guide sequence Search Results


90
GenScript corporation rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga)
Rnase1 Crispr Guide Rna (Target Sequence: Tgccaagggctcatgcacga), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+sequence/rnase1+crispr+guide+rna++target+sequence++tgccaagggctcatgcacga+/pm38307859-283-32-48
Average 90 stars, based on 1 article reviews
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GenScript corporation mouse non-targeting grna (guide rna) sequence
Mouse Non Targeting Grna (Guide Rna) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+sequence/mouse+non+targeting+grna++guide+rna++sequence/pm33197448-108-8-28
Average 90 stars, based on 1 article reviews
mouse non-targeting grna (guide rna) sequence - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
ToolGen Incorporated single guide rna (sgrna) including the sequence targeting the neu2 gene
Single Guide Rna (Sgrna) Including The Sequence Targeting The Neu2 Gene, supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+sequence/single+guide+rna++sgrna++including+the+sequence+targeting+the+neu2+gene/pmc08881595-32-7-20
Average 90 stars, based on 1 article reviews
single guide rna (sgrna) including the sequence targeting the neu2 gene - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GenScript corporation guide rna sequence
A. Phylogenetic analysis shows the closest homologs of C. elegans CAT-2 (gray) in S. stercoralis (brown) and S. ratti (blue). Putative homologs in each genome were identified by performing TBLASTN searches of the C. elegans CAT-2A <t>protein</t> <t>sequence</t> (i.e ., the longest isoform) against either the S. stercoralis genome or the S. ratti genome in WormBase ParaSite WBPS18. The tree has the three members of the biopterin-dependent aromatic amino acid hydroxylases in C. elegans , of which CAT-2 is a member, and the predicted homologs in S. stercoralis and S. ratti . B. Co-expression of Ss-cat-2 and Ss-dat-1 in the putative dopaminergic (DA) neurons of S. stercoralis . Montage shows expression of the Ss-cat-2 transcriptional reporter in green, expression of the Ss-dat-1 transcriptional reporter in magenta, and co-expression of the two reporters and the relative positions of these neurons along the body of the iL3 in the differential interference contrast (DIC) overlay. The circles, asterisk, and arrow label the putative Ss- CEP, Ss- ADE, and Ss- PDE neurons, respectively. The iL3 is oriented with the dorsal side facing up and the ventral side facing down; the head is to the left. Scale bar = 100 µm. C-D. Violin plots show expression levels of Ss-cat-2 and Ss-dat-1 , expressed as log 2 counts per million (CPM), at the indicated life stages based on published <t>RNA-seq</t> datasets , , . **** p <0.0001; statistical tests for differential expression analysis were performed as previously described, with corrections for multiple comparisons . FLF = free-living female; iL3 = infective third-stage larva; ppL3 = post-parasitic third-stage larva; PF = parasitic female. Each dot indicates an independent replicate experiment. E. The cat-2 genes of C. elegans and S. stercoralis . Schematics show the gene models of Ce-cat-2 (isoform a), as annotated in WormBase WS292, and Ss-cat-2 . The gene model for Ss-cat-2 was initially derived from WBPS18 and then manually updated to include an additional exon ; the existence of this exon was supported by RNA-seq data , . Exons and introns are depicted as lavender boxes and black lines, respectively. The transcriptional start sites are indicated by black arrows. Ss-cat-2 has a single CRISPR/Cas9 target site, which is located in the second exon (depicted in red). Drawings are to scale and scale bar = 500 bp. F. Inactivation of Ss-cat-2 drastically alters skin-penetration behavior. Tracks show the skin-penetration behaviors of a representative wild-type iL3 that punctured and penetrated the skin and a representative Ss-cat-2 -/- iL3 that punctured but did not complete penetration. Representative worms were defined as in . The key details the behavioral motifs that were tracked. G. Inactivation of Ss-cat-2 severely impairs skin penetration. Bar graphs show the percentage of wild-type and Ss-cat-2 -/- iL3s that completed skin penetration. n = 21 iL3s per genotype. **** p <0.0001, Fisher’s exact test. H. Ss-cat-2 -/- iL3s pushed and punctured the skin for less time than control iL3s. Violin plot depicts the percentage of time on skin that control and Ss-cat-2 -/- iL3s spent engaging in pushes or punctures. n = 20-21 iL3s per genotype. **** p <0.0001, Mann-Whitney test. The iL3s that had initiated penetration by the time the recording started were excluded from this analysis. I. The pushing bouts of Ss-cat-2 -/- iL3s are shorter than those of control iL3s. For each worm, the duration of each individual pushing bout was averaged and then plotted. n = 20 iL3s per genotype. *** p <0.001, Mann-Whitney test. J. Inactivation of Ss-cat-2 inhibits punctures. Violin plot depicts