xoo transformed cotton revealed constitutive expression of genes in multiple signalling pathways related to disease resistance

    doi: 10.1093/jxb/erq227

    Figure Lengend Snippet: The functional annotation of 530 DEGs in leaves of transgenic T-34 identified in the microarray analysis ( P <0.001).

    Article Snippet: Among 11 236 unigene ESTs included in the 12k cDNA microarray, 4.7% and 0.57% of ESTs were differentially expressed in leaves and roots of transgenic T-34, respectively.

    Techniques: Functional Assay, Transgenic Assay, Microarray