khdrbs1 Search Results


85
Thermo Fisher gene exp khdrbs1 mm00516130 m1
Gene Exp Khdrbs1 Mm00516130 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp khdrbs1 mm00516130 m1/product/Thermo Fisher
Average 85 stars, based on 1 article reviews
gene exp khdrbs1 mm00516130 m1 - by Bioz Stars, 2026-03
85/100 stars
  Buy from Supplier

93
Proteintech antibodies against khdrbs1
Antibodies Against Khdrbs1, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibodies against khdrbs1/product/Proteintech
Average 93 stars, based on 1 article reviews
antibodies against khdrbs1 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

85
Thermo Fisher gene exp khdrbs1 hs00173141 m1
A Workflow showing the selection strategy for <t>KHDRBS1</t> among DNA-damage response genes transcriptionally activated by Myc and significantly associated to breast cancer prognosis. Venn diagram showing the overlap between Myc-transcriptionally activated genes, DNA-damage response genes and genes associated to breast cancer. Specifically, genes were retrieved from: (i) microarray data of Myc-overexpressing mammospheres (M2) (GSE86407); (ii) published dataset (MD Anderson Human-DNA Repair Genes, https://www.mdanderson.org/documents/Labs/Wood-Laboratory/human-dna-repair-genes.html ), BioRad DNA-damage signaling pathway (SAB Target List H96) and recently published DNA-damage-associated genes (Supplementary Table ); and (iii) breast cancer versus normal breast tissues TCGA BRCA and GTeX gene expression data (Supplementary Table ). Genes were further selected for association to the worse relapse-free survival probability in breast cancer (Supplementary Table ) and novelty in the field, excluding known genes associated with BRCAness . B Box plot representing the distribution of log2 gene expression of KHDRBS1 retrieved from TCGA BRCA ( n = 1212) and GTeX ( n = 179) gene expression data (RNASeq2GeneNorm). p value was calculated with Wilcoxon rank sum test. C Kaplan–Meier plots of relapse-free survival (RFS) probability of BC patients stratified by high or low KHDRBS1 expression levels. D GSEA of DNA-repair gene signatures in IMEC-WT versus M2 ( n =3). E Scheme showing MYC and H3K4me3 PCR amplicons localization (red box) on IMEC-WT and M2 cells and layered H3K27ac signals on KHDRBS1 ( SAM68 ) promoter from ENCODE. Chromatin state was assessed by ChromHMM from ENCODE. MYC-MAX binding on multiple cell lines was assessed by ChIP-seq from ENCODE. F ChIP-qPCR estimating MYC binding at SAM68 promoter in IMEC-WT and M2 cells. Data are mean ± SEM ( n = 3). G qRT-PCR analysis of SAM68 gene expression in IMEC-WT and M2 cells. Data are mean ± SEM ( n = 3). H ChIP-qPCR of H3K4me3 deposition at KHDRBS1 ( SAM68 ) promoter in IMEC-WT and M2 cells. Data are mean ± SEM ( n = 3).
Gene Exp Khdrbs1 Hs00173141 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp khdrbs1 hs00173141 m1/product/Thermo Fisher
Average 85 stars, based on 1 article reviews
gene exp khdrbs1 hs00173141 m1 - by Bioz Stars, 2026-03
85/100 stars
  Buy from Supplier

91
OriGene flag sam68
A Workflow showing the selection strategy for <t>KHDRBS1</t> among DNA-damage response genes transcriptionally activated by Myc and significantly associated to breast cancer prognosis. Venn diagram showing the overlap between Myc-transcriptionally activated genes, DNA-damage response genes and genes associated to breast cancer. Specifically, genes were retrieved from: (i) microarray data of Myc-overexpressing mammospheres (M2) (GSE86407); (ii) published dataset (MD Anderson Human-DNA Repair Genes, https://www.mdanderson.org/documents/Labs/Wood-Laboratory/human-dna-repair-genes.html ), BioRad DNA-damage signaling pathway (SAB Target List H96) and recently published DNA-damage-associated genes (Supplementary Table ); and (iii) breast cancer versus normal breast tissues TCGA BRCA and GTeX gene expression data (Supplementary Table ). Genes were further selected for association to the worse relapse-free survival probability in breast cancer (Supplementary Table ) and novelty in the field, excluding known genes associated with BRCAness . B Box plot representing the distribution of log2 gene expression of KHDRBS1 retrieved from TCGA BRCA ( n = 1212) and GTeX ( n = 179) gene expression data (RNASeq2GeneNorm). p value was calculated with Wilcoxon rank sum test. C Kaplan–Meier plots of relapse-free survival (RFS) probability of BC patients stratified by high or low KHDRBS1 expression levels. D GSEA of DNA-repair gene signatures in IMEC-WT versus M2 ( n =3). E Scheme showing MYC and H3K4me3 PCR amplicons localization (red box) on IMEC-WT and M2 cells and layered H3K27ac signals on KHDRBS1 ( SAM68 ) promoter from ENCODE. Chromatin state was assessed by ChromHMM from ENCODE. MYC-MAX binding on multiple cell lines was assessed by ChIP-seq from ENCODE. F ChIP-qPCR estimating MYC binding at SAM68 promoter in IMEC-WT and M2 cells. Data are mean ± SEM ( n = 3). G qRT-PCR analysis of SAM68 gene expression in IMEC-WT and M2 cells. Data are mean ± SEM ( n = 3). H ChIP-qPCR of H3K4me3 deposition at KHDRBS1 ( SAM68 ) promoter in IMEC-WT and M2 cells. Data are mean ± SEM ( n = 3).
Flag Sam68, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/flag sam68/product/OriGene
Average 91 stars, based on 1 article reviews
flag sam68 - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

91
OriGene wild type sam68 khdrbs1
Reverse/β-turn peptidomimetic compounds are direct interactors of <t>Sam68</t> (A) Chemical structure of HAT inhibitor C646 and bromodomain ligand I-CBP112, as well as β-turn peptidomimetics ICG-001 and CWP232228. (B) Western blot analysis of CBP-catalyzed H3K14ac and H3K18ac histone acetylation marks in C646 (0.25 μM), I-CBP112 (0.25 μM), and CWP232228 (0.1 μM) t-hESCs versus control DMSO. Total histone H3 and GAPDH were used as loading control. Relative OD signal quantification versus H3 intensity is presented (C646: n = 3, I-CBP112: n = 5, CWP232228: n ≥ 3, ∗: p = 0.0183, ∗∗: p = 0.0078, ∗∗∗: p ≤ 0.00033, two-tailed t test). Data are represented as mean ± SEM (error bars). (C) Dose-response experiment assessing the impact of bromodomain ligand-based (C646 and I-CBP112), and peptidomimetic (CWP232228) inhibition of CBP on t-hESC growth (C646, I-CPB112: n = 4; CWP232228: n = 3). (D) Early endoderm differentiation assay performed in t-hESCs in the presence of CWP232228 (0.1 μM, n = 6), I-CBP112 (0.25 μM, n = 3), or C646 (0.25 μM, n = 3) versus control DMSO (n = 6) and basal culture media (n = 3). Bar graph represents relative counts of FOXA2-positive (early endoderm marker)/OCT4-negative cells in DMSO, CWP232228, I-CBP112, and C646-treated t-hESCs versus basal culture media (one-way ANOVA, ∗∗∗: p < 0.0001). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Pro-drug CWP232228 is converted into its active form CWP231904 via hydrolysis of the phosphate group by serum/cellular alkaline phosphatase. (F) Affinity pull-down experiments using CWP231904-conjugated magnetic beads performed on whole hESC lysates. Physical interaction between CBP, Sam68, beta-Catenin, ETS, MYB, GATA2, and PTMA with immobilized CWP231904 was assessed by immunoblotting. Each protein was previously shown as a member of the CBP interactome showing selective enrichment in human primary AML versus healthy blood ( <xref ref-type=Benoit et al., 2017 ). Excess of soluble compounds (CWP and ICG001, 100 μM) were used to compete with immobilized CWP231904. Whole-cell lysate was used as input, and amine-functionalized beads were used as negative control (n = 2). The heatmap presents mean background-corrected OD signal for each putative interactor tested (gray: not tested). " width="250" height="auto" />
Wild Type Sam68 Khdrbs1, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wild type sam68 khdrbs1/product/OriGene
Average 91 stars, based on 1 article reviews
wild type sam68 khdrbs1 - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

91
OriGene human khdrbs1 cdna
Reverse/β-turn peptidomimetic compounds are direct interactors of <t>Sam68</t> (A) Chemical structure of HAT inhibitor C646 and bromodomain ligand I-CBP112, as well as β-turn peptidomimetics ICG-001 and CWP232228. (B) Western blot analysis of CBP-catalyzed H3K14ac and H3K18ac histone acetylation marks in C646 (0.25 μM), I-CBP112 (0.25 μM), and CWP232228 (0.1 μM) t-hESCs versus control DMSO. Total histone H3 and GAPDH were used as loading control. Relative OD signal quantification versus H3 intensity is presented (C646: n = 3, I-CBP112: n = 5, CWP232228: n ≥ 3, ∗: p = 0.0183, ∗∗: p = 0.0078, ∗∗∗: p ≤ 0.00033, two-tailed t test). Data are represented as mean ± SEM (error bars). (C) Dose-response experiment assessing the impact of bromodomain ligand-based (C646 and I-CBP112), and peptidomimetic (CWP232228) inhibition of CBP on t-hESC growth (C646, I-CPB112: n = 4; CWP232228: n = 3). (D) Early endoderm differentiation assay performed in t-hESCs in the presence of CWP232228 (0.1 μM, n = 6), I-CBP112 (0.25 μM, n = 3), or C646 (0.25 μM, n = 3) versus control DMSO (n = 6) and basal culture media (n = 3). Bar graph represents relative counts of FOXA2-positive (early endoderm marker)/OCT4-negative cells in DMSO, CWP232228, I-CBP112, and C646-treated t-hESCs versus basal culture media (one-way ANOVA, ∗∗∗: p < 0.0001). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Pro-drug CWP232228 is converted into its active form CWP231904 via hydrolysis of the phosphate group by serum/cellular alkaline phosphatase. (F) Affinity pull-down experiments using CWP231904-conjugated magnetic beads performed on whole hESC lysates. Physical interaction between CBP, Sam68, beta-Catenin, ETS, MYB, GATA2, and PTMA with immobilized CWP231904 was assessed by immunoblotting. Each protein was previously shown as a member of the CBP interactome showing selective enrichment in human primary AML versus healthy blood ( <xref ref-type=Benoit et al., 2017 ). Excess of soluble compounds (CWP and ICG001, 100 μM) were used to compete with immobilized CWP231904. Whole-cell lysate was used as input, and amine-functionalized beads were used as negative control (n = 2). The heatmap presents mean background-corrected OD signal for each putative interactor tested (gray: not tested). " width="250" height="auto" />
Human Khdrbs1 Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human khdrbs1 cdna/product/OriGene
Average 91 stars, based on 1 article reviews
human khdrbs1 cdna - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