the time taken by control vs. Ss-cat-2 -/- iL3s to puncture the skin for the first time since placement on skin. n = 21 iL3s per genotype. ** p <0.01, Mann-Whitney test. The dotted line at y = 5 indicates the time at which the assay ended; the dots above this line indicate animals that failed to puncture the skin by the end of the assay period. K. Ss-cat-2 -/- iL3s frequently reverse after a push or puncture event. Violin plot shows the percentage of pushes or punctures that were followed by backward locomotion that lasted at least 1 s for each genotype. n = 21 iL3s per genotype. **** p <0.0001, Mann-Whitney test. L. Ss-cat-2 -/- iL3s frequently abort penetration attempts. Violin plot depicts the percentage of penetration attempts, as defined by instances that the worm has punctured and partially entered the skin, that were aborted. n = 11-21 iL3s per genotype. ** p <0.01, Mann-Whitney test. For H-L, dots depict individual worms, dashed lines indicate medians, and dotted lines indicate interquartile ranges. Behavioral parameters plotted in G-L were obtained from 3 independent replicate experiments.
Guide Rna Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+sequence/guide+rna+sequence/bio_rxiv__2025__01__29__635547-214-1-31
Average 90 stars, based on 1 article reviews
guide rna sequence - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Sigma-Genosys guide sequence targeting ahr
Drug efficiency in SKMel28 melanoma cell lines in the presence or absence of <t>AhR.</t> ( A ) AhR protein levels relative to that of HSC70 were analyzed by western blotting in SKMel28 cells in the presence or not <t>AhR</t> <t>(CRISPR/Cas9).</t> ( B ) SKMel28 and SKMel28 AhR KO cells were treated for 48 h at a dose leading to an approximately 50% reduction in cell viability (IC50). Histograms show the percentage of cell viability ( n = 3) after treatment with ABT-263 (5 μM), SB505124 (20 μM), Afatinib (20 μM), and CHIR−99021_1241 (20 μM). Each histogram represents the mean ± s.d.; with unpaired t -tests with Sidak-Bonferroni method ( n = 4–6).
Guide Sequence Targeting Ahr, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+sequence/guide+sequence+targeting+ahr/pmc07828536-216-1-5
Average 90 stars, based on 1 article reviews
guide sequence targeting ahr - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Broad Institute Inc guide rna (grna) sequences targeting the exon regions of the human il15ra gene
Drug efficiency in SKMel28 melanoma cell lines in the presence or absence of <t>AhR.</t> ( A ) AhR protein levels relative to that of HSC70 were analyzed by western blotting in SKMel28 cells in the presence or not <t>AhR</t> <t>(CRISPR/Cas9).</t> ( B ) SKMel28 and SKMel28 AhR KO cells were treated for 48 h at a dose leading to an approximately 50% reduction in cell viability (IC50). Histograms show the percentage of cell viability ( n = 3) after treatment with ABT-263 (5 μM), SB505124 (20 μM), Afatinib (20 μM), and CHIR−99021_1241 (20 μM). Each histogram represents the mean ± s.d.; with unpaired t -tests with Sidak-Bonferroni method ( n = 4–6).
Guide Rna (Grna) Sequences Targeting The Exon Regions Of The Human Il15ra Gene, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+sequence/guide+rna++grna++sequences+targeting+the+exon+regions+of+the+human+il15ra+gene/pmc11986442-68-6-17
Average 90 stars, based on 1 article reviews
guide rna (grna) sequences targeting the exon regions of the human il15ra gene - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Microsynth ag complementary oligonucleotides harboring the guide rna sequence and bpii compatible overhangs
Drug efficiency in SKMel28 melanoma cell lines in the presence or absence of <t>AhR.</t> ( A ) AhR protein levels relative to that of HSC70 were analyzed by western blotting in SKMel28 cells in the presence or not <t>AhR</t> <t>(CRISPR/Cas9).</t> ( B ) SKMel28 and SKMel28 AhR KO cells were treated for 48 h at a dose leading to an approximately 50% reduction in cell viability (IC50). Histograms show the percentage of cell viability ( n = 3) after treatment with ABT-263 (5 μM), SB505124 (20 μM), Afatinib (20 μM), and CHIR−99021_1241 (20 μM). Each histogram represents the mean ± s.d.; with unpaired t -tests with Sidak-Bonferroni method ( n = 4–6).
Complementary Oligonucleotides Harboring The Guide Rna Sequence And Bpii Compatible Overhangs, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+sequence/complementary+oligonucleotides+harboring+guide+rna+sequence+bpii+compatible+overhangs/pmc07110143-441-8-14
Average 90 stars, based on 1 article reviews
complementary oligonucleotides harboring the guide rna sequence and bpii compatible overhangs - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
TATAA Biocenter AB guide rnas specific to the tataa box and flanking sequence in the tnf core promoter
