Journal: Journal of Cellular and Molecular Medicine

Article Title: Reticulocalbin 1 is required for proliferation and migration of non‐small cell lung cancer cells regulated by osteoblast‐conditioned medium

doi: 10.1111/jcmm.17040

Figure Lengend Snippet: Information of antibodies

Article Snippet: p‐PERK(phosphoT980) , Bioss Bs−3330R , 1:1000 , 4℃ overnight.

Techniques:

Journal: Frontiers in immunology

Article Title: Inhibition of IP3R/Ca2+ Dysregulation Protects Mice From Ventilator-Induced Lung Injury via Endoplasmic Reticulum and Mitochondrial Pathways.

doi: 10.3389/fimmu.2021.729094

Figure Lengend Snippet: FIGURE 5 | 2-APB inhibits ER stress in HTV-treated mice. (A) Immunofluorescence photomicrographs of GRP78 (green) and CHOP (red) in lung tissues of group CON, HTV, and HTV+2-APB mice. Dapi (blue) was used to stain the nuclei. Scale bar: 200mm. An inset picture was employed to show the indicated area at 4X magnification. (B, C) Graphic presentations of fluorescence mean densities of GRP78 and CHOP. (D) Levels of GRP78, CHOP, p-IRE1a, t-IRE1a, TRAF2, XBP-1s, p-PERK, t-PERK, p-eIF2a, t-eIF2a, t-ATF6, b-actin proteins by Western blot. (E) Relative protein expression of GRP78, CHOP, TRAF2, XBP-1s and t-ATF6 relative to b-actin. (F) The relative ratio of p-IRE1a protein was presented to t-IRE1a. (G) The relative ratio of p-PERK protein was presented to t-PERK. (H) The relative ratio of p-eIF2a protein was presented to t-eIF2a. Data are expressed as means ± SD (n = 6 per group). *P < 0.05 vs. CON group. #P < 0.05 vs. HTV group.

Article Snippet: Genes Primer sequences (5’-3’) Mouse-GRP78 Forward GAAAGGATGGTTAATGATGCTGAG Reverse GTCTTCAATGTCCGCATCCTG Mouse-CHOP Forward CAAATGGCAGTTCAAAACCATC Reverse ATGTGTGCTGTGTGTGTGTTCC Mouse-NLRP3 Forward TGTGAGAAGCAGGTTCTACTCT Reverse GACTGTTGAGGTCCACACTCT Mouse-Caspase-1 Forward AGGCATGCCGTGGAGAGAAACAA Reverse AGCCCCTGACAGGATGTCTCCA Mouse-ASC Forward GACAGTACCAGGCAGTTCGT Reverse AGTCCTTGCAGGTCAGGTTC Mouse-GAPDH Forward TGTGTCCGTCGTGGATCTGA Reverse TTGCTGTTGAAGTCGCAGGAG Se ptember 2021 | Volume 12 | Article 729094 (#2148, CST), anti-GRP78 (sc-166490, Santa Cruz; and/or GB11098, Servicebio), anti-CHOP (sc-7351, Santa Cruz), antiphospho-IRE1a (ab48187, abcam), anti-IRE1a (ab37073, abcam), anti-TRAF2 (#4724, CST), anti-XBP-1s (#40435, CST), anti-phospho-PERK (#3179, CST), anti- PERK (#5683, CST), anti- phospho- eIF2a (AP0635, ABclonal), antieIF2a(A0764, ABclonal), anti-ATF6 (ab37149, abcam), antiIkBa (#4814s, CST), anti-p-NF-kB p65 (Ser536, #3033s, CST), anti-NF-kB p65 (#8242s, CST), anti-Lamin B (sc-374015, Santa Cruz), anti- NLRP3 (#13158, CST), anti-caspase-1 (A0964, ABclonal), anti-ASC (67824S, CST), anti-b-actin (#4970, CST).

Techniques: Staining, Western Blot, Expressing

Journal: Journal of advanced research

Article Title: Short-chain fatty acid butyrate against TMAO activating endoplasmic-reticulum stress and PERK/IRE1-axis with reducing atrial arrhythmia.

doi: 10.1016/j.jare.2024.08.009

Figure Lengend Snippet: Fig. 4. SB supplement ameliorated TMAO-mediated activation of ER stress signaling and dysregulation of ionic signaling. (A) and (B) Representative images and statistical data show the expression of pPERK, PERK, pIRE1a, IRE1a, pNF-jB, NF-jB, pIP3R, IP3R, NCX, Kv1.5, and b-actin in HL-1 cells from control group (n = 3), TMAO treated (n = 3), SB treated (n = 3), and TMAO combined with SB treated group (n = 3) in three independent experiments. b-Actin was used as a loading control. *P < 0.05. **P < 0.01. TMAO versus control or SB or TMAO combined with SB treatment.