90
ABclonal Biotechnology antibody anti-khdrbs1
Reverse/β-turn peptidomimetic compounds are direct interactors of <t>Sam68</t> (A) Chemical structure of HAT inhibitor C646 and bromodomain ligand I-CBP112, as well as β-turn peptidomimetics ICG-001 and CWP232228. (B) Western blot analysis of CBP-catalyzed H3K14ac and H3K18ac histone acetylation marks in C646 (0.25 μM), I-CBP112 (0.25 μM), and CWP232228 (0.1 μM) t-hESCs versus control DMSO. Total histone H3 and GAPDH were used as loading control. Relative OD signal quantification versus H3 intensity is presented (C646: n = 3, I-CBP112: n = 5, CWP232228: n ≥ 3, ∗: p = 0.0183, ∗∗: p = 0.0078, ∗∗∗: p ≤ 0.00033, two-tailed t test). Data are represented as mean ± SEM (error bars). (C) Dose-response experiment assessing the impact of bromodomain ligand-based (C646 and I-CBP112), and peptidomimetic (CWP232228) inhibition of CBP on t-hESC growth (C646, I-CPB112: n = 4; CWP232228: n = 3). (D) Early endoderm differentiation assay performed in t-hESCs in the presence of CWP232228 (0.1 μM, n = 6), I-CBP112 (0.25 μM, n = 3), or C646 (0.25 μM, n = 3) versus control DMSO (n = 6) and basal culture media (n = 3). Bar graph represents relative counts of FOXA2-positive (early endoderm marker)/OCT4-negative cells in DMSO, CWP232228, I-CBP112, and C646-treated t-hESCs versus basal culture media (one-way ANOVA, ∗∗∗: p < 0.0001). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Pro-drug CWP232228 is converted into its active form CWP231904 via hydrolysis of the phosphate group by serum/cellular alkaline phosphatase. (F) Affinity pull-down experiments using CWP231904-conjugated magnetic beads performed on whole hESC lysates. Physical interaction between CBP, Sam68, beta-Catenin, ETS, MYB, GATA2, and PTMA with immobilized CWP231904 was assessed by immunoblotting. Each protein was previously shown as a member of the CBP interactome showing selective enrichment in human primary AML versus healthy blood ( <xref ref-type=Benoit et al., 2017 ). Excess of soluble compounds (CWP and ICG001, 100 μM) were used to compete with immobilized CWP231904. Whole-cell lysate was used as input, and amine-functionalized beads were used as negative control (n = 2). The heatmap presents mean background-corrected OD signal for each putative interactor tested (gray: not tested). " width="250" height="auto" />
Antibody Anti Khdrbs1, supplied by ABclonal Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibody anti-khdrbs1/product/ABclonal Biotechnology
Average 90 stars, based on 1 article reviews
antibody anti-khdrbs1 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GeneTex khdrbs1

Khdrbs1, supplied by GeneTex, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/khdrbs1/product/GeneTex
Average 90 stars, based on 1 article reviews
khdrbs1 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Musashi Engineering Inc musashi family khdrbs1

Musashi Family Khdrbs1, supplied by Musashi Engineering Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/musashi family khdrbs1/product/Musashi Engineering Inc
Average 90 stars, based on 1 article reviews
musashi family khdrbs1 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
MBL Life science anti-khdrbs1
KEY RESOURCES TABLE
Anti Khdrbs1, supplied by MBL Life science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-khdrbs1/product/MBL Life science
Average 90 stars, based on 1 article reviews
anti-khdrbs1 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GenScript corporation khdrbs1 expression plasmid
Arginine methylation of HNRNPUL2, <t>KHDRBS1(SAM68)</t> and SRSF1 is reduced in HD ISPNs ( A ) Total cell lysates from non-differentiated control (33CAG) and HD (180CAG) ISPNs were prepared as described in the Experimental Section. IPs with a mixture of mono-methyl (MMA) and asymmetric dimethyl (ADMA) antibodies were performed followed by western blot analysis with indicated protein-specific antibodies. Protein bands were visualized and quantified using the Licor System and Image Studio software. ( B ) – ( D ) Graphs (left) show the mean intensity values (±SEM) of the signal detected with antibodies to total HNRNPUL2, KHDRBS1(SAM68) and SRSF1 in the IPs normalized to the signal obtained from input lysates with the same antibodies. Total protein levels normalized to β-tubulin were also quantified (right graphs). n = 3 (biological replicates), Normality Test (Shapiro–Wilk): Passed, Equal Variance Test: Passed. T -test with equal variances was performed: (B) * 33CAG versus 180CAG, P 0.04. (C) * 33CAG versus 180CAG, P 0.0046. * * 33CAG versus 180CAG, P 0.0039.
Khdrbs1 Expression Plasmid, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/khdrbs1 expression plasmid/product/GenScript corporation
Average 90 stars, based on 1 article reviews
khdrbs1 expression plasmid - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
OriGene sam68 (khdrbs1) human sirna oligo duplex
Arginine methylation of HNRNPUL2, <t>KHDRBS1(SAM68)</t> and SRSF1 is reduced in HD ISPNs ( A ) Total cell lysates from non-differentiated control (33CAG) and HD (180CAG) ISPNs were prepared as described in the Experimental Section. IPs with a mixture of mono-methyl (MMA) and asymmetric dimethyl (ADMA) antibodies were performed followed by western blot analysis with indicated protein-specific antibodies. Protein bands were visualized and quantified using the Licor System and Image Studio software. ( B ) – ( D ) Graphs (left) show the mean intensity values (±SEM) of the signal detected with antibodies to total HNRNPUL2, KHDRBS1(SAM68) and SRSF1 in the IPs normalized to the signal obtained from input lysates with the same antibodies. Total protein levels normalized to β-tubulin were also quantified (right graphs). n = 3 (biological replicates), Normality Test (Shapiro–Wilk): Passed, Equal Variance Test: Passed. T -test with equal variances was performed: (B) * 33CAG versus 180CAG, P 0.04. (C) * 33CAG versus 180CAG, P 0.0046. * * 33CAG versus 180CAG, P 0.0039.
Sam68 (Khdrbs1) Human Sirna Oligo Duplex, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sam68 (khdrbs1) human sirna oligo duplex/product/OriGene
Average 90 stars, based on 1 article reviews
sam68 (khdrbs1) human sirna oligo duplex - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


A Workflow showing the selection strategy for KHDRBS1 among DNA-damage response genes transcriptionally activated by Myc and significantly associated to breast cancer prognosis. Venn diagram showing the overlap between Myc-transcriptionally activated genes, DNA-damage response genes and genes associated to breast cancer. Specifically, genes were retrieved from: (i) microarray data of Myc-overexpressing mammospheres (M2) (GSE86407); (ii) published dataset (MD Anderson Human-DNA Repair Genes, https://www.mdanderson.org/documents/Labs/Wood-Laboratory/human-dna-repair-genes.html ), BioRad DNA-damage signaling pathway (SAB Target List H96) and recently published DNA-damage-associated genes (Supplementary Table ); and (iii) breast cancer versus normal breast tissues TCGA BRCA and GTeX gene expression data (Supplementary Table ). Genes were further selected for association to the worse relapse-free survival probability in breast cancer (Supplementary Table ) and novelty in the field, excluding known genes associated with BRCAness . B Box plot representing the distribution of log2 gene expression of KHDRBS1 retrieved from TCGA BRCA ( n = 1212) and GTeX ( n = 179) gene expression data (RNASeq2GeneNorm). p value was calculated with Wilcoxon rank sum test. C Kaplan–Meier plots of relapse-free survival (RFS) probability of BC patients stratified by high or low KHDRBS1 expression levels. D GSEA of DNA-repair gene signatures in IMEC-WT versus M2 ( n =3). E Scheme showing MYC and H3K4me3 PCR amplicons localization (red box) on IMEC-WT and M2 cells and layered H3K27ac signals on KHDRBS1 ( SAM68 ) promoter from ENCODE. Chromatin state was assessed by ChromHMM from ENCODE. MYC-MAX binding on multiple cell lines was assessed by ChIP-seq from ENCODE. F ChIP-qPCR estimating MYC binding at SAM68 promoter in IMEC-WT and M2 cells. Data are mean ± SEM ( n = 3). G qRT-PCR analysis of SAM68 gene expression in IMEC-WT and M2 cells. Data are mean ± SEM ( n = 3). H ChIP-qPCR of H3K4me3 deposition at KHDRBS1 ( SAM68 ) promoter in IMEC-WT and M2 cells. Data are mean ± SEM ( n = 3).

Journal: Oncogene

Article Title: Effective targeting of breast cancer stem cells by combined inhibition of Sam68 and Rad51

doi: 10.1038/s41388-022-02239-4

Figure Lengend Snippet: A Workflow showing the selection strategy for KHDRBS1 among DNA-damage response genes transcriptionally activated by Myc and significantly associated to breast cancer prognosis. Venn diagram showing the overlap between Myc-transcriptionally activated genes, DNA-damage response genes and genes associated to breast cancer. Specifically, genes were retrieved from: (i) microarray data of Myc-overexpressing mammospheres (M2) (GSE86407); (ii) published dataset (MD Anderson Human-DNA Repair Genes, https://www.mdanderson.org/documents/Labs/Wood-Laboratory/human-dna-repair-genes.html ), BioRad DNA-damage signaling pathway (SAB Target List H96) and recently published DNA-damage-associated genes (Supplementary Table ); and (iii) breast cancer versus normal breast tissues TCGA BRCA and GTeX gene expression data (Supplementary Table ). Genes were further selected for association to the worse relapse-free survival probability in breast cancer (Supplementary Table ) and novelty in the field, excluding known genes associated with BRCAness . B Box plot representing the distribution of log2 gene expression of KHDRBS1 retrieved from TCGA BRCA ( n = 1212) and GTeX ( n = 179) gene expression data (RNASeq2GeneNorm). p value was calculated with Wilcoxon rank sum test. C Kaplan–Meier plots of relapse-free survival (RFS) probability of BC patients stratified by high or low KHDRBS1 expression levels. D GSEA of DNA-repair gene signatures in IMEC-WT versus M2 ( n =3). E Scheme showing MYC and H3K4me3 PCR amplicons localization (red box) on IMEC-WT and M2 cells and layered H3K27ac signals on KHDRBS1 ( SAM68 ) promoter from ENCODE. Chromatin state was assessed by ChromHMM from ENCODE. MYC-MAX binding on multiple cell lines was assessed by ChIP-seq from ENCODE. F ChIP-qPCR estimating MYC binding at SAM68 promoter in IMEC-WT and M2 cells. Data are mean ± SEM ( n = 3). G qRT-PCR analysis of SAM68 gene expression in IMEC-WT and M2 cells. Data are mean ± SEM ( n = 3). H ChIP-qPCR of H3K4me3 deposition at KHDRBS1 ( SAM68 ) promoter in IMEC-WT and M2 cells. Data are mean ± SEM ( n = 3).

Article Snippet: For single assay, total RNA was retrotranscribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and qRT-PCR was performed using the following primers: MYC (HS00153408_m1), KHDRBS1 (HS00173141_m1), RAD51 (HS00947967_m1), and GAPDH (Hs02786624_g1) (Applied Biosystem) and BRCA1 (For CTGAAGACTGCTCAGGGCTATC, Rev AGGGTAGCTGTTAGAAGGCTGG) and GAPDH (For GCTTCGCTCTCTGCTCCTCCTGT, Rev TACGACCAAATCCGTTGACTCCG).