Drug efficiency in SKMel28 melanoma cell lines in the presence or absence of <t>AhR.</t> ( A ) AhR protein levels relative to that of HSC70 were analyzed by western blotting in SKMel28 cells in the presence or not <t>AhR</t> <t>(CRISPR/Cas9).</t> ( B ) SKMel28 and SKMel28 AhR KO cells were treated for 48 h at a dose leading to an approximately 50% reduction in cell viability (IC50). Histograms show the percentage of cell viability ( n = 3) after treatment with ABT-263 (5 μM), SB505124 (20 μM), Afatinib (20 μM), and CHIR−99021_1241 (20 μM). Each histogram represents the mean ± s.d.; with unpaired t -tests with Sidak-Bonferroni method ( n = 4–6).
Guide Rnas Specific To The Tataa Box And Flanking Sequence In The Tnf Core Promoter, supplied by TATAA Biocenter AB, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+sequence/guide+rnas+specific+to+the+tataa+box+and+flanking+sequence+in+the+tnf+core+promoter/us10765664-391-10-7
Average 90 stars, based on 1 article reviews
guide rnas specific to the tataa box and flanking sequence in the tnf core promoter - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Broad Institute Inc guide rna (grna) sequences
Drug efficiency in SKMel28 melanoma cell lines in the presence or absence of <t>AhR.</t> ( A ) AhR protein levels relative to that of HSC70 were analyzed by western blotting in SKMel28 cells in the presence or not <t>AhR</t> <t>(CRISPR/Cas9).</t> ( B ) SKMel28 and SKMel28 AhR KO cells were treated for 48 h at a dose leading to an approximately 50% reduction in cell viability (IC50). Histograms show the percentage of cell viability ( n = 3) after treatment with ABT-263 (5 μM), SB505124 (20 μM), Afatinib (20 μM), and CHIR−99021_1241 (20 μM). Each histogram represents the mean ± s.d.; with unpaired t -tests with Sidak-Bonferroni method ( n = 4–6).
Guide Rna (Grna) Sequences, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+sequence/guide+rna++grna++sequences/pm39396119-44-2-23
Average 90 stars, based on 1 article reviews
guide rna (grna) sequences - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GenScript corporation 20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′)
Drug efficiency in SKMel28 melanoma cell lines in the presence or absence of <t>AhR.</t> ( A ) AhR protein levels relative to that of HSC70 were analyzed by western blotting in SKMel28 cells in the presence or not <t>AhR</t> <t>(CRISPR/Cas9).</t> ( B ) SKMel28 and SKMel28 AhR KO cells were treated for 48 h at a dose leading to an approximately 50% reduction in cell viability (IC50). Histograms show the percentage of cell viability ( n = 3) after treatment with ABT-263 (5 μM), SB505124 (20 μM), Afatinib (20 μM), and CHIR−99021_1241 (20 μM). Each histogram represents the mean ± s.d.; with unpaired t -tests with Sidak-Bonferroni method ( n = 4–6).
20 Bp Guide Rna (Grna) Sequence (5′ Catggagttcccgttcgatg 3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+sequence/20+bp+guide+rna++grna++sequence++5++catggagttcccgttcgatg+3++/pmc11105004-138-2-19
Average 90 stars, based on 1 article reviews
20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GenScript corporation tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’)
Drug efficiency in SKMel28 melanoma cell lines in the presence or absence of <t>AhR.</t> ( A ) AhR protein levels relative to that of HSC70 were analyzed by western blotting in SKMel28 cells in the presence or not <t>AhR</t> <t>(CRISPR/Cas9).</t> ( B ) SKMel28 and SKMel28 AhR KO cells were treated for 48 h at a dose leading to an approximately 50% reduction in cell viability (IC50). Histograms show the percentage of cell viability ( n = 3) after treatment with ABT-263 (5 μM), SB505124 (20 μM), Afatinib (20 μM), and CHIR−99021_1241 (20 μM). Each histogram represents the mean ± s.d.; with unpaired t -tests with Sidak-Bonferroni method ( n = 4–6).
Tom20 Crispr Guide Rna Sequence (5’ Taagctcccaacaattagtc 3’), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+sequence/tom20+crispr+guide+rna+sequence++5++taagctcccaacaattagtc+3++/10__1074_slash_jbc__ra118__006693-184-10-28
Average 90 stars, based on 1 article reviews
tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Broad Institute Inc guide sequence ttggtgatcaatacagctgg
Drug efficiency in SKMel28 melanoma cell lines in the presence or absence of <t>AhR.</t> ( A ) AhR protein levels relative to that of HSC70 were analyzed by western blotting in SKMel28 cells in the presence or not <t>AhR</t> <t>(CRISPR/Cas9).</t> ( B ) SKMel28 and SKMel28 AhR KO cells were treated for 48 h at a dose leading to an approximately 50% reduction in cell viability (IC50). Histograms show the percentage of cell viability ( n = 3) after treatment with ABT-263 (5 μM), SB505124 (20 μM), Afatinib (20 μM), and CHIR−99021_1241 (20 μM). Each histogram represents the mean ± s.d.; with unpaired t -tests with Sidak-Bonferroni method ( n = 4–6).
Guide Sequence Ttggtgatcaatacagctgg, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+sequence/guide+sequence+ttggtgatcaatacagctgg/pmc08674260-277-7-10
Average 90 stars, based on 1 article reviews
guide sequence ttggtgatcaatacagctgg - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