Article Snippet: Then, the blots were incubated with primary antibodies against phospho-PERK (pPERK; #3179, Cell signaling), PERK (#3192, Cell signaling), phospho-IRE1a (pIRE1a; NB100-2323, Novus), IRE1a (#3294, Cell signaling Technology), phospho-NFjB (pNF-jB; #3033, Cell Signaling Technology), NF-jB (#8242, Cell Signaling Technology), phospho-IP3R (pIP3R; #3760, Cell signaling Technology), IP3R (#8568, Cell signaling Technology), NCX (MA3926, Thermo Fisher Scientific), Kv1.5 (APC-004, Alomone Lab), and b-actin (sc-47778, Santa Cruz).

Techniques: Activation Assay, Expressing, Control

Journal: Journal of advanced research

Article Title: Short-chain fatty acid butyrate against TMAO activating endoplasmic-reticulum stress and PERK/IRE1-axis with reducing atrial arrhythmia.

doi: 10.1016/j.jare.2024.08.009

Figure Lengend Snippet: Fig. 8. SB supplement ameliorated atrial fibrosis and PERK/IRE1a/NF-jB axis of TMAO-treated mice. The expression of atrial fibrosis (blue area) was detected by Masson’s staining and immunostaining of pPERK, pIRE1a, and pNF-jB in the atrium tissues derived from mice gavage with control (n = 5), TMAO (n = 5), and TMAO combined with SB (n = 5). The expressions of pPERK are indicated by hollow arrowheads. (bar, 25 lm). ** p < 0.01. TMAO treatment versus control group or TMAO combined with SB treated group. (For interpretation of the references to colour in this Fig. legend, the reader is referred to the web version of this article.)

Article Snippet: Then, the blots were incubated with primary antibodies against phospho-PERK (pPERK; #3179, Cell signaling), PERK (#3192, Cell signaling), phospho-IRE1a (pIRE1a; NB100-2323, Novus), IRE1a (#3294, Cell signaling Technology), phospho-NFjB (pNF-jB; #3033, Cell Signaling Technology), NF-jB (#8242, Cell Signaling Technology), phospho-IP3R (pIP3R; #3760, Cell signaling Technology), IP3R (#8568, Cell signaling Technology), NCX (MA3926, Thermo Fisher Scientific), Kv1.5 (APC-004, Alomone Lab), and b-actin (sc-47778, Santa Cruz).

Techniques: Expressing, Staining, Immunostaining, Derivative Assay, Control

Journal: Autophagy

Article Title: Autophagy-dependent EIF2AK3 activation compromises ursolic acid-induced apoptosis through upregulation of MCL1 in MCF-7 human breast cancer cells

doi: 10.4161/auto.22805

Figure Lengend Snippet: Figure 1. Ursolic acid (UA) induced cytoprotective EIF2AK3 activation in MCF-7 human breast cancer cells. UA induced cell number reduction (A) and apoptosis (B) in a dose-dependent manner. MCF-7 cells were treated with various concentrations of UA for 24 h, and then overall inhibitory effects and apoptosis were measured by crystal violet staining and annexin V/FITC staining, respectively. (C) Unfolded protein response induced by UA. MCF-7 cells were treated with various concentrations of UA for 24 h and then ER stress associated markers were analyzed by western blotting. (D) Effects of EIF2AK3 inactivation by RNAi on UA-induced apoptosis. The cells were transfected with 50 nmol/L of EIF2AK3 siRNA using siPORT™ NeoFX™ Transfection Agent. At 24 h post-transfection, the cells were treated with 20 μM for 24 h and apoptosis induction was assessed by sub-G1 analysis (n = 3, **p < 0.01). (The blots shown are representative of three independent experiments).