Techniques: Selection, Microarray, Gene Expression, Expressing, Binding Assay, ChIP-sequencing, ChIP-qPCR, Quantitative RT-PCR

A Kaplan–Meier plots of distant relapse-free survival (DRFS) of BC patients stratified by high or low Sam68 protein expression levels. Patients were categorized according to all molecular subtypes ( n = 211) and Luminal-A ( n = 91), Luminal-B ( n = 61), HER2 + ( n = 27), TNBC ( n = 32), HER2 + + TNBC ( n = 59) BCs. B Box plot representing the distribution of log2 gene expression of KHDRBS1 retrieved from TCGA BRCA gene expression data (RNASeq2GeneNorm). p value was calculated with Wilcoxon rank sum test. The indicated statistics refer to each molecular subtype versus basal subtypes. * p value ≤ 0.05; ** p value ≤ 0.01; **** p value ≤ 0.0001. C ChIP-qPCR estimating MYC and MAX binding at SAM68 promoter in BCSphCs (#4 and #15). Data are mean ± SEM of two independent experiment for each BCSphCs. D Expression of Myc (green color) and Sam68 (red color) on paraffin-embedded sections on parental BC and corresponding PDX tissue. Nuclei were counterstained with Toto-3 (blue color). Scale bar represents 40 µm. E Relative mRNA expression levels of MYC and KHDRBS1 on BCSphCs (#4, #13, and #21) expressing a MycER fusion protein induced by 50 nM of OHT. Data are represented as fold mRNA level changes of OHT-treated cells over vehicle. Data are represented as mean ± SD of three independent experiments. * p value ≤ 0.05; ** p value ≤ 0.01. F Cell proliferation analysis of ER+ (MCF7), TNBC (BT549), TNBC BRCA mut (HCC1937) BC cell lines and BCSphCs (#1, #4, #13, and #21) transduced with doxycyclin-inducible non-targeting (nt) and short hairpin Sam68 (shSam68). Data are represented as fold variation of shSam68 over scr. ns not significant; ** p value ≤ 0.01. G Size of tumors generated by orthotopic injection of ER+ (MCF7), TNBC (BT549), TNBC BRCA mut (HCC1937) BC cell lines and BCSphCs (#4, #13) in immunocompromised mice (NOD/SCID) at the indicated time points. Data are expressed as mean ± SD ( n = 5 mice per group). ns not significant, *** p value ≤ 0.001.

Journal: Oncogene

Article Title: Effective targeting of breast cancer stem cells by combined inhibition of Sam68 and Rad51

doi: 10.1038/s41388-022-02239-4

Figure Lengend Snippet: A Kaplan–Meier plots of distant relapse-free survival (DRFS) of BC patients stratified by high or low Sam68 protein expression levels. Patients were categorized according to all molecular subtypes ( n = 211) and Luminal-A ( n = 91), Luminal-B ( n = 61), HER2 + ( n = 27), TNBC ( n = 32), HER2 + + TNBC ( n = 59) BCs. B Box plot representing the distribution of log2 gene expression of KHDRBS1 retrieved from TCGA BRCA gene expression data (RNASeq2GeneNorm). p value was calculated with Wilcoxon rank sum test. The indicated statistics refer to each molecular subtype versus basal subtypes. * p value ≤ 0.05; ** p value ≤ 0.01; **** p value ≤ 0.0001. C ChIP-qPCR estimating MYC and MAX binding at SAM68 promoter in BCSphCs (#4 and #15). Data are mean ± SEM of two independent experiment for each BCSphCs. D Expression of Myc (green color) and Sam68 (red color) on paraffin-embedded sections on parental BC and corresponding PDX tissue. Nuclei were counterstained with Toto-3 (blue color). Scale bar represents 40 µm. E Relative mRNA expression levels of MYC and KHDRBS1 on BCSphCs (#4, #13, and #21) expressing a MycER fusion protein induced by 50 nM of OHT. Data are represented as fold mRNA level changes of OHT-treated cells over vehicle. Data are represented as mean ± SD of three independent experiments. * p value ≤ 0.05; ** p value ≤ 0.01. F Cell proliferation analysis of ER+ (MCF7), TNBC (BT549), TNBC BRCA mut (HCC1937) BC cell lines and BCSphCs (#1, #4, #13, and #21) transduced with doxycyclin-inducible non-targeting (nt) and short hairpin Sam68 (shSam68). Data are represented as fold variation of shSam68 over scr. ns not significant; ** p value ≤ 0.01. G Size of tumors generated by orthotopic injection of ER+ (MCF7), TNBC (BT549), TNBC BRCA mut (HCC1937) BC cell lines and BCSphCs (#4, #13) in immunocompromised mice (NOD/SCID) at the indicated time points. Data are expressed as mean ± SD ( n = 5 mice per group). ns not significant, *** p value ≤ 0.001.

Article Snippet: For single assay, total RNA was retrotranscribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and qRT-PCR was performed using the following primers: MYC (HS00153408_m1), KHDRBS1 (HS00173141_m1), RAD51 (HS00947967_m1), and GAPDH (Hs02786624_g1) (Applied Biosystem) and BRCA1 (For CTGAAGACTGCTCAGGGCTATC, Rev AGGGTAGCTGTTAGAAGGCTGG) and GAPDH (For GCTTCGCTCTCTGCTCCTCCTGT, Rev TACGACCAAATCCGTTGACTCCG).

Techniques: Expressing, Gene Expression, ChIP-qPCR, Binding Assay, Transduction, Generated, Injection

A MYC binding on DNA-damage related genes transcription start sites (TSS) on IMEC-WT and M2 breast cells. B Representative immunofluorescence analysis of Rad51 foci formation in ER+ (MCF7), TNBC (BT549), TNBC BRCA mut (HCC1937) BC established cell lines and BCSphCs (#4) untreated (UT) and after 6 h of 8 Gy single dose γ-irradiation (IR). Nuclei were counterstained by Toto-3 (blue). Scale bar represents 10 µm. C Waterfall plot analysis of doxorubicin (DOX, 200 nM, left panel ), paclitaxel (PTX, 10 nM, middle panel ) and carboplatin (CARB, 100 µM, left panel ) response at 72 h in ER+ and TNBC BC established cell lines and BCSphCs. D Response rate distribution to chemotherapy for ER+ and TNBC BC established cell lines and BCSphCs treated as in ( C ). Middle line shows the median value of response per group, while single points represent the average value of BC cell response to DOX, PTX and CARB. Data are mean of three independent experiments. Statistical analysis was performed by using Kruskal–Wallis test. Ns not significant, * p value ≤ 0.05; ** p value ≤ 0.01. E Immunoblot analysis of PARP and Sam68 (input) and after immunoprecipitation (IP) with Sam68 antibody in BCSphCs (#15) treated for 4 h with vehicle, doxorubicin (DOX), paclitaxel (PTX) and carboplatin (CARB). Lamin-B was used as loading control. F Immunoblot analysis of nuclear PAR, PARP, and Sam68 in scramble (scr) and short hairpin Sam68 (shSam68) ER+ (MCF7), TNBC (BT549), and TNBC BRCA mut (HCC1937) BC cell lines and BCSphCs (#4) treated with vehicle, doxorubicin (DOX), paclitaxel (PTX) and carboplatin (CARB) for 4 h. H3 was used as loading control. G Cell proliferation analysis of ER+ (MCF7), TNBC (BT549), and TNBC BRCA mut (HCC1937) BC cell lines and BCSphCs (#1, #4, #13, #21) transduced with scramble and short hairpin Sam68 (shSam68) treated with vehicle, doxorubicin (DOX), paclitaxel (PTX) and carboplatin (CARB) for 72 h. Data are represented as fold variation of shSam68 over scramble. Data are mean ± SD of three independent experiments. ns not significant; * p value ≤ 0.05; ** p value ≤ 0.01. H , I Relative mRNA expression levels of RAD51 (H) and MYC (I) on scramble (scr) and short hairpin Sam68 (shSam68) ER+ (MCF7), TNBC (BT549), and TNBC BRCA mut (HCC1937) BC cell lines and BCSphCs (#12 and #13) treated with vehicle, doxorubicin (DOX), paclitaxel (PTX), and carboplatin (CARB) for 24 h. Data are represented as fold mRNA level changes of treated scr and shSam68 cells over vehicle. Data are represented as mean ± SD of three independent experiments. Ns not significant, * p value ≤ 0.05; ** p value ≤ 0.01; *** p value ≤ 0.001.

Journal: Oncogene

Article Title: Effective targeting of breast cancer stem cells by combined inhibition of Sam68 and Rad51

doi: 10.1038/s41388-022-02239-4

Figure Lengend Snippet: A MYC binding on DNA-damage related genes transcription start sites (TSS) on IMEC-WT and M2 breast cells. B Representative immunofluorescence analysis of Rad51 foci formation in ER+ (MCF7), TNBC (BT549), TNBC BRCA mut (HCC1937) BC established cell lines and BCSphCs (#4) untreated (UT) and after 6 h of 8 Gy single dose γ-irradiation (IR). Nuclei were counterstained by Toto-3 (blue). Scale bar represents 10 µm. C Waterfall plot analysis of doxorubicin (DOX, 200 nM, left panel ), paclitaxel (PTX, 10 nM, middle panel ) and carboplatin (CARB, 100 µM, left panel ) response at 72 h in ER+ and TNBC BC established cell lines and BCSphCs. D Response rate distribution to chemotherapy for ER+ and TNBC BC established cell lines and BCSphCs treated as in ( C ). Middle line shows the median value of response per group, while single points represent the average value of BC cell response to DOX, PTX and CARB. Data are mean of three independent experiments. Statistical analysis was performed by using Kruskal–Wallis test. Ns not significant, * p value ≤ 0.05; ** p value ≤ 0.01. E Immunoblot analysis of PARP and Sam68 (input) and after immunoprecipitation (IP) with Sam68 antibody in BCSphCs (#15) treated for 4 h with vehicle, doxorubicin (DOX), paclitaxel (PTX) and carboplatin (CARB). Lamin-B was used as loading control. F Immunoblot analysis of nuclear PAR, PARP, and Sam68 in scramble (scr) and short hairpin Sam68 (shSam68) ER+ (MCF7), TNBC (BT549), and TNBC BRCA mut (HCC1937) BC cell lines and BCSphCs (#4) treated with vehicle, doxorubicin (DOX), paclitaxel (PTX) and carboplatin (CARB) for 4 h. H3 was used as loading control. G Cell proliferation analysis of ER+ (MCF7), TNBC (BT549), and TNBC BRCA mut (HCC1937) BC cell lines and BCSphCs (#1, #4, #13, #21) transduced with scramble and short hairpin Sam68 (shSam68) treated with vehicle, doxorubicin (DOX), paclitaxel (PTX) and carboplatin (CARB) for 72 h. Data are represented as fold variation of shSam68 over scramble. Data are mean ± SD of three independent experiments. ns not significant; * p value ≤ 0.05; ** p value ≤ 0.01. H , I Relative mRNA expression levels of RAD51 (H) and MYC (I) on scramble (scr) and short hairpin Sam68 (shSam68) ER+ (MCF7), TNBC (BT549), and TNBC BRCA mut (HCC1937) BC cell lines and BCSphCs (#12 and #13) treated with vehicle, doxorubicin (DOX), paclitaxel (PTX), and carboplatin (CARB) for 24 h. Data are represented as fold mRNA level changes of treated scr and shSam68 cells over vehicle. Data are represented as mean ± SD of three independent experiments. Ns not significant, * p value ≤ 0.05; ** p value ≤ 0.01; *** p value ≤ 0.001.