A. Phylogenetic analysis shows the closest homologs of C. elegans CAT-2 (gray) in S. stercoralis (brown) and S. ratti (blue). Putative homologs in each genome were identified by performing TBLASTN searches of the C. elegans CAT-2A protein sequence (i.e ., the longest isoform) against either the S. stercoralis genome or the S. ratti genome in WormBase ParaSite WBPS18. The tree has the three members of the biopterin-dependent aromatic amino acid hydroxylases in C. elegans , of which CAT-2 is a member, and the predicted homologs in S. stercoralis and S. ratti . B. Co-expression of Ss-cat-2 and Ss-dat-1 in the putative dopaminergic (DA) neurons of S. stercoralis . Montage shows expression of the Ss-cat-2 transcriptional reporter in green, expression of the Ss-dat-1 transcriptional reporter in magenta, and co-expression of the two reporters and the relative positions of these neurons along the body of the iL3 in the differential interference contrast (DIC) overlay. The circles, asterisk, and arrow label the putative Ss- CEP, Ss- ADE, and Ss- PDE neurons, respectively. The iL3 is oriented with the dorsal side facing up and the ventral side facing down; the head is to the left. Scale bar = 100 µm. C-D. Violin plots show expression levels of Ss-cat-2 and Ss-dat-1 , expressed as log 2 counts per million (CPM), at the indicated life stages based on published RNA-seq datasets , , . **** p <0.0001; statistical tests for differential expression analysis were performed as previously described, with corrections for multiple comparisons . FLF = free-living female; iL3 = infective third-stage larva; ppL3 = post-parasitic third-stage larva; PF = parasitic female. Each dot indicates an independent replicate experiment. E. The cat-2 genes of C. elegans and S. stercoralis . Schematics show the gene models of Ce-cat-2 (isoform a), as annotated in WormBase WS292, and Ss-cat-2 . The gene model for Ss-cat-2 was initially derived from WBPS18 and then manually updated to include an additional exon ; the existence of this exon was supported by RNA-seq data , . Exons and introns are depicted as lavender boxes and black lines, respectively. The transcriptional start sites are indicated by black arrows. Ss-cat-2 has a single CRISPR/Cas9 target site, which is located in the second exon (depicted in red). Drawings are to scale and scale bar = 500 bp. F. Inactivation of Ss-cat-2 drastically alters skin-penetration behavior. Tracks show the skin-penetration behaviors of a representative wild-type iL3 that punctured and penetrated the skin and a representative Ss-cat-2 -/- iL3 that punctured but did not complete penetration. Representative worms were defined as in . The key details the behavioral motifs that were tracked. G. Inactivation of Ss-cat-2 severely impairs skin penetration. Bar graphs show the percentage of wild-type and Ss-cat-2 -/- iL3s that completed skin penetration. n = 21 iL3s per genotype. **** p <0.0001, Fisher’s exact test. H. Ss-cat-2 -/- iL3s pushed and punctured the skin for less time than control iL3s. Violin plot depicts the percentage of time on skin that control and Ss-cat-2 -/- iL3s spent engaging in pushes or punctures. n = 20-21 iL3s per genotype. **** p <0.0001, Mann-Whitney test. The iL3s that had initiated penetration by the time the recording started were excluded from this analysis. I. The pushing bouts of Ss-cat-2 -/- iL3s are shorter than those of control iL3s. For each worm, the duration of each individual pushing bout was averaged and then plotted. n = 20 iL3s per genotype. *** p <0.001, Mann-Whitney test. J. Inactivation of Ss-cat-2 inhibits punctures. Violin plot depicts the time taken by control vs. Ss-cat-2 -/- iL3s to puncture the skin for the first time since placement on skin. n = 21 iL3s per genotype. ** p <0.01, Mann-Whitney test. The dotted line at y = 5 indicates the time at which the assay ended; the dots above this line indicate animals that failed to puncture the skin by the end of the assay period. K. Ss-cat-2 -/- iL3s frequently reverse after a push or puncture event. Violin plot shows the percentage of pushes or punctures that were followed by backward locomotion that lasted at least 1 s for each genotype. n = 21 iL3s per genotype. **** p <0.0001, Mann-Whitney test. L. Ss-cat-2 -/- iL3s frequently abort penetration attempts. Violin plot depicts the percentage of penetration attempts, as defined by instances that the worm has punctured and partially entered the skin, that were aborted. n = 11-21 iL3s per genotype. ** p <0.01, Mann-Whitney test. For H-L, dots depict individual worms, dashed lines indicate medians, and dotted lines indicate interquartile ranges. Behavioral parameters plotted in G-L were obtained from 3 independent replicate experiments.

Journal: bioRxiv

Article Title: Dopamine signaling drives skin invasion by human-infective nematodes

doi: 10.1101/2025.01.29.635547

Figure Lengend Snippet: A. Phylogenetic analysis shows the closest homologs of C. elegans CAT-2 (gray) in S. stercoralis (brown) and S. ratti (blue). Putative homologs in each genome were identified by performing TBLASTN searches of the C. elegans CAT-2A protein sequence (i.e ., the longest isoform) against either the S. stercoralis genome or the S. ratti genome in WormBase ParaSite WBPS18. The tree has the three members of the biopterin-dependent aromatic amino acid hydroxylases in C. elegans , of which CAT-2 is a member, and the predicted homologs in S. stercoralis and S. ratti . B. Co-expression of Ss-cat-2 and Ss-dat-1 in the putative dopaminergic (DA) neurons of S. stercoralis . Montage shows expression of the Ss-cat-2 transcriptional reporter in green, expression of the Ss-dat-1 transcriptional reporter in magenta, and co-expression of the two reporters and the relative positions of these neurons along the body of the iL3 in the differential interference contrast (DIC) overlay. The circles, asterisk, and arrow label the putative Ss- CEP, Ss- ADE, and Ss- PDE neurons, respectively. The iL3 is oriented with the dorsal side facing up and the ventral side facing down; the head is to the left. Scale bar = 100 µm. C-D. Violin plots show expression levels of Ss-cat-2 and Ss-dat-1 , expressed as log 2 counts per million (CPM), at the indicated life stages based on published RNA-seq datasets , , . **** p <0.0001; statistical tests for differential expression analysis were performed as previously described, with corrections for multiple comparisons . FLF = free-living female; iL3 = infective third-stage larva; ppL3 = post-parasitic third-stage larva; PF = parasitic female. Each dot indicates an independent replicate experiment. E. The cat-2 genes of C. elegans and S. stercoralis . Schematics show the gene models of Ce-cat-2 (isoform a), as annotated in WormBase WS292, and Ss-cat-2 . The gene model for Ss-cat-2 was initially derived from WBPS18 and then manually updated to include an additional exon ; the existence of this exon was supported by RNA-seq data , . Exons and introns are depicted as lavender boxes and black lines, respectively. The transcriptional start sites are indicated by black arrows. Ss-cat-2 has a single CRISPR/Cas9 target site, which is located in the second exon (depicted in red). Drawings are to scale and scale bar = 500 bp. F. Inactivation of Ss-cat-2 drastically alters skin-penetration behavior. Tracks show the skin-penetration behaviors of a representative wild-type iL3 that punctured and penetrated the skin and a representative Ss-cat-2 -/- iL3 that punctured but did not complete penetration. Representative worms were defined as in . The key details the behavioral motifs that were tracked. G. Inactivation of Ss-cat-2 severely impairs skin penetration. Bar graphs show the percentage of wild-type and Ss-cat-2 -/- iL3s that completed skin penetration. n = 21 iL3s per genotype. **** p <0.0001, Fisher’s exact test. H. Ss-cat-2 -/- iL3s pushed and punctured the skin for less time than control iL3s. Violin plot depicts the percentage of time on skin that control and Ss-cat-2 -/- iL3s spent engaging in pushes or punctures. n = 20-21 iL3s per genotype. **** p <0.0001, Mann-Whitney test. The iL3s that had initiated penetration by the time the recording started were excluded from this analysis. I. The pushing bouts of Ss-cat-2 -/- iL3s are shorter than those of control iL3s. For each worm, the duration of each individual pushing bout was averaged and then plotted. n = 20 iL3s per genotype. *** p <0.001, Mann-Whitney test. J. Inactivation of Ss-cat-2 inhibits punctures. Violin plot depicts the time taken by control vs. Ss-cat-2 -/- iL3s to puncture the skin for the first time since placement on skin. n = 21 iL3s per genotype. ** p <0.01, Mann-Whitney test. The dotted line at y = 5 indicates the time at which the assay ended; the dots above this line indicate animals that failed to puncture the skin by the end of the assay period. K. Ss-cat-2 -/- iL3s frequently reverse after a push or puncture event. Violin plot shows the percentage of pushes or punctures that were followed by backward locomotion that lasted at least 1 s for each genotype. n = 21 iL3s per genotype. **** p <0.0001, Mann-Whitney test. L. Ss-cat-2 -/- iL3s frequently abort penetration attempts. Violin plot depicts the percentage of penetration attempts, as defined by instances that the worm has punctured and partially entered the skin, that were aborted. n = 11-21 iL3s per genotype. ** p <0.01, Mann-Whitney test. For H-L, dots depict individual worms, dashed lines indicate medians, and dotted lines indicate interquartile ranges. Behavioral parameters plotted in G-L were obtained from 3 independent replicate experiments.