Article Snippet: RNA interference siRNAs targeting EIF2AK3 (sc-36213), ERN1 (sc-40705), HSPA5 (sc-29338), BECN1 (sc-29797) and MCL1 (sc-35877) were purchased from Santa Cruz Biotechnologies. siRNAs targeting ATG5 and nontargeting siRNA were synthesized by Integrated DNA Technologies.

Techniques: Activation Assay, Staining, Western Blot, Transfection

Journal: Autophagy

Article Title: Autophagy-dependent EIF2AK3 activation compromises ursolic acid-induced apoptosis through upregulation of MCL1 in MCF-7 human breast cancer cells

doi: 10.4161/auto.22805

Figure Lengend Snippet: Figure 4. ER stress was an effect rather than a cause of UA-induced autophagy. (A and B) Effects of EIF2AK3 (A) or ERN1 (B) knockdown on UA-induced LC3-I to LC3-II conversion. The cells were transfected with 50 nmol/L of EIF2AK3 siRNA or 50 nmol/L of ERN1 siRNA using siPORT™ NeoFX™ Transfection Agent. At 24 h post-transfection, the cells were treated with 20 μM for 24 h and then EIF2AK3, p-EIF2S1, ERN1 and LC3 were assessed by western blotting. (C and D) Effects of autophagy inhibition by 3-MA (C) or WORT (D) on UA-induced HSPA5 expression and EIF2S1 phosphorylation. The cells were treated with 20 μM UA in the presence or absence of 3-MA or WORT for 24 h and were analyzed by western blotting. (E) Effects of autophagy inhibition by BECN1/ATG5 knockdown on UA-induced HSPA5 expression and EIF2S1 phosphorylation. The cells were simultaneously transfected BECN1 and ATG5 siRNAs using siPORT™ NeoFX™ Transfection Agent. After 24 h transfection, the cells were treated with 20 μM UA for 24 h and were assessed by western blotting. (F) Time-course analysis of key parameters of ER stress, autophagy and apoptosis induced by UA in MCF-7cells. The cells were treated with UA for the indicated time and then LC3, EIF2S1 phosphorylation and PARP1 cleavage were assessed by western blotting. (G) UA induces autophagy-mediated ER stress in MDA-MB-231 cells. The cells were treated with UA for the indicated time and then LC3 and EIF2S1 phosphorylation were assessed by western blotting (left); The cells were pretreated with 3-MA for 1 h and further treated with UA for 6 h and western blotting was used to analyze LC3 and EIF2AK3-EIF2S1 phosphorylation (middle) and sub-G1 analysis was used to assess apoptosis induction by UA in the presence or absence of 3-MA for 24 h (right, n = 3, **p < 0.01). (The blots shown are representative of three independent experiments).

Article Snippet: RNA interference siRNAs targeting EIF2AK3 (sc-36213), ERN1 (sc-40705), HSPA5 (sc-29338), BECN1 (sc-29797) and MCL1 (sc-35877) were purchased from Santa Cruz Biotechnologies. siRNAs targeting ATG5 and nontargeting siRNA were synthesized by Integrated DNA Technologies.

Techniques: Knockdown, Transfection, Western Blot, Inhibition, Expressing, Phospho-proteomics

Journal: Autophagy

Article Title: Autophagy-dependent EIF2AK3 activation compromises ursolic acid-induced apoptosis through upregulation of MCL1 in MCF-7 human breast cancer cells

doi: 10.4161/auto.22805

Figure Lengend Snippet: Figure 5. Upregulation of MCL1 contributed to the prosurvival property of UA-induced, autophagy-dependent EIF2AK3 activation. (A) Effects of UA treatments on MCL1 expression. The cells were treated with various concentrations of UA for 24 h and MCL1 expression was analyzed by western blotting. (B) Effects of EIF2AK3 inactivation by RNAi on MCL1 induction by UA. EIF2AK3 was silenced by siRNA and MCL1 expression was analyzed by western blotting. (C) Effects of BECN1 and ATG5 knockdown on MCL1 induction by UA. BECN1 and ATG5 were simultaneously silenced by a siRNA approach and MCL1 was measured by western blotting. (D) Effects of ATG5 knockdown on phosphorylation of EIF2AK3-EIF2S1 and MCL1 induction. ATG5 was silenced by siRNA approach and phosphorylation of EIF2AK3-EIF2S1 and MCL1 expression were measured by western blotting. (E) Effects of 3-MA on MCL1 induction by UA. The cells were treated with 20 μM UA in the presence or absence of 3-MA for 24 h, MCL1 was analyzed by western blotting. (E) Effects of MCL1 inhibition by siRNA on UA-induced apoptosis measured by sub-G1 analysis (n = 3, **p < 0.01). (The blots shown are representative of three independent experiments).

