fkbp51 Search Results


94
Novus Biologicals fkbp51
Fig. 1 SAFit enhances melanoma cell death. a Dose response assay of SAFit 1 and 2 on Doxo-induced cell death. A375 melanoma cells were cultured in the presence or absence of 3 μM Doxo and/or SAFit 1 (4, 20 and 40 nM) and SAFit 2 (6, 30 and 60 nM). After a 48 h incubation, cell death was assessed by measuring the proportion of hypodiploid cells by flow cytometry. b (Left) Western blot assay showing exogenous levels of <t>FKBP51,</t> β-Actin was used as loading control. Full length western blots are shown as Supplemental Material. (Right) Graphical representation of cell death values (N = 4) from cultures of Flag-FKBP51 and EV incubated with 3 μM Doxo and/or 20 nM SAFit 1. After a 48 h incubation, cells were harvested and analysed by PI incorporation and flow cytometry. Representative flow cytometry histograms of PI incorporation are shown below. c SAFit improves dacarbazine (DTIC)-induced cell death. SAN melanoma cells were cultured in the presence or absence of 27 μM DTIC and with or without 100 nM SAFit 1 or 100 nM rapamycin. After 48 h incubation cells were harvested and analysed by flow cytometry. The graph shows cell death values obtained from independent experiments (N = 3). Representative flow cytometry histograms of PI incorporation are shown below.
Fkbp51, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fkbp51/pm40180895-177-15-17?v=Novus+Biologicals
Average 94 stars, based on 1 article reviews
fkbp51 - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

93
Bethyl fkbp5 fkbp51
Fig. 1 SAFit enhances melanoma cell death. a Dose response assay of SAFit 1 and 2 on Doxo-induced cell death. A375 melanoma cells were cultured in the presence or absence of 3 μM Doxo and/or SAFit 1 (4, 20 and 40 nM) and SAFit 2 (6, 30 and 60 nM). After a 48 h incubation, cell death was assessed by measuring the proportion of hypodiploid cells by flow cytometry. b (Left) Western blot assay showing exogenous levels of <t>FKBP51,</t> β-Actin was used as loading control. Full length western blots are shown as Supplemental Material. (Right) Graphical representation of cell death values (N = 4) from cultures of Flag-FKBP51 and EV incubated with 3 μM Doxo and/or 20 nM SAFit 1. After a 48 h incubation, cells were harvested and analysed by PI incorporation and flow cytometry. Representative flow cytometry histograms of PI incorporation are shown below. c SAFit improves dacarbazine (DTIC)-induced cell death. SAN melanoma cells were cultured in the presence or absence of 27 μM DTIC and with or without 100 nM SAFit 1 or 100 nM rapamycin. After 48 h incubation cells were harvested and analysed by flow cytometry. The graph shows cell death values obtained from independent experiments (N = 3). Representative flow cytometry histograms of PI incorporation are shown below.
Fkbp5 Fkbp51, supplied by Bethyl, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fkbp51/pmc06561294__pnas__1816847116__sapp-176-10-12?v=Bethyl
Average 93 stars, based on 1 article reviews
fkbp5 fkbp51 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

94
OriGene human fkbp51
<t>FKBP51</t> overexpression dampens insulin signaling in HepG2 cells but does not hinder its effects on glucose metabolism. HepG2 cells were transfected with either a plasmid coding Myc-DDK-tagged human FKBP51 (FKBP51) or an empty pCMV6 plasmid (Control) and were stimulated for 0.5 h with 100 nM insulin. ( A ) Representative blot ( n = 8), ( B ) FKBP51 protein levels, ( C ) Akt phosphorylation, ( D ) P70S6K phosphorylation, ( E ) FOXO1, ( F and G ) Glucose production assay ( n = 4), ( H ) mRNA levels (G6P, PCK1 y PDK4) ( n = 4), ( I ) Representative blot ( n = 3), GSK3β phosphorylation, ( J ) Representative imagens of glycogen synthesis assay and ( K ) Glycogen synthesis ( n = 4). One-way analysis of variance (ANOVA) followed by Tukey post hoc test. * p < 0.05 compared with control and square brackets with FKBP51 with insulin. Data are shown as means ± SEM.
Human Fkbp51, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fkbp51/pmc13018298-29-9-20?v=OriGene
Average 94 stars, based on 1 article reviews
human fkbp51 - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

