Journal: Bioactive Materials

Article Title: Near infrared enhanced palladium loaded siraitia grosvenorii carbon dots amplify mitophagy for acute lung injury immunotherapy

doi: 10.1016/j.bioactmat.2026.02.040

Figure Lengend Snippet: ALI therapeutic mechanism. A) Co-immunofluorescent staining images of cells incubated with Cy5-CPs or Cy5-CPs@SS31 by confocal staining microscope: DAPI (blue), Mito-tracker green (green), and Cy5-CPs or Cy5-CPs@SS31 (red). (Scale bar = 10 μm) B) MMP of treated cells by flow cytometry. C) Heatmap of DEGs between control group and CPs@SS31+NIR: genes with relatively high (red) and low (blue) expression levels. D) Volcano plot of DEGs: 542 upregulated and 499 downregulated genes between control group and CPs@SS31+NIR. E) Anti-inflammation pathways related DEGs by KEGG enrichment analysis (red). F) Anti-inflammation pathways related differential biological functions by GO enrichment analysis (red): molecular function (MF), biological process (BP) and cell component (CC). G) Protein-protein interaction network of mitophagy related proteins. H) P62, Parkin and PINK1 expression levels of treated cells by WB. I) P62, Parkin and PINK1 expression levels in the lung tissue of treated rats. (Scale bar = 100 μm).

Article Snippet: Furthermore, the membranes were separately incubated with the primary antibody (anti-P62, Parkin, PINK1 and GAPDH, Proteintech, China) overnight at 4 °C.

Techniques: Staining, Incubation, Microscopy, Flow Cytometry, Control, Expressing

Journal: Bioactive Materials

Article Title: A foam cell-targeted lipophagy restoration strategy stabilizes vulnerable atherosclerotic plaques

doi: 10.1016/j.bioactmat.2026.02.041

Figure Lengend Snippet: In vitro evaluation of foam cell lipid accumulation and lipophagy activation following OPN-HMCN@MLT treatment. ( A - C ) ORO and BODIPY staining images and corresponding quantification of ORO and BODIPY positive areas of RAW264.7 cells under different stimulations (n = 5, scale bar for ORO: 100 μm, scale bar for BODIPY: 20 μm). ( D ) Bio-TEM images of RAW264.7 cells post various treatments (n = 5, scale bars 1.0 μm). Green arrows indicate nanoparticles. ( E , F ) Morphometric analysis determined the mean number and area (μm 2 ) of LDs per cell section. ( G ) Confocal images depicting lipophagy flux in foam cells following different treatments (n = 5 biological replicates, scale bars: 10 μm). ( H - J ) The quantities of acidified autophagosomes (GFP-RFP+), neutral autophagosomes (GFP + RFP+), and LDs labeled with BODIPY were measured per cell for each condition. (K to N) Representative Western blot images and quantitative analysis of LC3, LAMP1, and P62 expression in foam cells. ∗ P < 0.05, ∗∗ P < 0.01, ∗∗∗ P < 0.001, and ∗∗∗∗ P < 0.0001.

Article Snippet: To block nonspecific binding, membranes were incubated with 5% skim milk for 1 h. Thereafter, membranes were incubated overnight at 4 °C with primary antibodies against ABCA1, ABCG1, ACOX1, CPT1A, LC3 (ab192890, 1:2000, abcam), LAMP1 (84658-5-RR, 1:8000, Proteintech), PPARα (66826-1-Ig, 1:3000, Proteintech), PPARγ (66936-1-Ig, 1:10000, Proteintech), P62 (18420-1-AP, 1:10000, Proteintech), MCAD (55210-1-AP, 1:3000, Proteintech), LCAD (17526-1-AP, 1:10000, Proteintech), tubulin (80762-1-RR, 1:10000, Proteintech), GAPDH (60004-1-Ig, 1:50000, Proteintech), and β-actin (66009-1-Ig, 1:20000, Proteintech).

Techniques: In Vitro, Activation Assay, Staining, Labeling, Western Blot, Expressing

Journal: Oncology Reports

Article Title: Platycodin D sensitizes head and neck squamous cell carcinoma to cisplatin by inducing autophagy arrest

doi: 10.3892/or.2026.9088

Figure Lengend Snippet: PD and cisplatin combination treatment increases autophagy marker levels in head and neck squamous cell carcinoma cells. (A) HSC3 and (C) FaDu cells were treated with PD (10 µM), cisplatin (10 µM) or combination treatment for 48 h. Cells were stained with LC3B antibody and analyzed using confocal microscopy. (B) In HSC3 cells, p62 immunofluorescence was increased following combination treatment compared with single treatments. (D) In FaDu cells, p62 staining similarly showed higher p62 levels in the combination treatment group than in the single treatment groups. Nuclei were stained with DAPI (blue), LC3B was stained red and p62 was stained green. Fluorescence intensity and puncta quantification were analyzed using ZEN software (Zeiss AG). Scale bar, 50 µm. Data are presented as the mean ± SD (n=3). *P<0.05, **P<0.01, ***P<0.001. PD, Platycodin D.

Article Snippet: The following antibodies were used: Anti-LC3A/B (1:1,000; cat. no. 12741S; Cell Signaling Technology, Inc.), anti-SQSTM1/p62 (1:1,000; cat. no. 5114S; Cell Signaling Technology, Inc.), anti-poly(ADP-ribose) polymerase (PARP; 1:1,000; cat. no. 9542S; Cell Signaling Technology, Inc.), anti-caspase 3 (1:1,000; cat. no. 9662S; Cell Signaling Technology, Inc.) and anti-β-actin (1:5,000; cat. no. 47778; Santa Cruz Biotechnology, Inc.).

Techniques: Marker, Staining, Confocal Microscopy, Immunofluorescence, Fluorescence, Software

Journal: Oncology Reports

Article Title: Platycodin D sensitizes head and neck squamous cell carcinoma to cisplatin by inducing autophagy arrest

doi: 10.3892/or.2026.9088

Figure Lengend Snippet: PD and cisplatin combination treatment induces autophagy arrest by inhibiting autophagosome degradation. HSC3 and FaDu cells were treated with PD (10 µM), cisplatin (10 µM) or combination treatment for 48 h, with or without BafA1. (A) Western blotting was performed to evaluate the expression levels of LC3A/B and p62. β-actin was used as a loading control. (B) Densitometric analysis of LC3A/B and p62 protein levels normalized to β-actin, performed using ImageJ software. Statistical significance was determined by one-way ANOVA followed by Tukey's post hoc test. Data are presented as the mean ± SD (n=3). *P<0.05, **P<0.01. BafA1, Bafilomycin A1; PD, Platycodin D.

Article Snippet: The following antibodies were used: Anti-LC3A/B (1:1,000; cat. no. 12741S; Cell Signaling Technology, Inc.), anti-SQSTM1/p62 (1:1,000; cat. no. 5114S; Cell Signaling Technology, Inc.), anti-poly(ADP-ribose) polymerase (PARP; 1:1,000; cat. no. 9542S; Cell Signaling Technology, Inc.), anti-caspase 3 (1:1,000; cat. no. 9662S; Cell Signaling Technology, Inc.) and anti-β-actin (1:5,000; cat. no. 47778; Santa Cruz Biotechnology, Inc.).

Techniques: Western Blot, Expressing, Control, Software

Journal: Oncology Reports

Article Title: Platycodin D sensitizes head and neck squamous cell carcinoma to cisplatin by inducing autophagy arrest

doi: 10.3892/or.2026.9088

Figure Lengend Snippet: PD and cisplatin combination treatment increases autophagy marker levels in head and neck squamous cell carcinoma cells. (A) HSC3 and (C) FaDu cells were treated with PD (10 µM), cisplatin (10 µM) or combination treatment for 48 h. Cells were stained with LC3B antibody and analyzed using confocal microscopy. (B) In HSC3 cells, p62 immunofluorescence was increased following combination treatment compared with single treatments. (D) In FaDu cells, p62 staining similarly showed higher p62 levels in the combination treatment group than in the single treatment groups. Nuclei were stained with DAPI (blue), LC3B was stained red and p62 was stained green. Fluorescence intensity and puncta quantification were analyzed using ZEN software (Zeiss AG). Scale bar, 50 µm. Data are presented as the mean ± SD (n=3). *P<0.05, **P<0.01, ***P<0.001. PD, Platycodin D.

Article Snippet: The cells were incubated overnight at 4°C with primary antibodies against LC3B (1:1,000; cat. no. 2775S; Cell Signaling Technology, Inc.) and sequestosome 1 (SQSTM1)/p62 (1:1,000; cat. no. 5114S; Cell Signaling Technology, Inc.).

Techniques: Marker, Staining, Confocal Microscopy, Immunofluorescence, Fluorescence, Software

Journal: Oncology Reports

Article Title: Platycodin D sensitizes head and neck squamous cell carcinoma to cisplatin by inducing autophagy arrest

doi: 10.3892/or.2026.9088

Figure Lengend Snippet: PD and cisplatin combination treatment induces autophagy arrest by inhibiting autophagosome degradation. HSC3 and FaDu cells were treated with PD (10 µM), cisplatin (10 µM) or combination treatment for 48 h, with or without BafA1. (A) Western blotting was performed to evaluate the expression levels of LC3A/B and p62. β-actin was used as a loading control. (B) Densitometric analysis of LC3A/B and p62 protein levels normalized to β-actin, performed using ImageJ software. Statistical significance was determined by one-way ANOVA followed by Tukey's post hoc test. Data are presented as the mean ± SD (n=3). *P<0.05, **P<0.01. BafA1, Bafilomycin A1; PD, Platycodin D.

Article Snippet: The cells were incubated overnight at 4°C with primary antibodies against LC3B (1:1,000; cat. no. 2775S; Cell Signaling Technology, Inc.) and sequestosome 1 (SQSTM1)/p62 (1:1,000; cat. no. 5114S; Cell Signaling Technology, Inc.).

Techniques: Western Blot, Expressing, Control, Software

Journal: The Journal of cell biology

Article Title: Cullin-3 adaptor SHKBP1 inhibits SQSTM1/p62 oligomerization and Keap1 sequestration

doi: 10.1083/jcb.202501207

Figure Lengend Snippet: (A) Workflow of first proteomics experiments using the neddylation inhibitor MLN4924 to enrich unstable CRL targets (left) and cartoon representation of drug treatment mechanism (right). Cells were treated with MLN4924 (10 μM) or vehicle for 16 h. (B) Workflow of second proteomics experiments using tandem UBA domain fusions to SHKBP1 to enrich ubiquitinated substrates (left) and model of ligase trap (right). Cells stably expressing the corresponding construct were treated with MG-132 (20 μM) for 2 h. (C) Workflow of third proteomics experiments using the SHKBP1 F44A CUL3-binding deficient mutant to reduce CRL complex components in IP compared to SHKBP1 WT (left) and corresponding model (right). (D–F) Volcano plots from the three SILAC MS proteomics experiments, showing log 2 (fold changes of protein abundance in heavy/light samples) vs. statistical significance (−log 10 (p-value)). Proteins whose change was below the cutoff (fold change < 1.2) are indicated in grey. Those above the cutoff with p values above 0.05 are shown in green, and those with p values below 0.05 are shown in purple.

Article Snippet: The following antibodies were used for Western blot: mouse anti-SQSTM1/p62 (D5L7G), Cell Signaling Technology (88588, RRID:AB_2800125); rabbit anti SQSTM1/p62, ABclonal (A19700, RRID:AB_2862742); mouse anti-Keap1, Santa Cruz Biotechnology (sc-365626, RRID:AB_10844829); rabbit anti-SHKBP1, Bethyl Laboratories (A304–891, RRID:AB_2621086); mouse anti-SHKBP1, Santa Cruz Biotechnology (sc-390121, RRID unavailable); mouse anti-ubiquitin, Santa Cruz Biotechnology (sc-8017, RRID:AB_628423); mouse anti-GFP, Santa Cruz Biotechnology (sc-9996, RRID:AB_627695); mouse anti-mCherry, Sigma-Aldrich (MAB131873, RRID:AB_11034849); mouse anti-Actin, MP Bio (08691001, RRID:AB_2335127); rabbit anti-FLAG, Sigma-Aldrich (F7425, RRID:AB_439687); mouse anti-HA, Covance (MMS-101R, RRID:AB_291262); rabbit anti-Tubulin, Cell Signaling Technology (2128S, RRID:AB_823664); rabbit anti-Histone H3, Cell Signaling Technology (4499S, RRID:AB_10544537); mouse anti-Nrf2 (A-10), Santa Cruz Biotechnology (sc-365949, RRID:AB_ 10917561).