Article Snippet: RNA interference siRNAs targeting EIF2AK3 (sc-36213), ERN1 (sc-40705), HSPA5 (sc-29338), BECN1 (sc-29797) and MCL1 (sc-35877) were purchased from Santa Cruz Biotechnologies. siRNAs targeting ATG5 and nontargeting siRNA were synthesized by Integrated DNA Technologies.

Techniques: Activation Assay, Expressing, Western Blot, Knockdown, Phospho-proteomics, Inhibition

Journal: Autophagy

Article Title: Autophagy-dependent EIF2AK3 activation compromises ursolic acid-induced apoptosis through upregulation of MCL1 in MCF-7 human breast cancer cells

doi: 10.4161/auto.22805

Figure Lengend Snippet: Figure 8. Signaling pathways underlying UA-induced cytoprotective autophagy in human MCF-7 breast cancer cells. UA at relatively low concentrations induced autophagy which in turn led to activation of UPR including EIF2AK3 pathway. Activation of EIF2AK3 suppressed UA-mediated apoptosis through upregulation of MCL1. UA-induced cytoprotective autophagy was attributed to MAPK1/3 activation but not associated with MTOR inhibition.

Article Snippet: RNA interference siRNAs targeting EIF2AK3 (sc-36213), ERN1 (sc-40705), HSPA5 (sc-29338), BECN1 (sc-29797) and MCL1 (sc-35877) were purchased from Santa Cruz Biotechnologies. siRNAs targeting ATG5 and nontargeting siRNA were synthesized by Integrated DNA Technologies.

Techniques: Protein-Protein interactions, Activation Assay, Inhibition

Journal: Scientific Reports

Article Title: PDZRN3 protects against apoptosis in myoblasts by maintaining cyclin A2 expression

doi: 10.1038/s41598-020-58116-1

Figure Lengend Snippet: PDZRN3 depletion attenuates proliferation and promotes apoptosis in C2C12 myoblasts. ( a ) Abundance of PDZRN3 in cells infected or not (None) with adenoviruses encoding either a PDZRN3 shRNA (KD or KD*) or a scrambled version of KD (Scramb) and then cultured for 48 h in GM until confluent (i). The cells were then cultured for 24 h in serum-deficient medium (ii) or reseeded and cultured for 48 h in GM until 30% to 40% confluent (iii). Cell lysates were subjected to immunoblot analysis with antibodies to PDZRN3 and to α-tubulin (loading control). A representative blot as well as quantitative data (means ± s.e.m. for five biological replicates) for the abundance of PDZRN3 normalized by that of α-tubulin and expressed relative to the value for noninfected cells are shown. ( b ) Relative viability of cells infected as in ( a ) and then cultured for 48 h was determined by trypan blue staining. Data are means ± s.e.m. for 10 biological replicates. ( c ) Phase-contrast microscopy of cells infected as in ( a ) and then cultured for 48 h. Scale bar , 100 μm. ( d ) Relative adhesion activity of cells infected with adenoviruses for KD or Scramb shRNAs was measured 1 h after reseeding. Data are means ± s.e.m. for 10 biological replicates. ( e ) Immunofluorescence analysis of Ki-67 in C2C12 cells infected with adenoviruses encoding KD or Scramb shRNAs. Nuclei were stained with DAPI. Scale bars , 25 μm. ( f ) Proportion of Ki-67-positive cells among total (DAPI-positive) cells as determined for images similar to those in ( e ). Data are means ± s.e.m. for five biological replicates. ( g ) The proportion of BrdU-positive cells among total (DAPI-positive) cells infected as in ( a ) was determined by immunofluorescence analysis. Data are means ± s.e.m. for five biological replicates. ( h ) Immunoblot analysis of total and Ser 473 -phosphorylated (p-) forms of Akt in cells infected with adenoviruses for KD or Scramb shRNAs. A representative blot as well as quantitative data (means ± s.e.m. for seven biological replicates) for the relative p-Akt/Akt densitometric ratio are shown. For all panels: * P < 0.05, ** P < 0.01, *** P < 0.001; NS, not significant (one-way ANOVA).