Article Snippet: For single assay, total RNA was retrotranscribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and qRT-PCR was performed using the following primers: MYC (HS00153408_m1), KHDRBS1 (HS00173141_m1), RAD51 (HS00947967_m1), and GAPDH (Hs02786624_g1) (Applied Biosystem) and BRCA1 (For CTGAAGACTGCTCAGGGCTATC, Rev AGGGTAGCTGTTAGAAGGCTGG) and GAPDH (For GCTTCGCTCTCTGCTCCTCCTGT, Rev TACGACCAAATCCGTTGACTCCG).

Techniques: Binding Assay, Immunofluorescence, Irradiation, Western Blot, Immunoprecipitation, Control, Transduction, Expressing

A Schematic model of DNA-repair signaling pathways mediating the resistance of BC stem-like cells to chemotherapy. B Workflow of purification of sphere cells from serially transplanted BC PDX and their use for in vitro and in vivo drug toxicity testing. C Size of tumors generated by orthotopic injection of scramble (scr) and short hairpin Sam68 (shSam68) BCSphCs treated with vehicle (veh) and BO2. Arrows indicate the start and the end of treatment. Data are expressed as mean of tumors generated by the injection of BCSphCs (#4, #13, and #21) ± SEM ( n = 5 mice per group). D Size of tumors generated by orthotopic injection of scramble (scr) and short hairpin Sam68 (shSam68) BCSphCs (#4, #13, #21) treated with vehicle, olaparib, BO2, cisplatin and olaparib plus BO2 and olaparib plus cisplatin and BO2. Arrows indicate the beginning and the end of treatment. Data are expressed as mean of tumors generated by the injection of BCSphCs (#4, #13, and #21) ± SEM ( n = 5 mice per group). **** p value ≤ 0.0001. E Immunoblot analysis of Rad51 in BCSphCs (#15) treated with dinaciclib for 24 h at the indicated concentration. Β-actin was used as loading control. F Cell viability percentage of scramble (scr) and short hairpin Sam68 (shSam68) BCSphCs (#4, #13, #15, and #21) treated with vehicle and dinaciclib (10 nM) for 6 days. Data are represented as mean ± SEM ( n = 2). * p value ≤ 0.05; *** p value ≤ 0.001. G Representative images ( left panel ) and quantification of area ( right panel ) of BC sphere cells (#21), transduced with scramble (scr) and short hairpin Sam68 (shSam68) lentiviral vectors, treated with vehicle and dinaciclib for 6 days. Data are represented as mean ± SEM ( n = 3). Ns not significant, ** p value ≤ 0.01; *** p value ≤ 0.001. Scale bar represents 100 µm. H Size of tumors generated by orthotopic injection of scramble (scr) and short hairpin Sam68 (shSam68) BCSphCs treated with vehicle (veh) and dinaciclib (din). Arrows indicate the start and the end of treatment. Data are expressed as mean of tumors generated by the injection of BCSphCs (#4, #7, #13) ± SEM ( n = 5 mice per group). **** p value ≤ 0.0001. I Cell viability percentage of BCSphCs (#4, #13, #14, #15, #21) treated with vehicle, olaparib and dinaciclib, alone or in combination, at the indicated concentrations for 6 days. Data are represented as mean ± SD ( n = 3). J Synergy plot representing the combination index (CI), computed in CompuSyn by using Chou-Talalay method, for each olaparib and dinaciclib dose pair, calculated from cell viability data of BCSphCs (#13). K Size of tumors generated by orthotopic injection of BCSphCs treated with vehicle, olaparib, dinaciclib and olaparib plus dinaciclib. Arrows indicate the start and the end of treatment. Data are expressed as mean of tumors generated with BCSphCs (#4, #7, #13) ± SEM ( n = 5 mice per group). *** p value ≤ 0.001.

Journal: Oncogene

Article Title: Effective targeting of breast cancer stem cells by combined inhibition of Sam68 and Rad51

doi: 10.1038/s41388-022-02239-4

Figure Lengend Snippet: A Schematic model of DNA-repair signaling pathways mediating the resistance of BC stem-like cells to chemotherapy. B Workflow of purification of sphere cells from serially transplanted BC PDX and their use for in vitro and in vivo drug toxicity testing. C Size of tumors generated by orthotopic injection of scramble (scr) and short hairpin Sam68 (shSam68) BCSphCs treated with vehicle (veh) and BO2. Arrows indicate the start and the end of treatment. Data are expressed as mean of tumors generated by the injection of BCSphCs (#4, #13, and #21) ± SEM ( n = 5 mice per group). D Size of tumors generated by orthotopic injection of scramble (scr) and short hairpin Sam68 (shSam68) BCSphCs (#4, #13, #21) treated with vehicle, olaparib, BO2, cisplatin and olaparib plus BO2 and olaparib plus cisplatin and BO2. Arrows indicate the beginning and the end of treatment. Data are expressed as mean of tumors generated by the injection of BCSphCs (#4, #13, and #21) ± SEM ( n = 5 mice per group). **** p value ≤ 0.0001. E Immunoblot analysis of Rad51 in BCSphCs (#15) treated with dinaciclib for 24 h at the indicated concentration. Β-actin was used as loading control. F Cell viability percentage of scramble (scr) and short hairpin Sam68 (shSam68) BCSphCs (#4, #13, #15, and #21) treated with vehicle and dinaciclib (10 nM) for 6 days. Data are represented as mean ± SEM ( n = 2). * p value ≤ 0.05; *** p value ≤ 0.001. G Representative images ( left panel ) and quantification of area ( right panel ) of BC sphere cells (#21), transduced with scramble (scr) and short hairpin Sam68 (shSam68) lentiviral vectors, treated with vehicle and dinaciclib for 6 days. Data are represented as mean ± SEM ( n = 3). Ns not significant, ** p value ≤ 0.01; *** p value ≤ 0.001. Scale bar represents 100 µm. H Size of tumors generated by orthotopic injection of scramble (scr) and short hairpin Sam68 (shSam68) BCSphCs treated with vehicle (veh) and dinaciclib (din). Arrows indicate the start and the end of treatment. Data are expressed as mean of tumors generated by the injection of BCSphCs (#4, #7, #13) ± SEM ( n = 5 mice per group). **** p value ≤ 0.0001. I Cell viability percentage of BCSphCs (#4, #13, #14, #15, #21) treated with vehicle, olaparib and dinaciclib, alone or in combination, at the indicated concentrations for 6 days. Data are represented as mean ± SD ( n = 3). J Synergy plot representing the combination index (CI), computed in CompuSyn by using Chou-Talalay method, for each olaparib and dinaciclib dose pair, calculated from cell viability data of BCSphCs (#13). K Size of tumors generated by orthotopic injection of BCSphCs treated with vehicle, olaparib, dinaciclib and olaparib plus dinaciclib. Arrows indicate the start and the end of treatment. Data are expressed as mean of tumors generated with BCSphCs (#4, #7, #13) ± SEM ( n = 5 mice per group). *** p value ≤ 0.001.

Article Snippet: For single assay, total RNA was retrotranscribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and qRT-PCR was performed using the following primers: MYC (HS00153408_m1), KHDRBS1 (HS00173141_m1), RAD51 (HS00947967_m1), and GAPDH (Hs02786624_g1) (Applied Biosystem) and BRCA1 (For CTGAAGACTGCTCAGGGCTATC, Rev AGGGTAGCTGTTAGAAGGCTGG) and GAPDH (For GCTTCGCTCTCTGCTCCTCCTGT, Rev TACGACCAAATCCGTTGACTCCG).

Techniques: Protein-Protein interactions, Purification, In Vitro, In Vivo, Generated, Injection, Western Blot, Concentration Assay, Control, Transduction

A Cell viability percentage of scramble (scr) and short hairpin Sam68 (shSam68) ER+ R (MCF7) BC cell line treated with vehicle and dinaciclib (10 nM) for 6 days. Data are represented as mean ± SEM ( n = 4). * p value ≤ 0.05; ** p value ≤ 0.01; *** p value ≤ 0.001. B Relative mRNA expression levels of RAD51 and MYC on scramble (scr) and short hairpin Sam68 (shSam68) ER+ R (MCF7) BC cells treated with vehicle and dinaciclib for 6 days. Data are represented as fold mRNA level changes of treated scr and shSam68 over vehicle ( n = 3). C Cell viability percentage in ER+ R (MCF7) BC cells treated with vehicle, olaparib and dinaciclib, alone or in combination, at the indicated concentrations for 6 days. Data are represented as mean ± SD ( n = 3). D Kaplan–Meier plots of relapse-free survival (RFS) probability of BC patients of all molecular subtypes stratified by high or low MYC , KHDRBS1 , and RAD51 expression levels. E Schematic model showing the persistence of a BC stem-like population, characterized by high expression levels of MYC, SAM68 , and RAD51 , following standard anticancer therapies.

Journal: Oncogene

Article Title: Effective targeting of breast cancer stem cells by combined inhibition of Sam68 and Rad51

doi: 10.1038/s41388-022-02239-4

Figure Lengend Snippet: A Cell viability percentage of scramble (scr) and short hairpin Sam68 (shSam68) ER+ R (MCF7) BC cell line treated with vehicle and dinaciclib (10 nM) for 6 days. Data are represented as mean ± SEM ( n = 4). * p value ≤ 0.05; ** p value ≤ 0.01; *** p value ≤ 0.001. B Relative mRNA expression levels of RAD51 and MYC on scramble (scr) and short hairpin Sam68 (shSam68) ER+ R (MCF7) BC cells treated with vehicle and dinaciclib for 6 days. Data are represented as fold mRNA level changes of treated scr and shSam68 over vehicle ( n = 3). C Cell viability percentage in ER+ R (MCF7) BC cells treated with vehicle, olaparib and dinaciclib, alone or in combination, at the indicated concentrations for 6 days. Data are represented as mean ± SD ( n = 3). D Kaplan–Meier plots of relapse-free survival (RFS) probability of BC patients of all molecular subtypes stratified by high or low MYC , KHDRBS1 , and RAD51 expression levels. E Schematic model showing the persistence of a BC stem-like population, characterized by high expression levels of MYC, SAM68 , and RAD51 , following standard anticancer therapies.

Article Snippet: For single assay, total RNA was retrotranscribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and qRT-PCR was performed using the following primers: MYC (HS00153408_m1), KHDRBS1 (HS00173141_m1), RAD51 (HS00947967_m1), and GAPDH (Hs02786624_g1) (Applied Biosystem) and BRCA1 (For CTGAAGACTGCTCAGGGCTATC, Rev AGGGTAGCTGTTAGAAGGCTGG) and GAPDH (For GCTTCGCTCTCTGCTCCTCCTGT, Rev TACGACCAAATCCGTTGACTCCG).