90
OriGene human fkbp5
Demographics, cortisol metrics, <t> FKBP5 </t> expression and psychosocial measures by sex
Human Fkbp5, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fkbp51/pmc06366448-116-12-17?v=OriGene
Average 90 stars, based on 1 article reviews
human fkbp5 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
R&D Systems fkbp51
Fig. 7. FKBP12 and <t>FKBP51</t> protein expressions in Tacrolimus-, Sirolimus- and Everolimus-treated HepG2 (A and B, respectively) and Huh7 (C and D, respectively) cells. Treatments were administered at different concentrations (0, 10 nM, 10 µM, and 100 µM). The protein expression of FKBP12 and FKBP51 was evaluated by Western‐blot analysis as described in Material and Methods. Results are expressed as mean ± SEM, and blots are representative of four to six independent experiments. *p ≤ 0.05 between control and immunosuppressant‐treated cells. The groups with different letters (a, b, c or d) were significantly different (p ≤ 0.05).
Fkbp51, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fkbp51/pm32369692-69-79-88?v=R%26D+Systems
Average 90 stars, based on 1 article reviews
fkbp51 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
OriGene length myc ddk
Fig. 7. FKBP12 and <t>FKBP51</t> protein expressions in Tacrolimus-, Sirolimus- and Everolimus-treated HepG2 (A and B, respectively) and Huh7 (C and D, respectively) cells. Treatments were administered at different concentrations (0, 10 nM, 10 µM, and 100 µM). The protein expression of FKBP12 and FKBP51 was evaluated by Western‐blot analysis as described in Material and Methods. Results are expressed as mean ± SEM, and blots are representative of four to six independent experiments. *p ≤ 0.05 between control and immunosuppressant‐treated cells. The groups with different letters (a, b, c or d) were significantly different (p ≤ 0.05).
Length Myc Ddk, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fkbp51/pmc08881485-216-4-15?v=OriGene
Average 90 stars, based on 1 article reviews
length myc ddk - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

94
R&D Systems 11bhsd1
Figure 7 AR signaling modulates <t>11BHSD1</t> and contributes to GR-regulated transcriptional activity in WAT but not liver. (A, B, C and D) Hsd11b1 mRNA and 11BHSD1 protein expression in WAT and liver upon glucocorticoid and androgen interventions. (E and F) The relationship between CORT levels and the expression of GR-responsive genes Fkbp5, Gilz and Mt2a in WAT and liver. Data are mean ± s.e.m. and N = 6–7 per group. Statistical significance was calculated using a one-way ANOVA with the Tukey multiple-comparisons test. *P < 0.05 vs Vehicle, **P < 0.01 vs Vehicle, $P < 0.05 vs CORT, $$P < 0.01 vs CORT. Representative Western images are shown and quantification of protein expression is based on 6 per group. GAPDH loading controls in Fig. 7D are identical to the ones shown in Fig. 3K.
11bhsd1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fkbp51/10__1530_slash_joe___18___0503-63-8-18?v=R%26D+Systems
Average 94 stars, based on 1 article reviews
11bhsd1 - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

93
R&D Systems fkbp51 goat polyclonal antibody
Figure 7 AR signaling modulates <t>11BHSD1</t> and contributes to GR-regulated transcriptional activity in WAT but not liver. (A, B, C and D) Hsd11b1 mRNA and 11BHSD1 protein expression in WAT and liver upon glucocorticoid and androgen interventions. (E and F) The relationship between CORT levels and the expression of GR-responsive genes Fkbp5, Gilz and Mt2a in WAT and liver. Data are mean ± s.e.m. and N = 6–7 per group. Statistical significance was calculated using a one-way ANOVA with the Tukey multiple-comparisons test. *P < 0.05 vs Vehicle, **P < 0.01 vs Vehicle, $P < 0.05 vs CORT, $$P < 0.01 vs CORT. Representative Western images are shown and quantification of protein expression is based on 6 per group. GAPDH loading controls in Fig. 7D are identical to the ones shown in Fig. 3K.
Fkbp51 Goat Polyclonal Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fkbp51/us12409182-330-73-77?v=R%26D+Systems
Average 93 stars, based on 1 article reviews
fkbp51 goat polyclonal antibody - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

94
Proteintech rabbit anti fkbp5
Figure 7 AR signaling modulates <t>11BHSD1</t> and contributes to GR-regulated transcriptional activity in WAT but not liver. (A, B, C and D) Hsd11b1 mRNA and 11BHSD1 protein expression in WAT and liver upon glucocorticoid and androgen interventions. (E and F) The relationship between CORT levels and the expression of GR-responsive genes Fkbp5, Gilz and Mt2a in WAT and liver. Data are mean ± s.e.m. and N = 6–7 per group. Statistical significance was calculated using a one-way ANOVA with the Tukey multiple-comparisons test. *P < 0.05 vs Vehicle, **P < 0.01 vs Vehicle, $P < 0.05 vs CORT, $$P < 0.01 vs CORT. Representative Western images are shown and quantification of protein expression is based on 6 per group. GAPDH loading controls in Fig. 7D are identical to the ones shown in Fig. 3K.
Rabbit Anti Fkbp5, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fkbp51/10__1038_slash_s41590___026___02472___z-599-44-49?v=Proteintech
Average 94 stars, based on 1 article reviews
rabbit anti fkbp5 - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

94
novus biologicals nbp2-33944
Figure 7 AR signaling modulates <t>11BHSD1</t> and contributes to GR-regulated transcriptional activity in WAT but not liver. (A, B, C and D) Hsd11b1 mRNA and 11BHSD1 protein expression in WAT and liver upon glucocorticoid and androgen interventions. (E and F) The relationship between CORT levels and the expression of GR-responsive genes Fkbp5, Gilz and Mt2a in WAT and liver. Data are mean ± s.e.m. and N = 6–7 per group. Statistical significance was calculated using a one-way ANOVA with the Tukey multiple-comparisons test. *P < 0.05 vs Vehicle, **P < 0.01 vs Vehicle, $P < 0.05 vs CORT, $$P < 0.01 vs CORT. Representative Western images are shown and quantification of protein expression is based on 6 per group. GAPDH loading controls in Fig. 7D are identical to the ones shown in Fig. 3K.
Nbp2 33944, supplied by novus biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fkbp51/pmc12979786-12-0-5?v=novus+biologicals
Average 94 stars, based on 1 article reviews
nbp2-33944 - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

93
Proteintech anti fkbp52
Figure 7 AR signaling modulates <t>11BHSD1</t> and contributes to GR-regulated transcriptional activity in WAT but not liver. (A, B, C and D) Hsd11b1 mRNA and 11BHSD1 protein expression in WAT and liver upon glucocorticoid and androgen interventions. (E and F) The relationship between CORT levels and the expression of GR-responsive genes Fkbp5, Gilz and Mt2a in WAT and liver. Data are mean ± s.e.m. and N = 6–7 per group. Statistical significance was calculated using a one-way ANOVA with the Tukey multiple-comparisons test. *P < 0.05 vs Vehicle, **P < 0.01 vs Vehicle, $P < 0.05 vs CORT, $$P < 0.01 vs CORT. Representative Western images are shown and quantification of protein expression is based on 6 per group. GAPDH loading controls in Fig. 7D are identical to the ones shown in Fig. 3K.
Anti Fkbp52, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fkbp51/pm38746882__ml4c00022_si_001-58-23-25?v=Proteintech
Average 93 stars, based on 1 article reviews
anti fkbp52 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

92
OriGene human fkbp5 fp gcgaaggagaagaccacgacat origene cat
Figure 7 AR signaling modulates <t>11BHSD1</t> and contributes to GR-regulated transcriptional activity in WAT but not liver. (A, B, C and D) Hsd11b1 mRNA and 11BHSD1 protein expression in WAT and liver upon glucocorticoid and androgen interventions. (E and F) The relationship between CORT levels and the expression of GR-responsive genes Fkbp5, Gilz and Mt2a in WAT and liver. Data are mean ± s.e.m. and N = 6–7 per group. Statistical significance was calculated using a one-way ANOVA with the Tukey multiple-comparisons test. *P < 0.05 vs Vehicle, **P < 0.01 vs Vehicle, $P < 0.05 vs CORT, $$P < 0.01 vs CORT. Representative Western images are shown and quantification of protein expression is based on 6 per group. GAPDH loading controls in Fig. 7D are identical to the ones shown in Fig. 3K.
Human Fkbp5 Fp Gcgaaggagaagaccacgacat Origene Cat, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fkbp51/pmc11224269__41467_2024_49978_MOESM1_ESM-130-222-225?v=OriGene
Average 92 stars, based on 1 article reviews
human fkbp5 fp gcgaaggagaagaccacgacat origene cat - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

Image Search Results


Fig. 1 SAFit enhances melanoma cell death. a Dose response assay of SAFit 1 and 2 on Doxo-induced cell death. A375 melanoma cells were cultured in the presence or absence of 3 μM Doxo and/or SAFit 1 (4, 20 and 40 nM) and SAFit 2 (6, 30 and 60 nM). After a 48 h incubation, cell death was assessed by measuring the proportion of hypodiploid cells by flow cytometry. b (Left) Western blot assay showing exogenous levels of FKBP51, β-Actin was used as loading control. Full length western blots are shown as Supplemental Material. (Right) Graphical representation of cell death values (N = 4) from cultures of Flag-FKBP51 and EV incubated with 3 μM Doxo and/or 20 nM SAFit 1. After a 48 h incubation, cells were harvested and analysed by PI incorporation and flow cytometry. Representative flow cytometry histograms of PI incorporation are shown below. c SAFit improves dacarbazine (DTIC)-induced cell death. SAN melanoma cells were cultured in the presence or absence of 27 μM DTIC and with or without 100 nM SAFit 1 or 100 nM rapamycin. After 48 h incubation cells were harvested and analysed by flow cytometry. The graph shows cell death values obtained from independent experiments (N = 3). Representative flow cytometry histograms of PI incorporation are shown below.

Journal: Cell death discovery

Article Title: Exploring the potential of selective FKBP51 inhibitors on melanoma: an investigation of their in vitro and in vivo effects.

doi: 10.1038/s41420-025-02430-y

Figure Lengend Snippet: Fig. 1 SAFit enhances melanoma cell death. a Dose response assay of SAFit 1 and 2 on Doxo-induced cell death. A375 melanoma cells were cultured in the presence or absence of 3 μM Doxo and/or SAFit 1 (4, 20 and 40 nM) and SAFit 2 (6, 30 and 60 nM). After a 48 h incubation, cell death was assessed by measuring the proportion of hypodiploid cells by flow cytometry. b (Left) Western blot assay showing exogenous levels of FKBP51, β-Actin was used as loading control. Full length western blots are shown as Supplemental Material. (Right) Graphical representation of cell death values (N = 4) from cultures of Flag-FKBP51 and EV incubated with 3 μM Doxo and/or 20 nM SAFit 1. After a 48 h incubation, cells were harvested and analysed by PI incorporation and flow cytometry. Representative flow cytometry histograms of PI incorporation are shown below. c SAFit improves dacarbazine (DTIC)-induced cell death. SAN melanoma cells were cultured in the presence or absence of 27 μM DTIC and with or without 100 nM SAFit 1 or 100 nM rapamycin. After 48 h incubation cells were harvested and analysed by flow cytometry. The graph shows cell death values obtained from independent experiments (N = 3). Representative flow cytometry histograms of PI incorporation are shown below.

Article Snippet: Bcl-2 (N-19, rabbit polyclonal, Santa Cruz Biotechnology), XIAP (2F1, mouse monoclonal, Stressgen Biotechnologies, BC, Canada), FKBP51 (NB100-68240, Novus Biological), Cyclin D1 (92G2, rabbit polyclonal, Cell Signaling Technology).

Techniques: Cell Culture, Incubation, Cytometry, Western Blot, Control

Fig. 2 SAFits counteract NF-κB/Rel activation. a Electrophoretic mobility shift assay (EMSA) of nuclear extracts obtained from SAN melanoma cells cultured with 3 μM Doxo and/or SAFit1 20 nM or SAFit2 30 nM, for 3 and 5 h. A competition assay with the same cold oligo or an unrelated (NF-AT) oligo suggests the specificity of NF-κB bands. Full gels are shown as Supplemental Material. b Relative normalized expression values of BCL-2 and XIAP mRNA levels in SAN melanoma cells incubated for 24 h in the presence or absence of 20 nM SAFit1 or 30 nM SAFit2. Relative quantitation of the transcript was performed using co-amplified β-Actin as an internal control for normalization. (Lower), Western blot of protein extracted from the same cells for Bcl-2 and XIAP assay. Full gels are shown as Supplemental Material. c BCL-2 and FKBP51 mRNA levels in FKBP51-knocked down A375 melanoma cells (Sh FKBP51 RNA), transfected or not with Flag-FKBP51. (Lower), Western blot of protein extracted from the same cells for Bcl-2, FKBP51 and FLAG-FKBP51 assay. Full gels are shown as Supplemental Material.

Journal: Cell death discovery

Article Title: Exploring the potential of selective FKBP51 inhibitors on melanoma: an investigation of their in vitro and in vivo effects.

doi: 10.1038/s41420-025-02430-y

Figure Lengend Snippet: Fig. 2 SAFits counteract NF-κB/Rel activation. a Electrophoretic mobility shift assay (EMSA) of nuclear extracts obtained from SAN melanoma cells cultured with 3 μM Doxo and/or SAFit1 20 nM or SAFit2 30 nM, for 3 and 5 h. A competition assay with the same cold oligo or an unrelated (NF-AT) oligo suggests the specificity of NF-κB bands. Full gels are shown as Supplemental Material. b Relative normalized expression values of BCL-2 and XIAP mRNA levels in SAN melanoma cells incubated for 24 h in the presence or absence of 20 nM SAFit1 or 30 nM SAFit2. Relative quantitation of the transcript was performed using co-amplified β-Actin as an internal control for normalization. (Lower), Western blot of protein extracted from the same cells for Bcl-2 and XIAP assay. Full gels are shown as Supplemental Material. c BCL-2 and FKBP51 mRNA levels in FKBP51-knocked down A375 melanoma cells (Sh FKBP51 RNA), transfected or not with Flag-FKBP51. (Lower), Western blot of protein extracted from the same cells for Bcl-2, FKBP51 and FLAG-FKBP51 assay. Full gels are shown as Supplemental Material.

Article Snippet: Bcl-2 (N-19, rabbit polyclonal, Santa Cruz Biotechnology), XIAP (2F1, mouse monoclonal, Stressgen Biotechnologies, BC, Canada), FKBP51 (NB100-68240, Novus Biological), Cyclin D1 (92G2, rabbit polyclonal, Cell Signaling Technology).

Techniques: Activation Assay, Electrophoretic Mobility Shift Assay, Cell Culture, Competitive Binding Assay, Expressing, Incubation, Quantitation Assay, Control, Western Blot, Transfection

FKBP51 overexpression dampens insulin signaling in HepG2 cells but does not hinder its effects on glucose metabolism. HepG2 cells were transfected with either a plasmid coding Myc-DDK-tagged human FKBP51 (FKBP51) or an empty pCMV6 plasmid (Control) and were stimulated for 0.5 h with 100 nM insulin. ( A ) Representative blot ( n = 8), ( B ) FKBP51 protein levels, ( C ) Akt phosphorylation, ( D ) P70S6K phosphorylation, ( E ) FOXO1, ( F and G ) Glucose production assay ( n = 4), ( H ) mRNA levels (G6P, PCK1 y PDK4) ( n = 4), ( I ) Representative blot ( n = 3), GSK3β phosphorylation, ( J ) Representative imagens of glycogen synthesis assay and ( K ) Glycogen synthesis ( n = 4). One-way analysis of variance (ANOVA) followed by Tukey post hoc test. * p < 0.05 compared with control and square brackets with FKBP51 with insulin. Data are shown as means ± SEM.

Journal: Scientific Reports

Article Title: FKBP51 disrupts the insulin signaling pathway and impairs mitochondrial bioenergetics in HepG2 cells

doi: 10.1038/s41598-026-40414-9

Figure Lengend Snippet: FKBP51 overexpression dampens insulin signaling in HepG2 cells but does not hinder its effects on glucose metabolism. HepG2 cells were transfected with either a plasmid coding Myc-DDK-tagged human FKBP51 (FKBP51) or an empty pCMV6 plasmid (Control) and were stimulated for 0.5 h with 100 nM insulin. ( A ) Representative blot ( n = 8), ( B ) FKBP51 protein levels, ( C ) Akt phosphorylation, ( D ) P70S6K phosphorylation, ( E ) FOXO1, ( F and G ) Glucose production assay ( n = 4), ( H ) mRNA levels (G6P, PCK1 y PDK4) ( n = 4), ( I ) