sirna


80
Thermo Fisher sigirr specific sirna
Bioz Stars score: 80/100, Techniques, Protocol Conditions and more for sigirr specific sirna, supplied by Thermo Fisher. Data for sigirr specific sirna gathered from related PubMed articles.
https://www.bioz.com/result/sigirr specific sirna/product/Thermo Fisher
Average 80 stars, based on 4 article reviews
Price from $9.99 to $1999.99
sigirr specific sirna - by Bioz Product Reviews, 2018-12-11
80/100 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ...
  Buy from Vendor

98
Thermo Fisher individual sirnas
Bioz Stars score: 98/100, Techniques, Protocol Conditions and more for individual sirnas, supplied by Thermo Fisher. Data for individual sirnas gathered from related PubMed articles.
https://www.bioz.com/result/individual sirnas/product/Thermo Fisher
Average 98 stars, based on 205 article reviews
Price from $9.99 to $1999.99
individual sirnas - by Bioz Product Reviews, 2018-12-11
98/100 stars
... L-003802-00-0005) or 4 different individual siRNAs (Dharmacon, LQ-003802-00-0002 2 nmol).
  Buy from Vendor

97
Thermo Fisher sirna smartpool
Bioz Stars score: 97/100, Techniques, Protocol Conditions and more for sirna smartpool, supplied by Thermo Fisher. Data for sirna smartpool gathered from related PubMed articles.
https://www.bioz.com/result/sirna smartpool/product/Thermo Fisher
Average 97 stars, based on 158 article reviews
Price from $9.99 to $1999.99
sirna smartpool - by Bioz Product Reviews, 2018-12-11
97/100 stars
... with control siRNA or siRNA SMARTpool (Dharmacon) for the indicated gene 72 hours prior to cell collection ...
  Buy from Vendor

93
Millipore sirna sequences
Bioz Stars score: 93/100, Techniques, Protocol Conditions and more for sirna sequences, supplied by Millipore. Data for sirna sequences gathered from related PubMed articles.
https://www.bioz.com/result/sirna sequences/product/Millipore
Average 93 stars, based on 76 article reviews
Price from $9.99 to $1999.99
sirna sequences - by Bioz Product Reviews, 2018-12-11
93/100 stars
... of 50 nM. siRNA sequences (Sigma ) ...
  Buy from Vendor

90
Qiagen sirnas
Bioz Stars score: 90/100, Techniques, Protocol Conditions and more for sirnas, supplied by Qiagen. Data for sirnas gathered from related PubMed articles.
https://www.bioz.com/result/sirnas/product/Qiagen
Average 90 stars, based on 2118 article reviews
Price from $9.99 to $1999.99
sirnas - by Bioz Product Reviews, 2018-12-11
90/100 stars
... an equimolar mix of the following siRNAs (Qiagen) was used: SI01323357: AGCCTTGGAATTATTCCTGAA; SI04460869: TGCCAGTGATTTGGAGGTGAA; ...
  Buy from Vendor

86
Thermo Fisher cell titer glo sirna against cebpa
Bioz Stars score: 86/100, Techniques, Protocol Conditions and more for cell titer glo sirna against cebpa, supplied by Thermo Fisher. Data for cell titer glo sirna against cebpa gathered from related PubMed articles.
https://www.bioz.com/result/cell titer glo sirna against cebpa/product/Thermo Fisher
Average 86 stars, based on 10 article reviews
Price from $9.99 to $1999.99
cell titer glo sirna against cebpa - by Bioz Product Reviews, 2018-12-11
86/100 stars
... of 100 ng/mL doxycycline to assess 7-day growth via Cell-Titer Glo SiRNA against CEBPA (Ambion s2888), IRF1 ...
  Buy from Vendor

81
Thermo Fisher hdac7 specific sirna
Bioz Stars score: 81/100, Techniques, Protocol Conditions and more for hdac7 specific sirna, supplied by Thermo Fisher. Data for hdac7 specific sirna gathered from related PubMed articles.
https://www.bioz.com/result/hdac7 specific sirna/product/Thermo Fisher
Average 81 stars, based on 4 article reviews
Price from $9.99 to $1999.99
hdac7 specific sirna - by Bioz Product Reviews, 2018-12-11
81/100 stars
... (Invitrogen, Carlsbad, CA) and 50 nM of validated HDAC7-specific siRNA (Ambion, Austin, TX) or scrambled ...
  Buy from Vendor

80
Thermo Fisher sigirr specific sirna
Bioz Stars score: 80/100, Techniques, Protocol Conditions and more for sigirr specific sirna, supplied by Thermo Fisher. Data for sigirr specific sirna gathered from related PubMed articles.
https://www.bioz.com/result/sigirr specific sirna/product/Thermo Fisher
Average 80 stars, based on 4 article reviews
Price from $9.99 to $1999.99
sigirr specific sirna - by Bioz Product Reviews, 2018-12-11
80/100 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ...
  Buy from Vendor

80
Thermo Fisher 50pmol sirna against zip12
Bioz Stars score: 80/100, Techniques, Protocol Conditions and more for 50pmol sirna against zip12, supplied by Thermo Fisher. Data for 50pmol sirna against zip12 gathered from related PubMed articles.
https://www.bioz.com/result/50pmol sirna against zip12/product/Thermo Fisher
Average 80 stars, based on 2 article reviews
Price from $9.99 to $1999.99
50pmol sirna against zip12 - by Bioz Product Reviews, 2018-12-11
80/100 stars
Cells were transfected overnight with 50pmol siRNA against ZIP12 (s8397, Ambion), or negative siRNA (4390844, ...
  Buy from Vendor

96
Illumina small rna deep sequencing
Bioz Stars score: 96/100, Techniques, Protocol Conditions and more for small rna deep sequencing, supplied by Illumina. Data for small rna deep sequencing gathered from related PubMed articles.
https://www.bioz.com/result/small rna deep sequencing/product/Illumina
Average 96 stars, based on 156 article reviews
Price from $9.99 to $1999.99
small rna deep sequencing - by Bioz Product Reviews, 2018-12-11
96/100 stars
... either mock or SINV-infected for 24 hrs as determined by Illumina small RNA deep sequencing. c, qPCR analysis of DGCR8 ...
  Buy from Vendor

83
fluidigm small c1 dna seq chip
Bioz Stars score: 83/100, Techniques, Protocol Conditions and more for small c1 dna seq chip, supplied by fluidigm. Data for small c1 dna seq chip gathered from related PubMed articles.
https://www.bioz.com/result/small c1 dna seq chip/product/fluidigm
Average 83 stars, based on 5 article reviews
Price from $9.99 to $1999.99
small c1 dna seq chip - by Bioz Product Reviews, 2018-12-11
83/100 stars
... cells/ul and loaded in a small C1 DNA-seq chip according to the manufacturer’s instructions (Fluidigm, except the suspension buffer to ...
  Buy from Vendor