Techniques: Expressing

Reverse/β-turn peptidomimetic compounds are direct interactors of Sam68 (A) Chemical structure of HAT inhibitor C646 and bromodomain ligand I-CBP112, as well as β-turn peptidomimetics ICG-001 and CWP232228. (B) Western blot analysis of CBP-catalyzed H3K14ac and H3K18ac histone acetylation marks in C646 (0.25 μM), I-CBP112 (0.25 μM), and CWP232228 (0.1 μM) t-hESCs versus control DMSO. Total histone H3 and GAPDH were used as loading control. Relative OD signal quantification versus H3 intensity is presented (C646: n = 3, I-CBP112: n = 5, CWP232228: n ≥ 3, ∗: p = 0.0183, ∗∗: p = 0.0078, ∗∗∗: p ≤ 0.00033, two-tailed t test). Data are represented as mean ± SEM (error bars). (C) Dose-response experiment assessing the impact of bromodomain ligand-based (C646 and I-CBP112), and peptidomimetic (CWP232228) inhibition of CBP on t-hESC growth (C646, I-CPB112: n = 4; CWP232228: n = 3). (D) Early endoderm differentiation assay performed in t-hESCs in the presence of CWP232228 (0.1 μM, n = 6), I-CBP112 (0.25 μM, n = 3), or C646 (0.25 μM, n = 3) versus control DMSO (n = 6) and basal culture media (n = 3). Bar graph represents relative counts of FOXA2-positive (early endoderm marker)/OCT4-negative cells in DMSO, CWP232228, I-CBP112, and C646-treated t-hESCs versus basal culture media (one-way ANOVA, ∗∗∗: p < 0.0001). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Pro-drug CWP232228 is converted into its active form CWP231904 via hydrolysis of the phosphate group by serum/cellular alkaline phosphatase. (F) Affinity pull-down experiments using CWP231904-conjugated magnetic beads performed on whole hESC lysates. Physical interaction between CBP, Sam68, beta-Catenin, ETS, MYB, GATA2, and PTMA with immobilized CWP231904 was assessed by immunoblotting. Each protein was previously shown as a member of the CBP interactome showing selective enrichment in human primary AML versus healthy blood ( <xref ref-type=Benoit et al., 2017 ). Excess of soluble compounds (CWP and ICG001, 100 μM) were used to compete with immobilized CWP231904. Whole-cell lysate was used as input, and amine-functionalized beads were used as negative control (n = 2). The heatmap presents mean background-corrected OD signal for each putative interactor tested (gray: not tested). " width="100%" height="100%">

Journal: iScience

Article Title: Pharmacological targeting of Sam68 functions in colorectal cancer stem cells

doi: 10.1016/j.isci.2021.103442

Figure Lengend Snippet: Reverse/β-turn peptidomimetic compounds are direct interactors of Sam68 (A) Chemical structure of HAT inhibitor C646 and bromodomain ligand I-CBP112, as well as β-turn peptidomimetics ICG-001 and CWP232228. (B) Western blot analysis of CBP-catalyzed H3K14ac and H3K18ac histone acetylation marks in C646 (0.25 μM), I-CBP112 (0.25 μM), and CWP232228 (0.1 μM) t-hESCs versus control DMSO. Total histone H3 and GAPDH were used as loading control. Relative OD signal quantification versus H3 intensity is presented (C646: n = 3, I-CBP112: n = 5, CWP232228: n ≥ 3, ∗: p = 0.0183, ∗∗: p = 0.0078, ∗∗∗: p ≤ 0.00033, two-tailed t test). Data are represented as mean ± SEM (error bars). (C) Dose-response experiment assessing the impact of bromodomain ligand-based (C646 and I-CBP112), and peptidomimetic (CWP232228) inhibition of CBP on t-hESC growth (C646, I-CPB112: n = 4; CWP232228: n = 3). (D) Early endoderm differentiation assay performed in t-hESCs in the presence of CWP232228 (0.1 μM, n = 6), I-CBP112 (0.25 μM, n = 3), or C646 (0.25 μM, n = 3) versus control DMSO (n = 6) and basal culture media (n = 3). Bar graph represents relative counts of FOXA2-positive (early endoderm marker)/OCT4-negative cells in DMSO, CWP232228, I-CBP112, and C646-treated t-hESCs versus basal culture media (one-way ANOVA, ∗∗∗: p < 0.0001). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Pro-drug CWP232228 is converted into its active form CWP231904 via hydrolysis of the phosphate group by serum/cellular alkaline phosphatase. (F) Affinity pull-down experiments using CWP231904-conjugated magnetic beads performed on whole hESC lysates. Physical interaction between CBP, Sam68, beta-Catenin, ETS, MYB, GATA2, and PTMA with immobilized CWP231904 was assessed by immunoblotting. Each protein was previously shown as a member of the CBP interactome showing selective enrichment in human primary AML versus healthy blood ( Benoit et al., 2017 ). Excess of soluble compounds (CWP and ICG001, 100 μM) were used to compete with immobilized CWP231904. Whole-cell lysate was used as input, and amine-functionalized beads were used as negative control (n = 2). The heatmap presents mean background-corrected OD signal for each putative interactor tested (gray: not tested).

Article Snippet: Custom mutagenesis of human KHDRBS1 cDNA and cloning into pLenti-mGFP-P2A-Puro vector was performed by OriGene Technologies, and lentiviral particles for control, wild-type Sam68/ KHDRBS1 , and G305N Sam68/ KHDRBS1 overexpression were generated as above-described.

Techniques: Western Blot, Two Tailed Test, Inhibition, Differentiation Assay, Marker, Magnetic Beads, Negative Control

In silico screening of peptidomimetics with enhanced binding affinity for Sam68 (A) Representation of Sam68 interacting with SH3 domain in Src kinase family proteins via proline-rich motifs located in N-terminal P1-P2 and between residues 275 and 374 (P3, P4, P5). Small molecule UCS15A is known to disrupt SH3-mediated interaction of Src with Sam68 P3-5 domains ( <xref ref-type=Sharma et al., 2001 ). (B) 2D representation of UCS15A and the peptidomimetic ICG-001 in silico predicted binding pocket in Sam68 275-374 peptide (red, oxygen; blue, nitrogen). Common residues involved in both small-molecule-binding pockets are highlighted in red. Predicted hydrogen bond length is represented by dashed lines (Å). (C) Schematic representation of the in silico structure-activity relationship analysis pipeline (PyRx) used to identify β-turn peptidomimetic molecules with enhanced binding affinity for Sam68 275-374 domain. “A” and “B” represent the positions of distinct substituents added to reverse-turn mimetic cores. (D) Dose-response curves assessing selective toxicity of peptidomimetics ICG-001, CWP232228, and PRI-724 in HT29 human colorectal cancer cell line versus normal intestinal progenitor cells HIEC (n ≥ 4, 48-h treatments). (E) Compound ranking based on predicted Keq for each β-turn analog (black dots). Only molecules presenting a standard deviation below 0.1 for a minimum of three analysis runs, with an exhaustiveness (“E”) level of “8” were plotted. Dots corresponding to ICG-001, CWP231904, PRI-724-OH, and YB-0159 were highlighted in red. Random structure ranking is represented by green dots. See also . (F) Structure of YB-0158, a phosphate-stabilized prodrug of YB-0159. (G) Docked poses of CWP231904 (left) and YB-0159 (right) in human Sam68 257-374 fragment (red, oxygen; blue, nitrogen). Glycine 305 is highlighted in red, where distinct hydrogen bond (gray dashed line) was predicted between YB-0159 and Sam68. The inset in the right pose represents a higher magnification view of the predicted hydrogen bond formation between YB-0158 and Gly305. See also . " width="100%" height="100%">

Journal: iScience

Article Title: Pharmacological targeting of Sam68 functions in colorectal cancer stem cells

doi: 10.1016/j.isci.2021.103442

Figure Lengend Snippet: In silico screening of peptidomimetics with enhanced binding affinity for Sam68 (A) Representation of Sam68 interacting with SH3 domain in Src kinase family proteins via proline-rich motifs located in N-terminal P1-P2 and between residues 275 and 374 (P3, P4, P5). Small molecule UCS15A is known to disrupt SH3-mediated interaction of Src with Sam68 P3-5 domains ( Sharma et al., 2001 ). (B) 2D representation of UCS15A and the peptidomimetic ICG-001 in silico predicted binding pocket in Sam68 275-374 peptide (red, oxygen; blue, nitrogen). Common residues involved in both small-molecule-binding pockets are highlighted in red. Predicted hydrogen bond length is represented by dashed lines (Å). (C) Schematic representation of the in silico structure-activity relationship analysis pipeline (PyRx) used to identify β-turn peptidomimetic molecules with enhanced binding affinity for Sam68 275-374 domain. “A” and “B” represent the positions of distinct substituents added to reverse-turn mimetic cores. (D) Dose-response curves assessing selective toxicity of peptidomimetics ICG-001, CWP232228, and PRI-724 in HT29 human colorectal cancer cell line versus normal intestinal progenitor cells HIEC (n ≥ 4, 48-h treatments). (E) Compound ranking based on predicted Keq for each β-turn analog (black dots). Only molecules presenting a standard deviation below 0.1 for a minimum of three analysis runs, with an exhaustiveness (“E”) level of “8” were plotted. Dots corresponding to ICG-001, CWP231904, PRI-724-OH, and YB-0159 were highlighted in red. Random structure ranking is represented by green dots. See also . (F) Structure of YB-0158, a phosphate-stabilized prodrug of YB-0159. (G) Docked poses of CWP231904 (left) and YB-0159 (right) in human Sam68 257-374 fragment (red, oxygen; blue, nitrogen). Glycine 305 is highlighted in red, where distinct hydrogen bond (gray dashed line) was predicted between YB-0159 and Sam68. The inset in the right pose represents a higher magnification view of the predicted hydrogen bond formation between YB-0158 and Gly305. See also .

Article Snippet: Custom mutagenesis of human KHDRBS1 cDNA and cloning into pLenti-mGFP-P2A-Puro vector was performed by OriGene Technologies, and lentiviral particles for control, wild-type Sam68/ KHDRBS1 , and G305N Sam68/ KHDRBS1 overexpression were generated as above-described.