Article Snippet: Mouse monoclonal antibodies to α-tubulin (T-9026), to p53 (#2524), to Ser 139 -phosphorylated H2AX (GTX628789), and to BrdU (66241-1-Ig) were from Sigma-Aldrich, Cell Signaling Technology, GeneTex, and Proteintech group (Chicago, IL), respectively, and rabbit monoclonal antibodies to Ki-67 (RM-9106-R7) were from Thermo Fisher Scientific (Waltham, MA).

Techniques: Infection, shRNA, Cell Culture, Western Blot, Control, Staining, Microscopy, Activity Assay, Immunofluorescence

Journal: Scientific Reports

Article Title: PDZRN3 protects against apoptosis in myoblasts by maintaining cyclin A2 expression

doi: 10.1038/s41598-020-58116-1

Figure Lengend Snippet: PDZRN3 depletion promotes apoptosis induced by serum deprivation in C2C12 myoblasts. ( a ) Immunoblot analysis of cleaved caspase-3 and α-tubulin (loading control) in C2C12 cells infected with adenoviruses encoding an shRNA specific for mouse PDZRN3 mRNA (KD) or a scrambled version of this shRNA sequence (Scramb) and then subjected to serum deprivation for the indicated times. A representative blot as well as quantitative data (means ± s.e.m. for 10 biological replicates) for the abundance of cleaved caspase-3 normalized by that of α-tubulin and expressed relative to the value for Scramb at 12 h are shown. *** P < 0.001 (two-way ANOVA). ( b ) The experiment in ( a ) was repeated with a different shRNA specific for PDZRN3 mRNA (KD*). Data for cells at 6 h after the onset of serum deprivation are presented as means ± s.e.m. for five biological replicates. * P < 0.05, ** P < 0.01, *** P < 0.001 (one-way ANOVA). ( c ) The proportion of early apoptosis (annexin V-positive, propidium iodide-negative) C2C12 cells after infection as in ( b ) and serum deprivation for 6 h. The total cell number was determined by DAPI-staining. Data are means ± s.e.m. for four biological replicates. *** P < 0.001, NS (one-way ANOVA). ( d ) Immunoblot analysis of cytochrome c in whole lysates and a cytosolic fraction of C2C12 cells infected as in ( a ) and deprived of serum for 12 h. Data for the abundance of cytosolic cytochrome c normalized by that of total cytochrome c and expressed relative to the value for Scramb are means ± s.e.m. for five biological replicates. *** P < 0.001 (one-way ANOVA).

Article Snippet: Mouse monoclonal antibodies to α-tubulin (T-9026), to p53 (#2524), to Ser 139 -phosphorylated H2AX (GTX628789), and to BrdU (66241-1-Ig) were from Sigma-Aldrich, Cell Signaling Technology, GeneTex, and Proteintech group (Chicago, IL), respectively, and rabbit monoclonal antibodies to Ki-67 (RM-9106-R7) were from Thermo Fisher Scientific (Waltham, MA).

Techniques: Western Blot, Control, Infection, shRNA, Sequencing, Staining

Journal: Scientific Reports

Article Title: PDZRN3 protects against apoptosis in myoblasts by maintaining cyclin A2 expression

doi: 10.1038/s41598-020-58116-1

Figure Lengend Snippet: PDZRN3 depletion increases the sensitivity of cells to various apoptotic stimuli. ( a ) Viability of C2C12 myoblasts infected or not (None) with adenoviruses encoding an shRNA specific for mouse PDZRN3 mRNA (KD) or a scrambled version of this shRNA sequence (Scramb) and then incubated for 3 h in GM containing the indicated concentrations of staurosporine. Data are means ± s.e.m. for 10 biological replicates. ** P < 0.01, *** P < 0.001, NS (two-way ANOVA). ( b ) C2C12 cells infected as in ( a ) were exposed to 0.5 μM staurosporine (SSP), 100 μM etoposide (ETP), 200 μM gemcitabine (GEM), or puromycin (PURO, 1 μg/ml) in GM for 3 h, after which cell lysates were subjected to immunoblot analysis with antibodies to cleaved caspase-3 and to α-tubulin. The abundance of cleaved caspase-3 was normalized by that of α-tubulin and expressed relative to the corresponding value for Scramb. Data are means ± s.e.m. for seven biological replicates. *** P < 0.001 (unpaired Student’s t test). ( c , d ) C3H10T1/2 cells ( c ) and NIH-3T3 cells ( d ) infected as in ( a ) were exposed either to low-serum medium for 6 h or to 0.5 μM staurosporine, 100 μM etoposide, or puromycin (1 μg/ml) in GM for 3 h. The abundance of cleaved caspase-3 was then determined as in ( b ). Data are means ± s.e.m. for four biological replicates. ** P < 0.01, *** P < 0.001 (unpaired Student’s t test).

