shrna


3.8
Thermo Fisher sigirr specific sirna
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/sigirr specific sirna/product/Thermo Fisher
Average 3.8 stars, based on 1230 article reviews
Price from $9.99 to $1999.99
sigirr specific sirna - by Bioz Product Reviews, 2018-08-01
3.8/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

N/A
p19 siRNA Binding Protein 1 000 units
  Buy from Vendor

4.8
Millipore shrnas
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/shrnas/product/Millipore
Average 4.8 stars, based on 589 article reviews
Price from $9.99 to $1999.99
shrnas - by Bioz Product Reviews, 2018-08-01
4.8/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

4.8
Millipore mission shrna library
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/mission shrna library/product/Millipore
Average 4.8 stars, based on 400 article reviews
Price from $9.99 to $1999.99
mission shrna library - by Bioz Product Reviews, 2018-08-01
4.8/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

4.6
Thermo Fisher shrna constructs
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/shrna constructs/product/Thermo Fisher
Average 4.6 stars, based on 303 article reviews
Price from $9.99 to $1999.99
shrna constructs - by Bioz Product Reviews, 2018-08-01
4.6/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

4.0
Millipore lentiviral shrna clones
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/lentiviral shrna clones/product/Millipore
Average 4.0 stars, based on 26 article reviews
Price from $9.99 to $1999.99
lentiviral shrna clones - by Bioz Product Reviews, 2018-08-01
4.0/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

4.0
Millipore shrnas against amd1
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/shrnas against amd1/product/Millipore
Average 4.0 stars, based on 13 article reviews
Price from $9.99 to $1999.99
shrnas against amd1 - by Bioz Product Reviews, 2018-08-01
4.0/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

3.9
Millipore rnai consortium trc shrna expression plasmids
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/rnai consortium trc shrna expression plasmids/product/Millipore
Average 3.9 stars, based on 10 article reviews
Price from $9.99 to $1999.99
rnai consortium trc shrna expression plasmids - by Bioz Product Reviews, 2018-08-01
3.9/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

3.9
Addgene inc rab27a shrna 2 gcttctgttcgacctgaca
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/rab27a shrna 2 gcttctgttcgacctgaca/product/Addgene inc
Average 3.9 stars, based on 9 article reviews
Price from $9.99 to $1999.99
rab27a shrna 2 gcttctgttcgacctgaca - by Bioz Product Reviews, 2018-08-01
3.9/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

3.9
Addgene inc scramble shrna sequence atctcgcttgggcgagagt plasmids
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/scramble shrna sequence atctcgcttgggcgagagt plasmids/product/Addgene inc
Average 3.9 stars, based on 9 article reviews
Price from $9.99 to $1999.99
scramble shrna sequence atctcgcttgggcgagagt plasmids - by Bioz Product Reviews, 2018-08-01
3.9/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

3.8
Millipore plko based shrna
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/plko based shrna/product/Millipore
Average 3.8 stars, based on 5 article reviews
Price from $9.99 to $1999.99
plko based shrna - by Bioz Product Reviews, 2018-08-01
3.8/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

3.8
Millipore cccaagacaaagacaagtaaa shrnas
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/cccaagacaaagacaagtaaa shrnas/product/Millipore
Average 3.8 stars, based on 5 article reviews
Price from $9.99 to $1999.99
cccaagacaaagacaagtaaa shrnas - by Bioz Product Reviews, 2018-08-01
3.8/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

4.0
Thermo Fisher on targetplus smartpool sirna
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/on targetplus smartpool sirna/product/Thermo Fisher
Average 4.0 stars, based on 334 article reviews
Price from $9.99 to $1999.99
on targetplus smartpool sirna - by Bioz Product Reviews, 2018-08-01
4.0/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

4.9
Qiagen allstar negative control sirna
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/allstar negative control sirna/product/Qiagen
Average 4.9 stars, based on 288 article reviews
Price from $9.99 to $1999.99
allstar negative control sirna - by Bioz Product Reviews, 2018-08-01
4.9/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

4.5
Thermo Fisher sirna smartpool
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/sirna smartpool/product/Thermo Fisher
Average 4.5 stars, based on 198 article reviews
Price from $9.99 to $1999.99
sirna smartpool - by Bioz Product Reviews, 2018-08-01
4.5/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

4.4
Qiagen sirna sequences
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/sirna sequences/product/Qiagen
Average 4.4 stars, based on 319 article reviews
Price from $9.99 to $1999.99
sirna sequences - by Bioz Product Reviews, 2018-08-01
4.4/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

4.3
Millipore sirna sequences
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/sirna sequences/product/Millipore
Average 4.3 stars, based on 76 article reviews
Price from $9.99 to $1999.99
sirna sequences - by Bioz Product Reviews, 2018-08-01
4.3/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

4.2
Thermo Fisher i silencer i sirna labeling kit with cy 3 dye
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/i silencer i sirna labeling kit with cy 3 dye/product/Thermo Fisher
Average 4.2 stars, based on 37 article reviews
Price from $9.99 to $1999.99
i silencer i sirna labeling kit with cy 3 dye - by Bioz Product Reviews, 2018-08-01
4.2/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

4.1
Thermo Fisher cell titer glo sirna against cebpa
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/cell titer glo sirna against cebpa/product/Thermo Fisher
Average 4.1 stars, based on 10 article reviews
Price from $9.99 to $1999.99
cell titer glo sirna against cebpa - by Bioz Product Reviews, 2018-08-01
4.1/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

4.0
Thermo Fisher on target plus sirna oligos
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/on target plus sirna oligos/product/Thermo Fisher
Average 4.0 stars, based on 22 article reviews
Price from $9.99 to $1999.99
on target plus sirna oligos - by Bioz Product Reviews, 2018-08-01
4.0/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

3.9
Thermo Fisher socs1 sirna
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/socs1 sirna/product/Thermo Fisher
Average 3.9 stars, based on 16 article reviews
Price from $9.99 to $1999.99
socs1 sirna - by Bioz Product Reviews, 2018-08-01
3.9/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

3.9
Thermo Fisher hk2 sirna
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/hk2 sirna/product/Thermo Fisher
Average 3.9 stars, based on 9 article reviews
Price from $9.99 to $1999.99
hk2 sirna - by Bioz Product Reviews, 2018-08-01
3.9/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

3.9
Qiagen fgfr3 sirna
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/fgfr3 sirna/product/Qiagen
Average 3.9 stars, based on 9 article reviews
Price from $9.99 to $1999.99
fgfr3 sirna - by Bioz Product Reviews, 2018-08-01
3.9/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

3.9
Kaneka Corp sirna oligonucleotides
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/sirna oligonucleotides/product/Kaneka Corp
Average 3.9 stars, based on 32 article reviews
Price from $9.99 to $1999.99
sirna oligonucleotides - by Bioz Product Reviews, 2018-08-01
3.9/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

3.9
Thermo Fisher stealth stau1 sirna
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/stealth stau1 sirna/product/Thermo Fisher
Average 3.9 stars, based on 6 article reviews
Price from $9.99 to $1999.99
stealth stau1 sirna - by Bioz Product Reviews, 2018-08-01
3.9/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

3.9
Thermo Fisher hdac7 specific sirna
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/hdac7 specific sirna/product/Thermo Fisher
Average 3.9 stars, based on 4 article reviews
Price from $9.99 to $1999.99
hdac7 specific sirna - by Bioz Product Reviews, 2018-08-01
3.9/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

3.8
Thermo Fisher sigirr specific sirna
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/sigirr specific sirna/product/Thermo Fisher
Average 3.8 stars, based on 1230 article reviews
Price from $9.99 to $1999.99
sigirr specific sirna - by Bioz Product Reviews, 2018-08-01
3.8/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

3.7
GE Healthcare acell sirna
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
https://www.bioz.com/result/acell sirna/product/GE Healthcare
Average 3.7 stars, based on 2 article reviews
Price from $9.99 to $1999.99
acell sirna - by Bioz Product Reviews, 2018-08-01
3.7/5 stars
1 µM SIGIRR-specific siRNA (On-Target Plus; Dharmacon, GE Healthcare) comprised 250 nM of the four following antisense sequences: ..
  Buy from Vendor

N/A
i Fect siRNA Transfection Reagent
  Buy from Vendor


N/A
p19 siRNA Binding Protein 1 000 units
  Buy from Vendor