Techniques: In Silico, Binding Assay, Activity Assay, Standard Deviation

YB-0158 alters Sam68 biology in human cancer cells (A) Dose-response experiment assessing growth inhibition caused by peptidomimetics analogs CWP232228 and YB-0158 in t-hESCs (n = 3, 48-h treatments). Calculated EC 50 for each small molecule is presented in the inset table. See also . (B) Dose-response experiment assessing growth inhibition caused by peptidomimetic analogs CWP232228 and YB-0158 in HT29 colorectal cancer cells (n = 2, 48-h treatments). Calculated EC 50 for each small molecule is presented in the inset table. (C) Co-immunoprecipitation (IP) assessing changes in interaction levels between Src and Sam68 in response to CWP232228 (1.5 μM) and YB-0158 (0.3 μM) in HT29 cells (48 h) (n = 3, ∗: p = 0.021, ∗∗: p = 0.0088, two-tailed t test). Data are represented as mean ± SEM (error bars). Mouse IgGs were used as negative control for pull down. (D) Immunofluorescence staining of Sam68 in DMSO, CWP232228, and YB-0158-treated t-hESCs (48 h, n = 9). Quantification of nuclear Sam68 was performed by high-content imaging and presented as relative levels versus DMSO (∗∗: p < 0.01, ∗∗∗: p < 0.0001, two-tailed t test). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Quantification of nuclear Sam68 in HT29 cells treated with increasing doses of YB-0158, in the presence (n = 4) or absence (n = 3) of a PRMT1 inhibitor (Furamidine, 10 μM). Cells were treated for 48 h and nuclear Sam68 immunostaining was quantified by high-content imaging. Data are represented as mean ± SEM (error bars). (F) Western blot analysis of Sam68 levels in normal human intestinal progenitor cells HIEC; human colorectal cancer SW480, HT29, and HCT116 lines; mouse colon adenocarcinoma MC38 cells; t-hESCs; as well as patient-derived CSC-enriched spheroids and 3D organoids from colorectal tumor samples (n ≥ 3). Relative OD signal quantification for Sam68 versus loading control (GAPDH) is presented. (G) Dose-response experiment monitoring growth of normal intestinal cells HIEC, as well as HT29, SW480, and HCT116 colorectal cancer lines treated with YB-0158 (n ≥ 3, 48 h). A significant correlation was established between calculated EC 50 and Sam68 expression (R 2 = 0.8510, p < 0.0001, simple linear regression). (H) Cell growth experiment in HCT116 cells transduced with control/empty-mGFP (pLenti Control) or KHDRBS1 -mGFP (pLenti Sam68) overexpression vectors and treated with YB-0158 (0.3 μM, 48 h) or vehicle control (DMSO). GFP-positive cell counts upon treatments are presented versus their corresponding DMSO-treated group (n = 7, ∗∗: p = 0.003, two-tailed t test). Data are represented as mean ± SEM (error bars). (I) Cell growth experiment using HCT116 cells overexpressing wild-type Sam68 ( KHDRBS1 ) (wt Sam68) or with a mutated G305 motif (G305N Sam68) and subjected to increasing doses of YB-0158 (0.08–10 μM versus DMSO control) for 48 h. Residual transduced cells (GFP reporter) were counted for each dose and presented versus DMSO control (n ≤ 5, ∗∗∗: p < 0.001, two-tailed t test). Data are represented as mean ± SEM (error bars).

Journal: iScience

Article Title: Pharmacological targeting of Sam68 functions in colorectal cancer stem cells

doi: 10.1016/j.isci.2021.103442

Figure Lengend Snippet: YB-0158 alters Sam68 biology in human cancer cells (A) Dose-response experiment assessing growth inhibition caused by peptidomimetics analogs CWP232228 and YB-0158 in t-hESCs (n = 3, 48-h treatments). Calculated EC 50 for each small molecule is presented in the inset table. See also . (B) Dose-response experiment assessing growth inhibition caused by peptidomimetic analogs CWP232228 and YB-0158 in HT29 colorectal cancer cells (n = 2, 48-h treatments). Calculated EC 50 for each small molecule is presented in the inset table. (C) Co-immunoprecipitation (IP) assessing changes in interaction levels between Src and Sam68 in response to CWP232228 (1.5 μM) and YB-0158 (0.3 μM) in HT29 cells (48 h) (n = 3, ∗: p = 0.021, ∗∗: p = 0.0088, two-tailed t test). Data are represented as mean ± SEM (error bars). Mouse IgGs were used as negative control for pull down. (D) Immunofluorescence staining of Sam68 in DMSO, CWP232228, and YB-0158-treated t-hESCs (48 h, n = 9). Quantification of nuclear Sam68 was performed by high-content imaging and presented as relative levels versus DMSO (∗∗: p < 0.01, ∗∗∗: p < 0.0001, two-tailed t test). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Quantification of nuclear Sam68 in HT29 cells treated with increasing doses of YB-0158, in the presence (n = 4) or absence (n = 3) of a PRMT1 inhibitor (Furamidine, 10 μM). Cells were treated for 48 h and nuclear Sam68 immunostaining was quantified by high-content imaging. Data are represented as mean ± SEM (error bars). (F) Western blot analysis of Sam68 levels in normal human intestinal progenitor cells HIEC; human colorectal cancer SW480, HT29, and HCT116 lines; mouse colon adenocarcinoma MC38 cells; t-hESCs; as well as patient-derived CSC-enriched spheroids and 3D organoids from colorectal tumor samples (n ≥ 3). Relative OD signal quantification for Sam68 versus loading control (GAPDH) is presented. (G) Dose-response experiment monitoring growth of normal intestinal cells HIEC, as well as HT29, SW480, and HCT116 colorectal cancer lines treated with YB-0158 (n ≥ 3, 48 h). A significant correlation was established between calculated EC 50 and Sam68 expression (R 2 = 0.8510, p < 0.0001, simple linear regression). (H) Cell growth experiment in HCT116 cells transduced with control/empty-mGFP (pLenti Control) or KHDRBS1 -mGFP (pLenti Sam68) overexpression vectors and treated with YB-0158 (0.3 μM, 48 h) or vehicle control (DMSO). GFP-positive cell counts upon treatments are presented versus their corresponding DMSO-treated group (n = 7, ∗∗: p = 0.003, two-tailed t test). Data are represented as mean ± SEM (error bars). (I) Cell growth experiment using HCT116 cells overexpressing wild-type Sam68 ( KHDRBS1 ) (wt Sam68) or with a mutated G305 motif (G305N Sam68) and subjected to increasing doses of YB-0158 (0.08–10 μM versus DMSO control) for 48 h. Residual transduced cells (GFP reporter) were counted for each dose and presented versus DMSO control (n ≤ 5, ∗∗∗: p < 0.001, two-tailed t test). Data are represented as mean ± SEM (error bars).

Article Snippet: Custom mutagenesis of human KHDRBS1 cDNA and cloning into pLenti-mGFP-P2A-Puro vector was performed by OriGene Technologies, and lentiviral particles for control, wild-type Sam68/ KHDRBS1 , and G305N Sam68/ KHDRBS1 overexpression were generated as above-described.

Techniques: Inhibition, Immunoprecipitation, Two Tailed Test, Negative Control, Immunofluorescence, Staining, Imaging, Immunostaining, Western Blot, Derivative Assay, Expressing, Transduction, Over Expression

Journal: iScience

Article Title: Pharmacological targeting of Sam68 functions in colorectal cancer stem cells

doi: 10.1016/j.isci.2021.103442

Figure Lengend Snippet:

Article Snippet: Custom mutagenesis of human KHDRBS1 cDNA and cloning into pLenti-mGFP-P2A-Puro vector was performed by OriGene Technologies, and lentiviral particles for control, wild-type Sam68/ KHDRBS1 , and G305N Sam68/ KHDRBS1 overexpression were generated as above-described.

Techniques: Recombinant, Derivative Assay, Immunoprecipitation, Staining, Chromatin Immunoprecipitation, DNA Purification, SYBR Green Assay, Purification, Western Blot, RNA Sequencing Assay, Sequencing, Expressing, Transformation Assay, shRNA, Software

Reverse/β-turn peptidomimetic compounds are direct interactors of Sam68 (A) Chemical structure of HAT inhibitor C646 and bromodomain ligand I-CBP112, as well as β-turn peptidomimetics ICG-001 and CWP232228. (B) Western blot analysis of CBP-catalyzed H3K14ac and H3K18ac histone acetylation marks in C646 (0.25 μM), I-CBP112 (0.25 μM), and CWP232228 (0.1 μM) t-hESCs versus control DMSO. Total histone H3 and GAPDH were used as loading control. Relative OD signal quantification versus H3 intensity is presented (C646: n = 3, I-CBP112: n = 5, CWP232228: n ≥ 3, ∗: p = 0.0183, ∗∗: p = 0.0078, ∗∗∗: p ≤ 0.00033, two-tailed t test). Data are represented as mean ± SEM (error bars). (C) Dose-response experiment assessing the impact of bromodomain ligand-based (C646 and I-CBP112), and peptidomimetic (CWP232228) inhibition of CBP on t-hESC growth (C646, I-CPB112: n = 4; CWP232228: n = 3). (D) Early endoderm differentiation assay performed in t-hESCs in the presence of CWP232228 (0.1 μM, n = 6), I-CBP112 (0.25 μM, n = 3), or C646 (0.25 μM, n = 3) versus control DMSO (n = 6) and basal culture media (n = 3). Bar graph represents relative counts of FOXA2-positive (early endoderm marker)/OCT4-negative cells in DMSO, CWP232228, I-CBP112, and C646-treated t-hESCs versus basal culture media (one-way ANOVA, ∗∗∗: p < 0.0001). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Pro-drug CWP232228 is converted into its active form CWP231904 via hydrolysis of the phosphate group by serum/cellular alkaline phosphatase. (F) Affinity pull-down experiments using CWP231904-conjugated magnetic beads performed on whole hESC lysates. Physical interaction between CBP, Sam68, beta-Catenin, ETS, MYB, GATA2, and PTMA with immobilized CWP231904 was assessed by immunoblotting. Each protein was previously shown as a member of the CBP interactome showing selective enrichment in human primary AML versus healthy blood ( <xref ref-type=Benoit et al., 2017 ). Excess of soluble compounds (CWP and ICG001, 100 μM) were used to compete with immobilized CWP231904. Whole-cell lysate was used as input, and amine-functionalized beads were used as negative control (n = 2). The heatmap presents mean background-corrected OD signal for each putative interactor tested (gray: not tested). " width="100%" height="100%">

Journal: iScience

Article Title: Pharmacological targeting of Sam68 functions in colorectal cancer stem cells

doi: 10.1016/j.isci.2021.103442

Figure Lengend Snippet: Reverse/β-turn peptidomimetic compounds are direct interactors of Sam68 (A) Chemical structure of HAT inhibitor C646 and bromodomain ligand I-CBP112, as well as β-turn peptidomimetics ICG-001 and CWP232228. (B) Western blot analysis of CBP-catalyzed H3K14ac and H3K18ac histone acetylation marks in C646 (0.25 μM), I-CBP112 (0.25 μM), and CWP232228 (0.1 μM) t-hESCs versus control DMSO. Total histone H3 and GAPDH were used as loading control. Relative OD signal quantification versus H3 intensity is presented (C646: n = 3, I-CBP112: n = 5, CWP232228: n ≥ 3, ∗: p = 0.0183, ∗∗: p = 0.0078, ∗∗∗: p ≤ 0.00033, two-tailed t test). Data are represented as mean ± SEM (error bars). (C) Dose-response experiment assessing the impact of bromodomain ligand-based (C646 and I-CBP112), and peptidomimetic (CWP232228) inhibition of CBP on t-hESC growth (C646, I-CPB112: n = 4; CWP232228: n = 3). (D) Early endoderm differentiation assay performed in t-hESCs in the presence of CWP232228 (0.1 μM, n = 6), I-CBP112 (0.25 μM, n = 3), or C646 (0.25 μM, n = 3) versus control DMSO (n = 6) and basal culture media (n = 3). Bar graph represents relative counts of FOXA2-positive (early endoderm marker)/OCT4-negative cells in DMSO, CWP232228, I-CBP112, and C646-treated t-hESCs versus basal culture media (one-way ANOVA, ∗∗∗: p < 0.0001). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Pro-drug CWP232228 is converted into its active form CWP231904 via hydrolysis of the phosphate group by serum/cellular alkaline phosphatase. (F) Affinity pull-down experiments using CWP231904-conjugated magnetic beads performed on whole hESC lysates. Physical interaction between CBP, Sam68, beta-Catenin, ETS, MYB, GATA2, and PTMA with immobilized CWP231904 was assessed by immunoblotting. Each protein was previously shown as a member of the CBP interactome showing selective enrichment in human primary AML versus healthy blood ( Benoit et al., 2017 ). Excess of soluble compounds (CWP and ICG001, 100 μM) were used to compete with immobilized CWP231904. Whole-cell lysate was used as input, and amine-functionalized beads were used as negative control (n = 2). The heatmap presents mean background-corrected OD signal for each putative interactor tested (gray: not tested).