Techniques: Stable Transfection, Expressing, Construct, Binding Assay, Mutagenesis, Multiplex sample analysis, Quantitative Proteomics

Journal: The Journal of cell biology

Article Title: Cullin-3 adaptor SHKBP1 inhibits SQSTM1/p62 oligomerization and Keap1 sequestration

doi: 10.1083/jcb.202501207

Figure Lengend Snippet: (A) Western blot analysis of whole cell lysates (WCL) and α-GFP immunoprecipitates (IP) from HeLa cells co-transfected with HA-p62 and GFP-SHKBP1 or GFP empty vector (EV) as a control. (B) Western blot analysis of WCL and α-GFP IP from HeLa cells co-transfected with GFP-p62 and HA-SHKBP1 or HA empty vector (EV) as a control. (C and D) Western blot analysis of WCL and α-GFP IP to assess the interaction between SHKBP1 and exogenous (C) or endogenous p62 (D). HeLa cells were transfected with GFP-SHKBP1 in combination with HA-p62 (C) or alone (D), and treated with DMSO or the proteasome inhibitor MG-132 (20 μM) for 2 h or MLN4924 (10 μM) for 16 h. (E) HeLa cells were co-transfected with GFP-p62 and mScarlet-i-SHKBP1, treated with DMSO or the proteasome inhibitor MG-132 (20 μM) for 2 h or MLN4924 (10 μM) for 16 h, and then observed under confocal microscope 24 h post transfection. Scale bars: 10 μm.

Article Snippet: The following antibodies were used for Western blot: mouse anti-SQSTM1/p62 (D5L7G), Cell Signaling Technology (88588, RRID:AB_2800125); rabbit anti SQSTM1/p62, ABclonal (A19700, RRID:AB_2862742); mouse anti-Keap1, Santa Cruz Biotechnology (sc-365626, RRID:AB_10844829); rabbit anti-SHKBP1, Bethyl Laboratories (A304–891, RRID:AB_2621086); mouse anti-SHKBP1, Santa Cruz Biotechnology (sc-390121, RRID unavailable); mouse anti-ubiquitin, Santa Cruz Biotechnology (sc-8017, RRID:AB_628423); mouse anti-GFP, Santa Cruz Biotechnology (sc-9996, RRID:AB_627695); mouse anti-mCherry, Sigma-Aldrich (MAB131873, RRID:AB_11034849); mouse anti-Actin, MP Bio (08691001, RRID:AB_2335127); rabbit anti-FLAG, Sigma-Aldrich (F7425, RRID:AB_439687); mouse anti-HA, Covance (MMS-101R, RRID:AB_291262); rabbit anti-Tubulin, Cell Signaling Technology (2128S, RRID:AB_823664); rabbit anti-Histone H3, Cell Signaling Technology (4499S, RRID:AB_10544537); mouse anti-Nrf2 (A-10), Santa Cruz Biotechnology (sc-365949, RRID:AB_ 10917561).

Techniques: Western Blot, Transfection, Plasmid Preparation, Control, Microscopy

Journal: The Journal of cell biology

Article Title: Cullin-3 adaptor SHKBP1 inhibits SQSTM1/p62 oligomerization and Keap1 sequestration

doi: 10.1083/jcb.202501207

Figure Lengend Snippet: (A) Domain map of SHKBP1 and truncations used in this paper. (B) Representative live-cell images showing localization of full-length (FL) and truncated forms of SHKBP1. HeLa cells were transfected with the indicated GFP-tagged SHKBP1 construct and observed by confocal microscopy 24 h post-transfection. Scale bars: 10 μm. (C) Western blot analysis of α-GFP IP of lysates from HeLa cells co-transfected with HA-CUL3 and either the indicated GFP-SHKBP1 truncation or GFP empty vector (EV) as a control. (D) Western blot analysis of α-GFP IP of lysates from HeLa cells co-transfected with HA-p62 and either the indicated GFP-SHKBP1 truncation or GFP-EV as a control. (E) Domain map of p62 and truncations used in this paper. (F) Representative live cell images showing localization of p62 truncations. HeLa cells were transfected with the indicated GFP-tagged p62 construct and observed by confocal microscopy 24 h post-transfection. Scale bars: 10 μm. (G) Western blot analysis of α-GFP IP of lysates from HeLa cells co-transfected with HA-SHKBP1 and the indicated GFP-p62 construct. (H) AlphaFold3 structural prediction of the interaction between SHKBP1-WD domain (magenta) and p62 (green). Electrostatic interactions (blue) indicated between p62 residues K7, R18, D92, D93 and R96 and SHKBP1 residues R357, K359, D360, D362, and E367 (pink), respectively. ipTM = 0.73, pTM = 0.54. (I) Western blot analysis of α-GFP IP of lysates from HeLa cells co-transfected with the indicated FLAG-SHKBP1 and GFP-p62 constructs. (J) Quantification of FLAG-SHKBP1 from GFP IP samples to assess the strength of interaction between p62 and SHKBP1, with band intensities normalized to FLAG-SHKBP1 levels in WCL and to GFP-p62 levels in IP (n = 3). Exact p values indicated from two-way ANOVA with Tukey’s post-hoc test. (K) Representative live cell images showing localization of p62 point mutants. HeLa cells were transfected with the indicated GFP-tagged p62 construct and observed by confocal microscopy 24 h post transfection. Scale bars: 10 μm.

Article Snippet: The following antibodies were used for Western blot: mouse anti-SQSTM1/p62 (D5L7G), Cell Signaling Technology (88588, RRID:AB_2800125); rabbit anti SQSTM1/p62, ABclonal (A19700, RRID:AB_2862742); mouse anti-Keap1, Santa Cruz Biotechnology (sc-365626, RRID:AB_10844829); rabbit anti-SHKBP1, Bethyl Laboratories (A304–891, RRID:AB_2621086); mouse anti-SHKBP1, Santa Cruz Biotechnology (sc-390121, RRID unavailable); mouse anti-ubiquitin, Santa Cruz Biotechnology (sc-8017, RRID:AB_628423); mouse anti-GFP, Santa Cruz Biotechnology (sc-9996, RRID:AB_627695); mouse anti-mCherry, Sigma-Aldrich (MAB131873, RRID:AB_11034849); mouse anti-Actin, MP Bio (08691001, RRID:AB_2335127); rabbit anti-FLAG, Sigma-Aldrich (F7425, RRID:AB_439687); mouse anti-HA, Covance (MMS-101R, RRID:AB_291262); rabbit anti-Tubulin, Cell Signaling Technology (2128S, RRID:AB_823664); rabbit anti-Histone H3, Cell Signaling Technology (4499S, RRID:AB_10544537); mouse anti-Nrf2 (A-10), Santa Cruz Biotechnology (sc-365949, RRID:AB_ 10917561).