Article Snippet: Mouse monoclonal antibodies to α-tubulin (T-9026), to p53 (#2524), to Ser 139 -phosphorylated H2AX (GTX628789), and to BrdU (66241-1-Ig) were from Sigma-Aldrich, Cell Signaling Technology, GeneTex, and Proteintech group (Chicago, IL), respectively, and rabbit monoclonal antibodies to Ki-67 (RM-9106-R7) were from Thermo Fisher Scientific (Waltham, MA).

Techniques: Infection, shRNA, Sequencing, Incubation, Western Blot

Journal: Scientific Reports

Article Title: PDZRN3 protects against apoptosis in myoblasts by maintaining cyclin A2 expression

doi: 10.1038/s41598-020-58116-1

Figure Lengend Snippet: PDZRN3 depletion suppresses the expression of cyclin A2. ( a ) C2C12 myoblasts infected or not (None) with adenoviruses encoding PDZRN3 (KD or KD*) or scrambled (Scramb) shRNAs were subjected to immunoblot analysis of cyclin A2 and GAPDH (loading control). The abundance of cyclin A2 was normalized by that of GAPDH and expressed relative to the value for Scramb. Data are means ± s.e.m. for five biological replicates. *** P < 0.001, NS (one-way ANOVA). ( b ) RT and real-time PCR analysis of cyclin A2 mRNA in cells infected as in ( a ). Data are expressed relative to the value for noninfected cells and are means ± s.e.m. for five biological replicates. *** P < 0.001, NS (one-way ANOVA). ( c ) C2C12 cells synchronized by nocodazole treatment were cultured in GM for the indicated times after removal of nocodazole, after which cell lysates were subjected to immunoblot analysis with antibodies to cyclin A2 and to GAPDH. A representative blot as well as quantitative data (means ± s.e.m. for four biological replicates) for the abundance of cyclin A2 normalized by that of GAPDH and expressed relative to the value for cells at 1 h are shown. ** P < 0.01, *** P < 0.001 versus cells at 1 h (one-way ANOVA). ( d ) Cells infected with adenoviruses for KD or Scramb shRNAs were analyzed as in ( c ). Data are expressed relative to the value for Scramb at 1 h after removal of nocodazole and are means ± s.e.m. for five biological replicates. ** P < 0.01, *** P < 0.001 (two-way ANOVA). ( e ) Immunoblot analysis of cyclin A2 and α-tubulin (loading control) in C2C12 cells infected with adenoviruses encoding KD or Scramb shRNAs and subjected to serum deprivation for the indicated times. A representative blot as well as quantitative data (means ± s.e.m. for 10 biological replicates) for the abundance of cyclin A2 normalized by that of α-tubulin and expressed relative to the value for Scramb at time 0 are shown. ** P < 0.01, *** P < 0.001 (two-way ANOVA).

Article Snippet: Mouse monoclonal antibodies to α-tubulin (T-9026), to p53 (#2524), to Ser 139 -phosphorylated H2AX (GTX628789), and to BrdU (66241-1-Ig) were from Sigma-Aldrich, Cell Signaling Technology, GeneTex, and Proteintech group (Chicago, IL), respectively, and rabbit monoclonal antibodies to Ki-67 (RM-9106-R7) were from Thermo Fisher Scientific (Waltham, MA).

Techniques: Expressing, Infection, Western Blot, Control, Real-time Polymerase Chain Reaction, Cell Culture

Journal: Scientific Reports

Article Title: PDZRN3 protects against apoptosis in myoblasts by maintaining cyclin A2 expression

doi: 10.1038/s41598-020-58116-1

Figure Lengend Snippet: PDZRN3 depletion down-regulates Mre11, activates p53, and enhances serum deprivation-induced DNA damage. ( a , b , e ) C2C12 myoblasts infected with adenoviruses for PDZRN3 (KD or KD*) or scrambled (Scramb) shRNAs were incubated in low-serum medium for the indicated times and then subjected to immunoblot analysis with antibodies to Mre11 ( a ), to Ser 15 -phosphorylated p53 (p-p53) ( b ), to Ser 139 -phosphorylated H2AX (p-H2AX) ( e ), or to α-tubulin (loading control). Representative blots as well as quantitative data (means ± s.e.m. for 10 biological replicates) for the abundance of Mre11, p-p53, and p-H2AX normalized by that of α-tubulin and expressed relative to the value for Scramb at time 0 ( a , b ) or 12 h ( e ) are shown. * P < 0.05, ** P < 0.01, *** P < 0.001 (two-way ANOVA). ( c ) The cells in ( b ) were also subjected to immunoblot analysis with antibodies to p53 and to α-tubulin after serum deprivation for 12 h. The abundance of total p53 protein was normalized by that of α-tubulin and is expressed relative to the value for Scramb. Data are means ± s.e.m. from nine biological replicates. *** P < 0.001 (unpaired Student’s t test). ( d ) C2C12 cells infected or not (None) with adenoviruses encoding PDZRN3 (KD or KD*) or scrambled (Scramb) shRNAs were subjected to immunofluorescence analysis with antibodies to p-H2AX after serum deprivation for 6 h. Nuclei were stained with DAPI. Scale bars, 25 μm. Arrowheads indicate foci of p-H2AX formed in nuclei in response to DNA damage.

Article Snippet: Mouse monoclonal antibodies to α-tubulin (T-9026), to p53 (#2524), to Ser 139 -phosphorylated H2AX (GTX628789), and to BrdU (66241-1-Ig) were from Sigma-Aldrich, Cell Signaling Technology, GeneTex, and Proteintech group (Chicago, IL), respectively, and rabbit monoclonal antibodies to Ki-67 (RM-9106-R7) were from Thermo Fisher Scientific (Waltham, MA).

Techniques: Infection, Incubation, Western Blot, Control, Immunofluorescence, Staining

Journal: Scientific Reports

Article Title: PDZRN3 protects against apoptosis in myoblasts by maintaining cyclin A2 expression

doi: 10.1038/s41598-020-58116-1

Figure Lengend Snippet: Forced expression of cyclin A2 attenuates the promotion of apoptosis and the inhibition of proliferation by PDZRN3 depletion. ( a ) C2C12 myoblasts infected with adenoviruses for PDZRN3 (KD) or scrambled (Sc) shRNAs were transfected with an expression vector for cyclin A2 (+) or with the corresponding empty vector (−) and then deprived of serum for 6 h, after which cell lysates were subjected to immunoblot analysis with antibodies to PDZRN3, to cyclin A2, to Mre11, to cleaved caspase-3, and to α-tubulin (loading control). ( b ) The abundance of cleaved caspase-3, cyclin A2, and Mre11 normalized by that of α-tubulin was determined for cells treated as in ( a ). Data are expressed relative to the value for cells infected with the scrambled shRNA and transfected with the empty vector and are means ± s.e.m. for eight biological replicates. *** P < 0.001 (one-way ANOVA). ( c ) C2C12 cells infected and transfected as in ( a ) were cultured in GM containing 0.5 μM staurosporine for 3 h and then subjected to immunoblot analysis for determination of the relative amount of cleaved caspase-3 normalized by that of α-tubulin. Data are means ± s.e.m. for 10 biological replicates. *** P < 0.001 (one-way ANOVA). ( d ) C2C12 cells infected and transfected as in ( a ) were subjected to immunoblot analysis for determination of the relative amount of Ki-67 normalized by that of α-tubulin. Data are means ± s.e.m. for 10 biological replicates. *** P < 0.001 (one-way ANOVA).

Article Snippet: Mouse monoclonal antibodies to α-tubulin (T-9026), to p53 (#2524), to Ser 139 -phosphorylated H2AX (GTX628789), and to BrdU (66241-1-Ig) were from Sigma-Aldrich, Cell Signaling Technology, GeneTex, and Proteintech group (Chicago, IL), respectively, and rabbit monoclonal antibodies to Ki-67 (RM-9106-R7) were from Thermo Fisher Scientific (Waltham, MA).

Techniques: Expressing, Inhibition, Infection, Transfection, Plasmid Preparation, Western Blot, Control, shRNA, Cell Culture