Article Snippet: Custom mutagenesis of human KHDRBS1 cDNA and cloning into pLenti-mGFP-P2A-Puro vector was performed by OriGene Technologies, and lentiviral particles for control, wild-type Sam68/ KHDRBS1 , and G305N Sam68/ KHDRBS1 overexpression were generated as above-described.

Techniques: Western Blot, Two Tailed Test, Inhibition, Differentiation Assay, Marker, Magnetic Beads, Negative Control

In silico screening of peptidomimetics with enhanced binding affinity for Sam68 (A) Representation of Sam68 interacting with SH3 domain in Src kinase family proteins via proline-rich motifs located in N-terminal P1-P2 and between residues 275 and 374 (P3, P4, P5). Small molecule UCS15A is known to disrupt SH3-mediated interaction of Src with Sam68 P3-5 domains ( <xref ref-type=Sharma et al., 2001 ). (B) 2D representation of UCS15A and the peptidomimetic ICG-001 in silico predicted binding pocket in Sam68 275-374 peptide (red, oxygen; blue, nitrogen). Common residues involved in both small-molecule-binding pockets are highlighted in red. Predicted hydrogen bond length is represented by dashed lines (Å). (C) Schematic representation of the in silico structure-activity relationship analysis pipeline (PyRx) used to identify β-turn peptidomimetic molecules with enhanced binding affinity for Sam68 275-374 domain. “A” and “B” represent the positions of distinct substituents added to reverse-turn mimetic cores. (D) Dose-response curves assessing selective toxicity of peptidomimetics ICG-001, CWP232228, and PRI-724 in HT29 human colorectal cancer cell line versus normal intestinal progenitor cells HIEC (n ≥ 4, 48-h treatments). (E) Compound ranking based on predicted Keq for each β-turn analog (black dots). Only molecules presenting a standard deviation below 0.1 for a minimum of three analysis runs, with an exhaustiveness (“E”) level of “8” were plotted. Dots corresponding to ICG-001, CWP231904, PRI-724-OH, and YB-0159 were highlighted in red. Random structure ranking is represented by green dots. See also . (F) Structure of YB-0158, a phosphate-stabilized prodrug of YB-0159. (G) Docked poses of CWP231904 (left) and YB-0159 (right) in human Sam68 257-374 fragment (red, oxygen; blue, nitrogen). Glycine 305 is highlighted in red, where distinct hydrogen bond (gray dashed line) was predicted between YB-0159 and Sam68. The inset in the right pose represents a higher magnification view of the predicted hydrogen bond formation between YB-0158 and Gly305. See also . " width="100%" height="100%">

Journal: iScience

Article Title: Pharmacological targeting of Sam68 functions in colorectal cancer stem cells

doi: 10.1016/j.isci.2021.103442

Figure Lengend Snippet: In silico screening of peptidomimetics with enhanced binding affinity for Sam68 (A) Representation of Sam68 interacting with SH3 domain in Src kinase family proteins via proline-rich motifs located in N-terminal P1-P2 and between residues 275 and 374 (P3, P4, P5). Small molecule UCS15A is known to disrupt SH3-mediated interaction of Src with Sam68 P3-5 domains ( Sharma et al., 2001 ). (B) 2D representation of UCS15A and the peptidomimetic ICG-001 in silico predicted binding pocket in Sam68 275-374 peptide (red, oxygen; blue, nitrogen). Common residues involved in both small-molecule-binding pockets are highlighted in red. Predicted hydrogen bond length is represented by dashed lines (Å). (C) Schematic representation of the in silico structure-activity relationship analysis pipeline (PyRx) used to identify β-turn peptidomimetic molecules with enhanced binding affinity for Sam68 275-374 domain. “A” and “B” represent the positions of distinct substituents added to reverse-turn mimetic cores. (D) Dose-response curves assessing selective toxicity of peptidomimetics ICG-001, CWP232228, and PRI-724 in HT29 human colorectal cancer cell line versus normal intestinal progenitor cells HIEC (n ≥ 4, 48-h treatments). (E) Compound ranking based on predicted Keq for each β-turn analog (black dots). Only molecules presenting a standard deviation below 0.1 for a minimum of three analysis runs, with an exhaustiveness (“E”) level of “8” were plotted. Dots corresponding to ICG-001, CWP231904, PRI-724-OH, and YB-0159 were highlighted in red. Random structure ranking is represented by green dots. See also . (F) Structure of YB-0158, a phosphate-stabilized prodrug of YB-0159. (G) Docked poses of CWP231904 (left) and YB-0159 (right) in human Sam68 257-374 fragment (red, oxygen; blue, nitrogen). Glycine 305 is highlighted in red, where distinct hydrogen bond (gray dashed line) was predicted between YB-0159 and Sam68. The inset in the right pose represents a higher magnification view of the predicted hydrogen bond formation between YB-0158 and Gly305. See also .

Article Snippet: Custom mutagenesis of human KHDRBS1 cDNA and cloning into pLenti-mGFP-P2A-Puro vector was performed by OriGene Technologies, and lentiviral particles for control, wild-type Sam68/ KHDRBS1 , and G305N Sam68/ KHDRBS1 overexpression were generated as above-described.

Techniques: In Silico, Binding Assay, Activity Assay, Standard Deviation

YB-0158 alters Sam68 biology in human cancer cells (A) Dose-response experiment assessing growth inhibition caused by peptidomimetics analogs CWP232228 and YB-0158 in t-hESCs (n = 3, 48-h treatments). Calculated EC 50 for each small molecule is presented in the inset table. See also . (B) Dose-response experiment assessing growth inhibition caused by peptidomimetic analogs CWP232228 and YB-0158 in HT29 colorectal cancer cells (n = 2, 48-h treatments). Calculated EC 50 for each small molecule is presented in the inset table. (C) Co-immunoprecipitation (IP) assessing changes in interaction levels between Src and Sam68 in response to CWP232228 (1.5 μM) and YB-0158 (0.3 μM) in HT29 cells (48 h) (n = 3, ∗: p = 0.021, ∗∗: p = 0.0088, two-tailed t test). Data are represented as mean ± SEM (error bars). Mouse IgGs were used as negative control for pull down. (D) Immunofluorescence staining of Sam68 in DMSO, CWP232228, and YB-0158-treated t-hESCs (48 h, n = 9). Quantification of nuclear Sam68 was performed by high-content imaging and presented as relative levels versus DMSO (∗∗: p < 0.01, ∗∗∗: p < 0.0001, two-tailed t test). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Quantification of nuclear Sam68 in HT29 cells treated with increasing doses of YB-0158, in the presence (n = 4) or absence (n = 3) of a PRMT1 inhibitor (Furamidine, 10 μM). Cells were treated for 48 h and nuclear Sam68 immunostaining was quantified by high-content imaging. Data are represented as mean ± SEM (error bars). (F) Western blot analysis of Sam68 levels in normal human intestinal progenitor cells HIEC; human colorectal cancer SW480, HT29, and HCT116 lines; mouse colon adenocarcinoma MC38 cells; t-hESCs; as well as patient-derived CSC-enriched spheroids and 3D organoids from colorectal tumor samples (n ≥ 3). Relative OD signal quantification for Sam68 versus loading control (GAPDH) is presented. (G) Dose-response experiment monitoring growth of normal intestinal cells HIEC, as well as HT29, SW480, and HCT116 colorectal cancer lines treated with YB-0158 (n ≥ 3, 48 h). A significant correlation was established between calculated EC 50 and Sam68 expression (R 2 = 0.8510, p < 0.0001, simple linear regression). (H) Cell growth experiment in HCT116 cells transduced with control/empty-mGFP (pLenti Control) or KHDRBS1 -mGFP (pLenti Sam68) overexpression vectors and treated with YB-0158 (0.3 μM, 48 h) or vehicle control (DMSO). GFP-positive cell counts upon treatments are presented versus their corresponding DMSO-treated group (n = 7, ∗∗: p = 0.003, two-tailed t test). Data are represented as mean ± SEM (error bars). (I) Cell growth experiment using HCT116 cells overexpressing wild-type Sam68 ( KHDRBS1 ) (wt Sam68) or with a mutated G305 motif (G305N Sam68) and subjected to increasing doses of YB-0158 (0.08–10 μM versus DMSO control) for 48 h. Residual transduced cells (GFP reporter) were counted for each dose and presented versus DMSO control (n ≤ 5, ∗∗∗: p < 0.001, two-tailed t test). Data are represented as mean ± SEM (error bars).

Journal: iScience

Article Title: Pharmacological targeting of Sam68 functions in colorectal cancer stem cells

doi: 10.1016/j.isci.2021.103442

Figure Lengend Snippet: YB-0158 alters Sam68 biology in human cancer cells (A) Dose-response experiment assessing growth inhibition caused by peptidomimetics analogs CWP232228 and YB-0158 in t-hESCs (n = 3, 48-h treatments). Calculated EC 50 for each small molecule is presented in the inset table. See also . (B) Dose-response experiment assessing growth inhibition caused by peptidomimetic analogs CWP232228 and YB-0158 in HT29 colorectal cancer cells (n = 2, 48-h treatments). Calculated EC 50 for each small molecule is presented in the inset table. (C) Co-immunoprecipitation (IP) assessing changes in interaction levels between Src and Sam68 in response to CWP232228 (1.5 μM) and YB-0158 (0.3 μM) in HT29 cells (48 h) (n = 3, ∗: p = 0.021, ∗∗: p = 0.0088, two-tailed t test). Data are represented as mean ± SEM (error bars). Mouse IgGs were used as negative control for pull down. (D) Immunofluorescence staining of Sam68 in DMSO, CWP232228, and YB-0158-treated t-hESCs (48 h, n = 9). Quantification of nuclear Sam68 was performed by high-content imaging and presented as relative levels versus DMSO (∗∗: p < 0.01, ∗∗∗: p < 0.0001, two-tailed t test). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Quantification of nuclear Sam68 in HT29 cells treated with increasing doses of YB-0158, in the presence (n = 4) or absence (n = 3) of a PRMT1 inhibitor (Furamidine, 10 μM). Cells were treated for 48 h and nuclear Sam68 immunostaining was quantified by high-content imaging. Data are represented as mean ± SEM (error bars). (F) Western blot analysis of Sam68 levels in normal human intestinal progenitor cells HIEC; human colorectal cancer SW480, HT29, and HCT116 lines; mouse colon adenocarcinoma MC38 cells; t-hESCs; as well as patient-derived CSC-enriched spheroids and 3D organoids from colorectal tumor samples (n ≥ 3). Relative OD signal quantification for Sam68 versus loading control (GAPDH) is presented. (G) Dose-response experiment monitoring growth of normal intestinal cells HIEC, as well as HT29, SW480, and HCT116 colorectal cancer lines treated with YB-0158 (n ≥ 3, 48 h). A significant correlation was established between calculated EC 50 and Sam68 expression (R 2 = 0.8510, p < 0.0001, simple linear regression). (H) Cell growth experiment in HCT116 cells transduced with control/empty-mGFP (pLenti Control) or KHDRBS1 -mGFP (pLenti Sam68) overexpression vectors and treated with YB-0158 (0.3 μM, 48 h) or vehicle control (DMSO). GFP-positive cell counts upon treatments are presented versus their corresponding DMSO-treated group (n = 7, ∗∗: p = 0.003, two-tailed t test). Data are represented as mean ± SEM (error bars). (I) Cell growth experiment using HCT116 cells overexpressing wild-type Sam68 ( KHDRBS1 ) (wt Sam68) or with a mutated G305 motif (G305N Sam68) and subjected to increasing doses of YB-0158 (0.08–10 μM versus DMSO control) for 48 h. Residual transduced cells (GFP reporter) were counted for each dose and presented versus DMSO control (n ≤ 5, ∗∗∗: p < 0.001, two-tailed t test). Data are represented as mean ± SEM (error bars).

Article Snippet: Custom mutagenesis of human KHDRBS1 cDNA and cloning into pLenti-mGFP-P2A-Puro vector was performed by OriGene Technologies, and lentiviral particles for control, wild-type Sam68/ KHDRBS1 , and G305N Sam68/ KHDRBS1 overexpression were generated as above-described.

Techniques: Inhibition, Immunoprecipitation, Two Tailed Test, Negative Control, Immunofluorescence, Staining, Imaging, Immunostaining, Western Blot, Derivative Assay, Expressing, Transduction, Over Expression

Journal: iScience

Article Title: Pharmacological targeting of Sam68 functions in colorectal cancer stem cells

doi: 10.1016/j.isci.2021.103442

Figure Lengend Snippet:

Article Snippet: Custom mutagenesis of human KHDRBS1 cDNA and cloning into pLenti-mGFP-P2A-Puro vector was performed by OriGene Technologies, and lentiviral particles for control, wild-type Sam68/ KHDRBS1 , and G305N Sam68/ KHDRBS1 overexpression were generated as above-described.

Techniques: Recombinant, Derivative Assay, Immunoprecipitation, Staining, Chromatin Immunoprecipitation, DNA Purification, SYBR Green Assay, Purification, Western Blot, RNA Sequencing Assay, Sequencing, Expressing, Transformation Assay, shRNA, Software

Journal: iScience

Article Title: Oxygen-carrying sequential preservation mitigates liver grafts ischemia-reperfusion injury

doi: 10.1016/j.isci.2022.105858

Figure Lengend Snippet:

Article Snippet: The PVDF membranes were blocked with 5% non-fat dried milk in tris-buffered saline (pH 7.4) containing 0.1% Tween20 and subsequently immunoblotted with antibodies directed against BECN1 (ab207612, Abcam), ATG5 (GTX113309, GeneTex), MAP1LC3B (GTX127375, GeneTex), KHDRBS1 (GTX100685, GeneTex), HSPA5 (#3183, CST), DDIT3 (#2895, CST), SIRT1 (ab110304, Abcam), SIRT2 (ab211033, Abcam), NFE2L2(ab92946, Abcam), HMOX1 (ab68477, Abcam), cleaved-CASPASE 3 (#9661, CST), and β-ACTIN (sc-81178, Santa Cruz).

Techniques: Recombinant, Flow Cytometry, Apoptosis Assay, CCK-8 Assay, Multiple Displacement Amplification, Bicinchoninic Acid Protein Assay, TUNEL Assay, ATP Assay, Software, Preserving

KEY RESOURCES TABLE

Journal: Cell

Article Title: Pervasive Chromatin-RNA Binding Protein Interactions Enable RNA-Based Regulation of Transcription

doi: 10.1016/j.cell.2019.06.001

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Rabbit polyclonal anti-KHDRBS1 , MBL , RN021P; RRID: AB_1953049.

Techniques: Recombinant, Protease Inhibitor, Magnetic Beads, Staining, Blocking Assay, Ligation, Purification, Gel Extraction, Imaging, Sequencing, Software

Arginine methylation of HNRNPUL2, KHDRBS1(SAM68) and SRSF1 is reduced in HD ISPNs ( A ) Total cell lysates from non-differentiated control (33CAG) and HD (180CAG) ISPNs were prepared as described in the Experimental Section. IPs with a mixture of mono-methyl (MMA) and asymmetric dimethyl (ADMA) antibodies were performed followed by western blot analysis with indicated protein-specific antibodies. Protein bands were visualized and quantified using the Licor System and Image Studio software. ( B ) – ( D ) Graphs (left) show the mean intensity values (±SEM) of the signal detected with antibodies to total HNRNPUL2, KHDRBS1(SAM68) and SRSF1 in the IPs normalized to the signal obtained from input lysates with the same antibodies. Total protein levels normalized to β-tubulin were also quantified (right graphs). n = 3 (biological replicates), Normality Test (Shapiro–Wilk): Passed, Equal Variance Test: Passed. T -test with equal variances was performed: (B) * 33CAG versus 180CAG, P 0.04. (C) * 33CAG versus 180CAG, P 0.0046. * * 33CAG versus 180CAG, P 0.0039.

Journal: Human Molecular Genetics

Article Title: Arginine methylation of RNA-binding proteins is impaired in Huntington’s disease

doi: 10.1093/hmg/ddad125

Figure Lengend Snippet: Arginine methylation of HNRNPUL2, KHDRBS1(SAM68) and SRSF1 is reduced in HD ISPNs ( A ) Total cell lysates from non-differentiated control (33CAG) and HD (180CAG) ISPNs were prepared as described in the Experimental Section. IPs with a mixture of mono-methyl (MMA) and asymmetric dimethyl (ADMA) antibodies were performed followed by western blot analysis with indicated protein-specific antibodies. Protein bands were visualized and quantified using the Licor System and Image Studio software. ( B ) – ( D ) Graphs (left) show the mean intensity values (±SEM) of the signal detected with antibodies to total HNRNPUL2, KHDRBS1(SAM68) and SRSF1 in the IPs normalized to the signal obtained from input lysates with the same antibodies. Total protein levels normalized to β-tubulin were also quantified (right graphs). n = 3 (biological replicates), Normality Test (Shapiro–Wilk): Passed, Equal Variance Test: Passed. T -test with equal variances was performed: (B) * 33CAG versus 180CAG, P 0.04. (C) * 33CAG versus 180CAG, P 0.0046. * * 33CAG versus 180CAG, P 0.0039.

Article Snippet: FLAG-tagged HNRNPUL2 and KHDRBS1 expression plasmids were obtained from GenScript.

Techniques: Methylation, Control, Western Blot, Software

RNA association of hypomethylated RBPs is decreased in HD cells. RNA-binding assay in ISPNs. RNA pull-downs were performed as described in the Experimental Section according to Castello et al . (2013) . ( A ) Validation of RNA-binding assay in ISPNs demonstrating detection of indicated RNA-bound proteins in cross-linked cells (but not in the eluates of nonirradiated control cells) with protein-specific antibodies. ( B ) The amounts of mRNA within RNA-protein complexes were estimated by absorbance at A260, and equal amounts were analyzed by western blotting with indicated protein-specific antibodies. Representative experiment is shown. ( C ) – ( G ) Quantitation of blots shown in (B). Graphs show the mean intensity values (±SD) of the signal with antibodies to indicated proteins detected in the RNA-bound fraction normalized to the signal obtained from input lysates with the same antibodies. n = 3 (biological replicates). Normality test (Shapiro–Wilk): Passed, equal variance test: Passed. One-way ANOVA was performed with pairwise multiple comparison procedures (Holm–Sidak method). (C) HNRNPUL2, * 33EE versus 180, P 0.002; * * 33DG versus 180, P 0.002. (D) KHDRBS1, * 33EE versus 180, P 0.004; * * 33DG versus 180, P < 0.001; * * * 33DG versus 33EE, P < 0.001. (E) FUS, * 33EE versus 180, P 0.003; * * 33DG versus 180, P 0.008. (F) SRSF1, * 33EE versus 180, P 0.003; * * 33DG versus 180, P 0.011. (G) TAF15, * 33EE versus 180, P < 0.001; * * 33DG versus 180, P < 0.001; * * * 33DG versus 33EE, P < 0.001.

Journal: Human Molecular Genetics

Article Title: Arginine methylation of RNA-binding proteins is impaired in Huntington’s disease

doi: 10.1093/hmg/ddad125

Figure Lengend Snippet: RNA association of hypomethylated RBPs is decreased in HD cells. RNA-binding assay in ISPNs. RNA pull-downs were performed as described in the Experimental Section according to Castello et al . (2013) . ( A ) Validation of RNA-binding assay in ISPNs demonstrating detection of indicated RNA-bound proteins in cross-linked cells (but not in the eluates of nonirradiated control cells) with protein-specific antibodies. ( B ) The amounts of mRNA within RNA-protein complexes were estimated by absorbance at A260, and equal amounts were analyzed by western blotting with indicated protein-specific antibodies. Representative experiment is shown. ( C ) – ( G ) Quantitation of blots shown in (B). Graphs show the mean intensity values (±SD) of the signal with antibodies to indicated proteins detected in the RNA-bound fraction normalized to the signal obtained from input lysates with the same antibodies. n = 3 (biological replicates). Normality test (Shapiro–Wilk): Passed, equal variance test: Passed. One-way ANOVA was performed with pairwise multiple comparison procedures (Holm–Sidak method). (C) HNRNPUL2, * 33EE versus 180, P 0.002; * * 33DG versus 180, P 0.002. (D) KHDRBS1, * 33EE versus 180, P 0.004; * * 33DG versus 180, P < 0.001; * * * 33DG versus 33EE, P < 0.001. (E) FUS, * 33EE versus 180, P 0.003; * * 33DG versus 180, P 0.008. (F) SRSF1, * 33EE versus 180, P 0.003; * * 33DG versus 180, P 0.011. (G) TAF15, * 33EE versus 180, P < 0.001; * * 33DG versus 180, P < 0.001; * * * 33DG versus 33EE, P < 0.001.

Article Snippet: FLAG-tagged HNRNPUL2 and KHDRBS1 expression plasmids were obtained from GenScript.

Techniques: RNA Binding Assay, Biomarker Discovery, Control, Western Blot, Quantitation Assay, Comparison