Article Snippet: This guide RNA sequence was synthesized and fused with the promoter of the S. ratti U6 gene, the sequence of the sgRNA scaffold, and the S. ratti U6 3′ UTR by GenScript, as previously described .

Techniques: Sequencing, Expressing, RNA Sequencing Assay, Derivative Assay, CRISPR, Control, MANN-WHITNEY

A. Phylogenetic analysis shows the closest homologs of C. elegans TRP-4 (gray) in S. stercoralis (brown). Putative homologs in each genome were identified by performing TBLASTN searches of the C. elegans TRP-4 protein sequence against the S. stercoralis genome in WBPS18. The tree has all known TRP family members in C. elegans - and the predicted homologs in S. stercoralis . B. Co-expression of Ss-trp-4 and Ss-dat-1 in the putative dopaminergic (DA) neurons of S. stercoralis . Montage shows expression of the Ss-trp-4 transcriptional reporter in green, expression of the Ss-dat-1 transcriptional reporter in magenta, and co-expression of the two reporters and the relative positions of these neurons along the body of the iL3 in the DIC overlay. The circles, asterisk, and arrow label the putative Ss- CEP, Ss- ADE, and Ss- PDE neurons, respectively; we never observed expression of the Ss-trp-4 reporter in Ss- PDE. The iL3 is oriented with the dorsal side facing up and head to the left. Scale bar = 100 µm. C. Violin plot shows expression levels of Ss-trp-4 , expressed as log 2 counts per million (CPM), in the indicated life stages based on published RNA-seq datasets , , . **** p <0.0001; statistical tests for differential expression analysis were performed as previously described, with corrections for multiple comparisons . FLF = free-living female; iL3 = infective third-stage larva; ppL3 = post-parasitic third-stage larva; PF = parasitic female. Each dot indicates an independent replicate experiment. D. The trp-4 genes of C. elegans and S. stercoralis . Schematics show the gene models of Ce-trp-4 and Ss-trp-4 , which were derived from annotations in WS292 and WBPS18, respectively. Notably, the Ss-trp-4 gene model has a 5′ UTR that is not annotated in WBPS18 but is supported by published RNA-seq data , . Exons, introns, and UTRs are depicted as pink boxes, black lines, and gray boxes, respectively. The transcriptional start sites are indicated by black arrows. Ss-trp-4 has two CRISPR/Cas9 target sites in the first exon, which are depicted in red; we used two distinct sgRNAs, one targeting each CRISPR site, to inactivate Ss-trp-4 and generate a mutant stable line. Drawings are to scale and scale bar = 1000 bp. E. Ss-trp-4 mutants have reduced skin-penetration drive. Tracks show the skin-penetration behaviors of a representative wild-type iL3 that punctured and completed penetration and a representative Ss-trp-4 -/- iL3 that neither punctured nor completed penetration. Representative worms were defined as in . The key details the behavioral motifs that were tracked. F. Inactivation of Ss-trp-4 severely inhibits skin penetration. Bar graph shows the percentage of wild-type and Ss-trp-4 -/- iL3s that completed skin penetration. n = 24 iL3s per genotype. **** p <0.0001, Fisher’s exact test. G. Ss-trp-4 -/- iL3s pushed and punctured the skin for less time than control worms. Violin plot depicts the percentage of time on skin that control and Ss-trp-4 -/- iL3s spent engaging in pushes or punctures. n = 23-24 iL3s per genotype. **** p <0.0001, Mann-Whitney test. The iL3s that had initiated penetration by the time the recording started were excluded from this analysis. H. The pushing bouts of Ss-trp-4 -/- iL3s are shorter than those of control iL3s. For each worm, the duration of each individual pushing bout was averaged and then plotted. n = 23 iL3s per genotype. ** p <0.01, Mann-Whitney test. I. Inactivation of Ss-trp-4 inhibits punctures. Violin plot depicts the time taken by control vs. Ss-trp-4 -/- iL3s to puncture the skin for the first time since placement on skin. n = 24 iL3s per genotype. **** p <0.0001, Mann-Whitney test. The dotted line at y = 5 indicates the time at which the assay ended; the dots above this line indicate animals that failed to puncture the skin by the end of the assay. J. Ss-trp-4 -/- iL3s frequently reverse after a push or puncture event. Violin plot shows the percentage of pushes or punctures that were followed by backward locomotion that lasted at least 1 s for each genotype. n = 23-24 iL3s per genotype. *** p <0.001, Mann-Whitney test. K. Ss-trp-4 -/- iL3s frequently abort penetration attempts. Violin plot depicts the percentage of penetration attempts, as defined by instances that the worm has punctured and partially entered the skin, that were aborted. n = 9-24 iL3s per genotype. *** p <0.001, Mann-Whitney test. For G-K, dots depict individual worms, dashed lines indicate the median, and dotted lines indicate the interquartile range. Behavioral parameters plotted in F-K were obtained from 3 independent replicate experiments.