Techniques: Transfection, Construct, Confocal Microscopy, Western Blot, Plasmid Preparation, Control, Structural Proteomics

Journal: The Journal of cell biology

Article Title: Cullin-3 adaptor SHKBP1 inhibits SQSTM1/p62 oligomerization and Keap1 sequestration

doi: 10.1083/jcb.202501207

Figure Lengend Snippet: (A) Western blot analysis of in vivo ubiquitination assay. WT or SHKBP1 KO HeLa cells were co-transfected with His-ubiquitin and either GFP-p62 or GFP EV, and overexpressed (OE) group represents WT cells that were also co-transfected with FLAG-SHKBP1. 24 h post transfection, cells were treated with MG-132 (20 μM) for 2 h and subjected to His pull-down using Ni-NTA agarose and Western blot. (B) Western blot analysis of the whole-cell lysates (WCL) from WT, SHKBP1 KO, and FLAG-SHKBP1 overexpressing (OE) HeLa cells. (C) Representative live cell images showing p62 body formation. WT or SHKBP1 KO HeLa cells were transfected with GFP-p62 either alone (left) or in combination with mScarlet-i-SHKBP1 (right, where OE refers to SHKBP1 overexpression in WT cells and RE (rescue) refers to SHKBP1 overexpression in KO cells) and imaged using confocal microscopy 24 h post-transfection. Scale bars: 20 μm. (D) Quantification of the average p62 body size of images shown in (C) from three independently plated samples. n = 51 (KO), 43 (WT), 37 (OE), and 35 (RE). Exact p values indicated (****, p < 0.0001) from one-way ANOVA with Tukey’s post-hoc test. (E) Western blot analysis of WCL from WT or SHKBP1 KO HeLa cells after DSP crosslinking. Cells were treated with MG-132 (0.5 μM) for 12 h, crosslinked with 0.4 mg/mL DSP at 4 °C for 2 h, and lysed in IP lysis buffer with 1% SDS. The lysates mixed with reducing or nonreducing loading buffer (i.e., with or without β-mercaptoethanol) and were analyzed by Western blot. (F) Quantification of the ratio of intensities of monomeric to total p62. Intensities were normalized to the WT without MG-132 treatment group. n = 6. Exact p values indicated (****, p < 0.0001) from two-way ANOVA.

Article Snippet: The following antibodies were used for Western blot: mouse anti-SQSTM1/p62 (D5L7G), Cell Signaling Technology (88588, RRID:AB_2800125); rabbit anti SQSTM1/p62, ABclonal (A19700, RRID:AB_2862742); mouse anti-Keap1, Santa Cruz Biotechnology (sc-365626, RRID:AB_10844829); rabbit anti-SHKBP1, Bethyl Laboratories (A304–891, RRID:AB_2621086); mouse anti-SHKBP1, Santa Cruz Biotechnology (sc-390121, RRID unavailable); mouse anti-ubiquitin, Santa Cruz Biotechnology (sc-8017, RRID:AB_628423); mouse anti-GFP, Santa Cruz Biotechnology (sc-9996, RRID:AB_627695); mouse anti-mCherry, Sigma-Aldrich (MAB131873, RRID:AB_11034849); mouse anti-Actin, MP Bio (08691001, RRID:AB_2335127); rabbit anti-FLAG, Sigma-Aldrich (F7425, RRID:AB_439687); mouse anti-HA, Covance (MMS-101R, RRID:AB_291262); rabbit anti-Tubulin, Cell Signaling Technology (2128S, RRID:AB_823664); rabbit anti-Histone H3, Cell Signaling Technology (4499S, RRID:AB_10544537); mouse anti-Nrf2 (A-10), Santa Cruz Biotechnology (sc-365949, RRID:AB_ 10917561).

Techniques: Ubiquitin Proteomics, Western Blot, In Vivo, Transfection, Over Expression, Confocal Microscopy, Lysis

Journal: The Journal of cell biology

Article Title: Cullin-3 adaptor SHKBP1 inhibits SQSTM1/p62 oligomerization and Keap1 sequestration

doi: 10.1083/jcb.202501207

Figure Lengend Snippet: (A) WT and SHKBP1 KO HeLa cells were transfected with GFP-p62 alone or in combination with mScarlet-i-SHKBP1. 24 h later, cells were subjected to live-cell imaging by confocal microscopy and analysis by fluorescence recovery after photobleaching (FRAP). Shown is a representative image for each condition. A pre-bleach image is provided along with a timecourse of post-bleach images (post-bleach time indicated in min). Scale bars: 2 μm. (B) Quantification of the fluorescence recovery rates of GFP-p62 from FRAP experiments. Data were analyzed with GraphPad Prism using nonlinear regression (curve fit), shown as mean ± standard deviation (SD). n = 3 for each group from three independent experiments. (C) Quantification of the half-life of fluorescence recovery of GFP-p62 from FRAP experiments. n = 20 for each group from three independent experiments. Exact p values indicated from one-way ANOVA with Tukey’s post-hoc test. (D) Western blot analysis of the whole-cell lysates from three HEK 293T cell lines stably expressing endogenously tagged p62 using mNeonGreen 2 (mNG): SHKBP1 WT, SHKBP1 KO, and SHKBP1 WT with transient overexpression (OE) of a large amount of FLAG-SHKBP1. The hollow arrowhead indicates the FLAG-SHKBP1, and the solid arrowhead indicates untagged (endogenous) SHKBP1. (E) Western blot analysis of WCL, flow-through (FT), and anti-mNeonGreen IP to assess the interaction between SHKBP1 and endogenously tagged p62 in a HEK293T cell line stably expressing mNG-p62 and transfected with a small amount of FLAG-SHKBP1. For the p62 blot, asterisks denote background bands from p62 antibody and solid arrowhead indicates mNG11-tagged p62. For the SHKBP1 blot, hollow arrowhead indicates the FLAG-SHKBP1, and solid arrowhead indicates untagged (endogenous) SHKBP1. (F) Representative live cell images showing single particle tracking of endogenous mNG-p62 by confocal microscopy. HEK 293T cell lines stably expressing mNG-p62 were transfected with either mScarlet-i (in both SHKBP1 KO and SHKBP1 WT backgrounds) or mScarlet-i-SHKBP1 (in SHKBP1 WT background, “OE”). Tracked p62 bodies are indicated by magenta circles, and movement tracks are shown by colored lines. Scale bars: 5 μm. (G) Quantification of the mean speed of tracked p62 bodies in SHKBP1 KO, WT, and OE conditions. n = 200–300 p62 bodies collected from three independently plated samples. Exact p values indicated from one-way ANOVA with Tukey’s post-hoc test. (H) Representative live cell images showing endogenous p62 body shapes. HEK 293T stable cell lines were transfected with the indicated mScarlet-i constructs and observed by confocal microscopy 24 h post-transfection. Scale bars: 5 μm. (I–L) Quantification of the mNG p62 body roundness, solidity, circularity and aspect ratio. n = 1000–1300 p62 bodies collected from three independently plated samples. Exact p values indicated from one-way ANOVA with Tukey’s post-hoc test.