Journal: bioRxiv

Article Title: Dopamine signaling drives skin invasion by human-infective nematodes

doi: 10.1101/2025.01.29.635547

Figure Lengend Snippet: A. Phylogenetic analysis shows the closest homologs of C. elegans TRP-4 (gray) in S. stercoralis (brown). Putative homologs in each genome were identified by performing TBLASTN searches of the C. elegans TRP-4 protein sequence against the S. stercoralis genome in WBPS18. The tree has all known TRP family members in C. elegans - and the predicted homologs in S. stercoralis . B. Co-expression of Ss-trp-4 and Ss-dat-1 in the putative dopaminergic (DA) neurons of S. stercoralis . Montage shows expression of the Ss-trp-4 transcriptional reporter in green, expression of the Ss-dat-1 transcriptional reporter in magenta, and co-expression of the two reporters and the relative positions of these neurons along the body of the iL3 in the DIC overlay. The circles, asterisk, and arrow label the putative Ss- CEP, Ss- ADE, and Ss- PDE neurons, respectively; we never observed expression of the Ss-trp-4 reporter in Ss- PDE. The iL3 is oriented with the dorsal side facing up and head to the left. Scale bar = 100 µm. C. Violin plot shows expression levels of Ss-trp-4 , expressed as log 2 counts per million (CPM), in the indicated life stages based on published RNA-seq datasets , , . **** p <0.0001; statistical tests for differential expression analysis were performed as previously described, with corrections for multiple comparisons . FLF = free-living female; iL3 = infective third-stage larva; ppL3 = post-parasitic third-stage larva; PF = parasitic female. Each dot indicates an independent replicate experiment. D. The trp-4 genes of C. elegans and S. stercoralis . Schematics show the gene models of Ce-trp-4 and Ss-trp-4 , which were derived from annotations in WS292 and WBPS18, respectively. Notably, the Ss-trp-4 gene model has a 5′ UTR that is not annotated in WBPS18 but is supported by published RNA-seq data , . Exons, introns, and UTRs are depicted as pink boxes, black lines, and gray boxes, respectively. The transcriptional start sites are indicated by black arrows. Ss-trp-4 has two CRISPR/Cas9 target sites in the first exon, which are depicted in red; we used two distinct sgRNAs, one targeting each CRISPR site, to inactivate Ss-trp-4 and generate a mutant stable line. Drawings are to scale and scale bar = 1000 bp. E. Ss-trp-4 mutants have reduced skin-penetration drive. Tracks show the skin-penetration behaviors of a representative wild-type iL3 that punctured and completed penetration and a representative Ss-trp-4 -/- iL3 that neither punctured nor completed penetration. Representative worms were defined as in . The key details the behavioral motifs that were tracked. F. Inactivation of Ss-trp-4 severely inhibits skin penetration. Bar graph shows the percentage of wild-type and Ss-trp-4 -/- iL3s that completed skin penetration. n = 24 iL3s per genotype. **** p <0.0001, Fisher’s exact test. G. Ss-trp-4 -/- iL3s pushed and punctured the skin for less time than control worms. Violin plot depicts the percentage of time on skin that control and Ss-trp-4 -/- iL3s spent engaging in pushes or punctures. n = 23-24 iL3s per genotype. **** p <0.0001, Mann-Whitney test. The iL3s that had initiated penetration by the time the recording started were excluded from this analysis. H. The pushing bouts of Ss-trp-4 -/- iL3s are shorter than those of control iL3s. For each worm, the duration of each individual pushing bout was averaged and then plotted. n = 23 iL3s per genotype. ** p <0.01, Mann-Whitney test. I. Inactivation of Ss-trp-4 inhibits punctures. Violin plot depicts the time taken by control vs. Ss-trp-4 -/- iL3s to puncture the skin for the first time since placement on skin. n = 24 iL3s per genotype. **** p <0.0001, Mann-Whitney test. The dotted line at y = 5 indicates the time at which the assay ended; the dots above this line indicate animals that failed to puncture the skin by the end of the assay. J. Ss-trp-4 -/- iL3s frequently reverse after a push or puncture event. Violin plot shows the percentage of pushes or punctures that were followed by backward locomotion that lasted at least 1 s for each genotype. n = 23-24 iL3s per genotype. *** p <0.001, Mann-Whitney test. K. Ss-trp-4 -/- iL3s frequently abort penetration attempts. Violin plot depicts the percentage of penetration attempts, as defined by instances that the worm has punctured and partially entered the skin, that were aborted. n = 9-24 iL3s per genotype. *** p <0.001, Mann-Whitney test. For G-K, dots depict individual worms, dashed lines indicate the median, and dotted lines indicate the interquartile range. Behavioral parameters plotted in F-K were obtained from 3 independent replicate experiments.

Article Snippet: This guide RNA sequence was synthesized and fused with the promoter of the S. ratti U6 gene, the sequence of the sgRNA scaffold, and the S. ratti U6 3′ UTR by GenScript, as previously described .

Techniques: Sequencing, Expressing, RNA Sequencing Assay, Derivative Assay, CRISPR, Mutagenesis, Control, MANN-WHITNEY

Drug efficiency in SKMel28 melanoma cell lines in the presence or absence of AhR. ( A ) AhR protein levels relative to that of HSC70 were analyzed by western blotting in SKMel28 cells in the presence or not AhR (CRISPR/Cas9). ( B ) SKMel28 and SKMel28 AhR KO cells were treated for 48 h at a dose leading to an approximately 50% reduction in cell viability (IC50). Histograms show the percentage of cell viability ( n = 3) after treatment with ABT-263 (5 μM), SB505124 (20 μM), Afatinib (20 μM), and CHIR−99021_1241 (20 μM). Each histogram represents the mean ± s.d.; with unpaired t -tests with Sidak-Bonferroni method ( n = 4–6).

Journal: International Journal of Molecular Sciences

Article Title: AhR and Cancer: From Gene Profiling to Targeted Therapy

doi: 10.3390/ijms22020752

Figure Lengend Snippet: Drug efficiency in SKMel28 melanoma cell lines in the presence or absence of AhR. ( A ) AhR protein levels relative to that of HSC70 were analyzed by western blotting in SKMel28 cells in the presence or not AhR (CRISPR/Cas9). ( B ) SKMel28 and SKMel28 AhR KO cells were treated for 48 h at a dose leading to an approximately 50% reduction in cell viability (IC50). Histograms show the percentage of cell viability ( n = 3) after treatment with ABT-263 (5 μM), SB505124 (20 μM), Afatinib (20 μM), and CHIR−99021_1241 (20 μM). Each histogram represents the mean ± s.d.; with unpaired t -tests with Sidak-Bonferroni method ( n = 4–6).

Article Snippet: The guide sequence targeting AhR (Sigma-Genosys, St. Louis, MO, USA) was cloned into the GeneArt CRISPR Nuclease vector according to the manufacturer’s instructions (Life Technologies, Saint-Aubin, France).

Techniques: Western Blot, CRISPR