Article Snippet: The following antibodies were used for Western blot: mouse anti-SQSTM1/p62 (D5L7G), Cell Signaling Technology (88588, RRID:AB_2800125); rabbit anti SQSTM1/p62, ABclonal (A19700, RRID:AB_2862742); mouse anti-Keap1, Santa Cruz Biotechnology (sc-365626, RRID:AB_10844829); rabbit anti-SHKBP1, Bethyl Laboratories (A304–891, RRID:AB_2621086); mouse anti-SHKBP1, Santa Cruz Biotechnology (sc-390121, RRID unavailable); mouse anti-ubiquitin, Santa Cruz Biotechnology (sc-8017, RRID:AB_628423); mouse anti-GFP, Santa Cruz Biotechnology (sc-9996, RRID:AB_627695); mouse anti-mCherry, Sigma-Aldrich (MAB131873, RRID:AB_11034849); mouse anti-Actin, MP Bio (08691001, RRID:AB_2335127); rabbit anti-FLAG, Sigma-Aldrich (F7425, RRID:AB_439687); mouse anti-HA, Covance (MMS-101R, RRID:AB_291262); rabbit anti-Tubulin, Cell Signaling Technology (2128S, RRID:AB_823664); rabbit anti-Histone H3, Cell Signaling Technology (4499S, RRID:AB_10544537); mouse anti-Nrf2 (A-10), Santa Cruz Biotechnology (sc-365949, RRID:AB_ 10917561).

Techniques: Transfection, Live Cell Imaging, Confocal Microscopy, Fluorescence, Standard Deviation, Western Blot, Stable Transfection, Expressing, Over Expression, Single-particle Tracking, Construct

Journal: The Journal of cell biology

Article Title: Cullin-3 adaptor SHKBP1 inhibits SQSTM1/p62 oligomerization and Keap1 sequestration

doi: 10.1083/jcb.202501207

Figure Lengend Snippet: (A) Western blot analysis of co-IP experiments for endogenous p62. Lysates were from WT HeLa cells, SHKBP1 KO HeLa cells, and HeLa cells transfected with mScarlet-i-SHKBP1 (OE). (B) Quantification of Keap1 from p62-IP to demonstrate the interaction between endogenous p62 and Keap1, with band intensities normalized to actin levels (n = 3). Exact p values indicated from one-way ANOVA with Tukey’s post-hoc test. C) Western blot analysis of WCL from WT and SHKBP1 KO HeLa cells treated with As(III) (10 μM) for the indicated times. (D) Quantification of Keap1 protein levels, with band intensities normalized to actin levels (n = 5). Exact p values indicated (****, p < 0.0001) from two-way ANOVA. (E) Confocal microscopy analysis of WT and KO SHKBP1 HeLa cells co-transfected with GFP-p62 and miRFP-Keap1 and treated with As(III) (10 μM) for 4 h or with DMSO as control. Scale bars: 20 μm. (F and G) Quantification of Keap1 aggregate size (F) and p62 body size (G) in WT and SHKBP1 KO HeLa cells after As(III) treatment (representative images shown in 6E). n = 11 images from three independently plated samples. Exact p values indicated from unpaired two-tailed Student’s t test. (H) Confocal microscopy analysis of HeLa cells co-transfected with GFP-p62 and miRFP-Keap1, with or without mScarlet-i-SHKBP1, and treated with As(III) (10 μM) for 4 h or with DMSO as control. Scale bars: 20 μm. (I and J) Quantification of p62 body size (I) and the percentage of cells containing Keap1 aggregates (J) in control of SHKBP1-overexpressing (OE) HeLa cells with or without As(III) treatment (representative images shown in 6H). n = 8–12 images from three independently plated samples. Exact p values indicated from two-way ANOVA. (K) Immunofluorescence (IF) analysis of endogenous p62 and Keap1 in WT and SHKBP1 KO HeLa cells by confocal microscopy. Cells were treated with As(III) (10 μM) for indicated times. Scale bars: 10 μm; 5 μm (zoomed-in images). (L–N) Quantification of Keap1 aggregate size (L), p62 body size (M), and colocalization of Keap1 and p62 (N) in WT and SHKBP1 KO HeLa cells with As(III) treatment for the indicated times (representative images shown in 6K). n = 13–18 images from three independently plated samples. Exact p values indicated (****, p < 0.0001) from two-way ANOVA with Tukey’s post-hoc test.

Article Snippet: The following antibodies were used for Western blot: mouse anti-SQSTM1/p62 (D5L7G), Cell Signaling Technology (88588, RRID:AB_2800125); rabbit anti SQSTM1/p62, ABclonal (A19700, RRID:AB_2862742); mouse anti-Keap1, Santa Cruz Biotechnology (sc-365626, RRID:AB_10844829); rabbit anti-SHKBP1, Bethyl Laboratories (A304–891, RRID:AB_2621086); mouse anti-SHKBP1, Santa Cruz Biotechnology (sc-390121, RRID unavailable); mouse anti-ubiquitin, Santa Cruz Biotechnology (sc-8017, RRID:AB_628423); mouse anti-GFP, Santa Cruz Biotechnology (sc-9996, RRID:AB_627695); mouse anti-mCherry, Sigma-Aldrich (MAB131873, RRID:AB_11034849); mouse anti-Actin, MP Bio (08691001, RRID:AB_2335127); rabbit anti-FLAG, Sigma-Aldrich (F7425, RRID:AB_439687); mouse anti-HA, Covance (MMS-101R, RRID:AB_291262); rabbit anti-Tubulin, Cell Signaling Technology (2128S, RRID:AB_823664); rabbit anti-Histone H3, Cell Signaling Technology (4499S, RRID:AB_10544537); mouse anti-Nrf2 (A-10), Santa Cruz Biotechnology (sc-365949, RRID:AB_ 10917561).

Techniques: Western Blot, Co-Immunoprecipitation Assay, Transfection, Confocal Microscopy, Control, Two Tailed Test, Immunofluorescence

Journal: The Journal of cell biology

Article Title: Cullin-3 adaptor SHKBP1 inhibits SQSTM1/p62 oligomerization and Keap1 sequestration

doi: 10.1083/jcb.202501207

Figure Lengend Snippet: (A) IF analysis of endogenous Nrf2 in WT and SHKBP1 KO HeLa cells by confocal microscopy. Nuclei were stained with DAPI (magenta). Cells were treated with As(III) (10 μM) for the indicated times. Scale bars: 15 μm. (B) Quantification of nuclear levels of Nrf2 in WT and SHKBP1 KO HeLa cells with As(III) treatment for the indicated times (representative images shown in (A). n = 9 images each including ~30 cells from three independently plated samples. Exact p values indicated (****, p < 0.0001) from two-way ANOVA with Tukey’s post-hoc test. (C) Western blot analysis of cytosolic and nuclear fractions from WT and SHKBP1 KO HeLa cells treated with As(III) (10 μM) for the indicated times. Tubulin and Histone H3 are used to qualitatively assess the purity of each fraction. (D) Quantification of nuclear Nrf2 protein levels, with band intensities normalized to Histone H3 levels (n = 3). Exact p values indicated from two-way ANOVA. (E) Role of SHKBP1 in p62-Keap1-Nrf2 pathway.

Article Snippet: The following antibodies were used for Western blot: mouse anti-SQSTM1/p62 (D5L7G), Cell Signaling Technology (88588, RRID:AB_2800125); rabbit anti SQSTM1/p62, ABclonal (A19700, RRID:AB_2862742); mouse anti-Keap1, Santa Cruz Biotechnology (sc-365626, RRID:AB_10844829); rabbit anti-SHKBP1, Bethyl Laboratories (A304–891, RRID:AB_2621086); mouse anti-SHKBP1, Santa Cruz Biotechnology (sc-390121, RRID unavailable); mouse anti-ubiquitin, Santa Cruz Biotechnology (sc-8017, RRID:AB_628423); mouse anti-GFP, Santa Cruz Biotechnology (sc-9996, RRID:AB_627695); mouse anti-mCherry, Sigma-Aldrich (MAB131873, RRID:AB_11034849); mouse anti-Actin, MP Bio (08691001, RRID:AB_2335127); rabbit anti-FLAG, Sigma-Aldrich (F7425, RRID:AB_439687); mouse anti-HA, Covance (MMS-101R, RRID:AB_291262); rabbit anti-Tubulin, Cell Signaling Technology (2128S, RRID:AB_823664); rabbit anti-Histone H3, Cell Signaling Technology (4499S, RRID:AB_10544537); mouse anti-Nrf2 (A-10), Santa Cruz Biotechnology (sc-365949, RRID:AB_ 10917561).

Techniques: Knock-Out, Translocation Assay, Confocal Microscopy, Staining, Western Blot

Journal: The Journal of cell biology

Article Title: Cullin-3 adaptor SHKBP1 inhibits SQSTM1/p62 oligomerization and Keap1 sequestration

doi: 10.1083/jcb.202501207

Figure Lengend Snippet: (A) Western blot analysis of whole cell lysates (WCL) and α-GFP immunoprecipitates (IP) from HeLa cells co-transfected with HA-p62 and GFP-SHKBP1 or GFP empty vector (EV) as a control. (B) Western blot analysis of WCL and α-GFP IP from HeLa cells co-transfected with GFP-p62 and HA-SHKBP1 or HA empty vector (EV) as a control. (C and D) Western blot analysis of WCL and α-GFP IP to assess the interaction between SHKBP1 and exogenous (C) or endogenous p62 (D). HeLa cells were transfected with GFP-SHKBP1 in combination with HA-p62 (C) or alone (D), and treated with DMSO or the proteasome inhibitor MG-132 (20 μM) for 2 h or MLN4924 (10 μM) for 16 h. (E) HeLa cells were co-transfected with GFP-p62 and mScarlet-i-SHKBP1, treated with DMSO or the proteasome inhibitor MG-132 (20 μM) for 2 h or MLN4924 (10 μM) for 16 h, and then observed under confocal microscope 24 h post transfection. Scale bars: 10 μm.

Article Snippet: Resistant EGFP-SHKBP1 or 2xUBA-3xFLAG-SHKBP1 (2US) or GFP-SHKBP1 (F44A) were subcloned into the pCDH-CMV-MCS vector to yield the lentiviral plasmid. p62-related constructs were amplified from HA-p62, Addgene (28027), which was subcloned into pEGFP-C1 vector (Clontech) using EcoRI and KpnI to generate GFP-p62 using primers: CCGGAATTCGATGGCGTCGCTCACCGTG, CGGGGTACCTCACAACGGCGGGGGATGCTTTG.

Techniques: Western Blot, Transfection, Plasmid Preparation, Control, Microscopy

Journal: The Journal of cell biology

Article Title: Cullin-3 adaptor SHKBP1 inhibits SQSTM1/p62 oligomerization and Keap1 sequestration

doi: 10.1083/jcb.202501207

Figure Lengend Snippet: (A) Domain map of SHKBP1 and truncations used in this paper. (B) Representative live-cell images showing localization of full-length (FL) and truncated forms of SHKBP1. HeLa cells were transfected with the indicated GFP-tagged SHKBP1 construct and observed by confocal microscopy 24 h post-transfection. Scale bars: 10 μm. (C) Western blot analysis of α-GFP IP of lysates from HeLa cells co-transfected with HA-CUL3 and either the indicated GFP-SHKBP1 truncation or GFP empty vector (EV) as a control. (D) Western blot analysis of α-GFP IP of lysates from HeLa cells co-transfected with HA-p62 and either the indicated GFP-SHKBP1 truncation or GFP-EV as a control. (E) Domain map of p62 and truncations used in this paper. (F) Representative live cell images showing localization of p62 truncations. HeLa cells were transfected with the indicated GFP-tagged p62 construct and observed by confocal microscopy 24 h post-transfection. Scale bars: 10 μm. (G) Western blot analysis of α-GFP IP of lysates from HeLa cells co-transfected with HA-SHKBP1 and the indicated GFP-p62 construct. (H) AlphaFold3 structural prediction of the interaction between SHKBP1-WD domain (magenta) and p62 (green). Electrostatic interactions (blue) indicated between p62 residues K7, R18, D92, D93 and R96 and SHKBP1 residues R357, K359, D360, D362, and E367 (pink), respectively. ipTM = 0.73, pTM = 0.54. (I) Western blot analysis of α-GFP IP of lysates from HeLa cells co-transfected with the indicated FLAG-SHKBP1 and GFP-p62 constructs. (J) Quantification of FLAG-SHKBP1 from GFP IP samples to assess the strength of interaction between p62 and SHKBP1, with band intensities normalized to FLAG-SHKBP1 levels in WCL and to GFP-p62 levels in IP (n = 3). Exact p values indicated from two-way ANOVA with Tukey’s post-hoc test. (K) Representative live cell images showing localization of p62 point mutants. HeLa cells were transfected with the indicated GFP-tagged p62 construct and observed by confocal microscopy 24 h post transfection. Scale bars: 10 μm.

Article Snippet: Resistant EGFP-SHKBP1 or 2xUBA-3xFLAG-SHKBP1 (2US) or GFP-SHKBP1 (F44A) were subcloned into the pCDH-CMV-MCS vector to yield the lentiviral plasmid. p62-related constructs were amplified from HA-p62, Addgene (28027), which was subcloned into pEGFP-C1 vector (Clontech) using EcoRI and KpnI to generate GFP-p62 using primers: CCGGAATTCGATGGCGTCGCTCACCGTG, CGGGGTACCTCACAACGGCGGGGGATGCTTTG.

Techniques: Transfection, Construct, Confocal Microscopy, Western Blot, Plasmid Preparation, Control, Structural Proteomics

Journal: Redox Biology

Article Title: Inhibition of SDE2 promotes autophagy-dependent ferroptosis in multiple myeloma

doi: 10.1016/j.redox.2026.104007

Figure Lengend Snippet: Impact of SDE2 knockdown on cellular metabolism and autophagy in MM cells. (A) Fluorescence imaging of CFDA/DAPI-stained OPM-2 and KMS-11 cells with or without SDE2 knockdown (left). The bar graph quantifies relative fluorescence intensity (right). (B) Fluorescence imaging of acridine orange-stained OPM-2 and KMS-11 cells with or without SDE2 knockdown (left). The bar graph quantifies relative fluorescence intensity (right). (C) MitoTracker staining to evaluate mitochondrial activity in OPM-2 and KMS-11 cells with or without SDE2 knockdown. (D) Transmission electron microscopy (TEM) images showing autophagosomes (indicated by red arrows) and autolysosomes (indicated by yellow arrows) in OPM-2 and KMS-11 cells with or without SDE2 knockdown. (E) Western blot analysis of p62 and ATG5 expression levels in OPM-2 and KMS-11 cells with or without SDE2 knockdown. (F) mRFP-GFP-LC3 dual fluorescence labeling of OPM-2 and KMS-11 cells with or without SDE2 knockdown, visualizing autophagosomes (yellow puncta: red + green) and autolysosomes (red-only puncta). The bar graphs quantify the total number of puncta and the relative proportion of autophagosomes to autolysosomes. ∗P < 0.05; ∗∗P < 0.01; ∗∗∗P < 0.001.

Article Snippet: Lysates were resolved by SDS-PAGE, transferred to PVDF membranes (Millipore), and probed with antibodies against SDE2 (PA5-46779, Thermo Fisher), ATG5 (#2630, Cell Signaling Technology), LC3 (sc-271625, Santa Cruz), P62 (sc-28359, Santa Cruz), and GAPDH (ab8245, Abcam).

Techniques: Knockdown, Fluorescence, Imaging, Staining, Activity Assay, Transmission Assay, Electron Microscopy, Western Blot, Expressing, Labeling

Journal: Redox Biology

Article Title: Inhibition of SDE2 promotes autophagy-dependent ferroptosis in multiple myeloma

doi: 10.1016/j.redox.2026.104007

Figure Lengend Snippet: SDE2 promotes MM cell proliferation via its UBL domain–dependent inhibition of ferroptosis and autophagy. (A) Colony formation assays were performed in H929 cells transfected with empty vector, SDE2, or SDE2Δ1. Representative images (left) and quantification of colony numbers (right) are shown. (B) Intracellular glutathione (GSH), ferrous iron (Fe 2+ ), and malondialdehyde (MDA) levels were measured using corresponding colorimetric kits. (C) Western blot analysis of ferroptosis-related proteins (NCOA4, ACSL4, FTH1, and GPX4) in the indicated groups; GAPDH was used as a loading control. Densitometric quantification is shown on the right. (D) Lipid peroxidation was assessed by BODIPY 581/591 C11 staining in H929 cells expressing vector, SDE2, or SDE2Δ1. Representative fluorescence images of oxidized (green) and non-oxidized (red) signals are shown. (E) Quantification of oxidized BODIPY fluorescence intensity from (D). (F) Quantification of MitoTracker Red fluorescence intensity in the indicated groups. (G) Mitochondrial morphology was visualized by MitoTracker Red staining in H929 cells. (H) Autophagic flux was evaluated using the mRFP-GFP-LC3 tandem fluorescent-tagged reporter system. Representative images show red (mRFP), green (GFP), and merged puncta. (I) Quantification of LC3 puncta number and percentage of mRFP + /GFP − autolysosomes per cell from (H). (J) Western blot analysis of autophagy-related proteins p62, ATG5, and ATG7 in the indicated groups. GAPDH served as a loading control. Densitometric quantification is shown below. ∗P < 0.05; ∗∗P < 0.01; ∗∗∗P < 0.001.

Article Snippet: Lysates were resolved by SDS-PAGE, transferred to PVDF membranes (Millipore), and probed with antibodies against SDE2 (PA5-46779, Thermo Fisher), ATG5 (#2630, Cell Signaling Technology), LC3 (sc-271625, Santa Cruz), P62 (sc-28359, Santa Cruz), and GAPDH (ab8245, Abcam).

Techniques: Inhibition, Transfection, Plasmid Preparation, Western Blot, Control, Staining, Expressing, Fluorescence

Journal: Redox Biology

Article Title: Inhibition of SDE2 promotes autophagy-dependent ferroptosis in multiple myeloma

doi: 10.1016/j.redox.2026.104007

Figure Lengend Snippet: Modulation of autophagy and ferroptosis in MM cells through SDE2 manipulation and pharmacological interventions. KMS-11 cells treated with SDE2 knockdown and/or the autophagy inhibitor chloroquine (CQ): (A) Western blot analysis of autophagy-related proteins LC3 and p62 in KMS-11 cells. Densitometric quantification is shown on the right. (B) Western blot analysis of ACSL4, FTH1, and GPX4 in KMS-11 cells under the same treatments as in (A), with corresponding quantification on the right. (C) Biochemical analysis of ferroptosis-related markers GSH, MDA, and Fe 2+ in KMS-11 cells. H929 cells treated with SDE2 overexpression and/or the ferroptosis inducer Erastin: (D) Western blot analysis of autophagy-related proteins LC3 and p62 in H929 cells. Densitometric quantification is shown on the right. (E) Western blot analysis and quantification of ATG5 and ATG7 in H929 cells under the same treatments as in (D). (F) mRFP-GFP-LC3 dual fluorescence labeling visualizing autophagic flux in H929 cells, showing autophagosomes (yellow puncta: red + green) and autolysosomes (red-only puncta). KMS-11 cells treated with SDE2 knockdown and/or ATG5 knockdown: (G) Western blot analysis and quantification of Beclin1 and p62 in KMS-11 cells expressing shCtrl or shSDE2, with or without ATG5 knockdown. (H) Western blot analysis of ACSL4, FTH1, and GPX4 in KMS-11 cells with single or combined knockdown of SDE2 and ATG5. Quantification is shown on the right. (I) Biochemical analysis of ferroptosis-related markers GSH, MDA, and Fe 2+ in KMS-11 cells. ∗P < 0.05; ∗∗P < 0.01; ∗∗∗P < 0.001.

Article Snippet: Lysates were resolved by SDS-PAGE, transferred to PVDF membranes (Millipore), and probed with antibodies against SDE2 (PA5-46779, Thermo Fisher), ATG5 (#2630, Cell Signaling Technology), LC3 (sc-271625, Santa Cruz), P62 (sc-28359, Santa Cruz), and GAPDH (ab8245, Abcam).

Techniques: Knockdown, Western Blot, Over Expression, Fluorescence, Labeling, Expressing

Journal: Redox Biology

Article Title: Inhibition of SDE2 promotes autophagy-dependent ferroptosis in multiple myeloma

doi: 10.1016/j.redox.2026.104007

Figure Lengend Snippet: Functional interplay between ATG5 and SDE2 in MM progression and ferroptosis regulation. (A) Western blot analysis of ATG5 expression in malignant cells (T) and non-malignant bone marrow cells (N) isolated from the peripheral blood of MM patients. (B) Western blot analysis confirming the efficiency of ATG5 overexpression in OPM-2 and H929 cells transfected with a plasmid encoding the full-length ATG5 sequence. (C) Crystal violet staining of Transwell migration assays comparing the migratory ability of OPM-2 and H929 cells with or without ATG5 overexpression. (D) Experimental setup for H929 cells treated with SDE2 overexpression, ATG5 overexpression, or a combination of both. (E) Western blot analysis of SDE2 and ATG5 protein levels in H929 cells from the four groups defined in (D). GAPDH was used as a loading control. (F) (Top) Colony formation assay evaluating the proliferative capacity of H929 cells under different treatments. (Bottom) Transwell assay assessing the migratory ability of H929 cells under different treatments. (G) Biochemical analysis of ferroptosis-related markers (MDA, GSH, and Fe 2+ ) in H929 cells subjected to different treatments. (H) Western blot analysis of ferroptosis-related proteins (NCOA4, ACSL4, FTH1, and GPX4) in H929 cells under different treatments. (I) Western blot analysis showing the effects of different treatments on LC3 expression and p62 degradation in H929 cells. (J) Representative images of tumors formed 35 days after subcutaneous inoculation of differently treated H929 stable cell lines into nude mice. (K) Tumor growth curves showing volume changes of tumors derived from differently treated H929 cell lines over time. (L) Average tumor weights of tumors derived from differently treated H929 cell lines. (M) Western blot analysis of NCOA4, ACSL4, FTH1, and GPX4 expression levels in tumors derived from differently treated H929 cell lines. (N) Western blot analysis showing the activation levels of the ATG5/ATG7 pathway and p62 degradation in tumors derived from differently treated H929 cell lines. (O) Representative images of H&E staining and Ki67 immunohistochemical staining of tumor sections derived from differently treated H929 cell lines. The bar graph quantifies the percentage of proliferating cells (Ki67-positive). ∗P < 0.05; ∗∗P < 0.01; ∗∗∗P < 0.001.

Article Snippet: Lysates were resolved by SDS-PAGE, transferred to PVDF membranes (Millipore), and probed with antibodies against SDE2 (PA5-46779, Thermo Fisher), ATG5 (#2630, Cell Signaling Technology), LC3 (sc-271625, Santa Cruz), P62 (sc-28359, Santa Cruz), and GAPDH (ab8245, Abcam).

Techniques: Functional Assay, Western Blot, Expressing, Isolation, Over Expression, Transfection, Plasmid Preparation, Sequencing, Staining, Migration, Control, Colony Assay, Transwell Assay, Stable Transfection, Derivative Assay, Activation Assay, Immunohistochemical staining

Journal: Redox Biology

Article Title: Inhibition of SDE2 promotes autophagy-dependent ferroptosis in multiple myeloma

doi: 10.1016/j.redox.2026.104007

Figure Lengend Snippet: Effects of SDE2 knockdown and Antitumor agent-82 treatment on RPMI 8226 cells in vitro and in vivo . (A) Experimental setup for RPMI 8226 cells treated with SDE2 knockdown, Antitumor agent-82, or a combination of both. (B–C) (B) Colony formation assay evaluating the proliferative capacity of RPMI 8226 cells under different treatments. (C) Transwell migration assay assessing the migratory ability of RPMI 8226 cells under different treatments. (D) Biochemical analysis of ferroptosis-related markers (GSH, Fe 2+ , and MDA) in RPMI 8226 cells under different treatments. (E) Western blot analysis of ferroptosis-related proteins (NCOA4, ACSL4, FTH1, and GPX4) in RPMI 8226 cells subjected to different treatments. (F) Representative images of tumors formed 35 days after subcutaneous inoculation of differently treated RPMI 8226 stable cell lines into nude mice (n = 5). (G) Tumor growth curves showing volume changes of tumors derived from differently treated RPMI 8226 cell lines over time (n = 5). (H) Tumor weight was recorded at the endpoint (Day 35) for each group (n = 5). (I) Western blot analysis of NCOA4, GPX4, and p62 expression levels in tumors derived from differently treated RPMI 8226 cell lines (n = 5). (J) Representative images of H&E staining and Ki67 immunohistochemical staining of tumor sections derived from RPMI 8226 cell lines. The bar graph quantifies the percentage of proliferating cells (Ki67-positive) (n = 5). ∗P < 0.05; ∗∗P < 0.01; ∗∗∗P < 0.001.

Article Snippet: Lysates were resolved by SDS-PAGE, transferred to PVDF membranes (Millipore), and probed with antibodies against SDE2 (PA5-46779, Thermo Fisher), ATG5 (#2630, Cell Signaling Technology), LC3 (sc-271625, Santa Cruz), P62 (sc-28359, Santa Cruz), and GAPDH (ab8245, Abcam).

Techniques: Knockdown, In Vitro, In Vivo, Colony Assay, Transwell Migration Assay, Western Blot, Stable Transfection, Derivative Assay, Expressing, Staining, Immunohistochemical staining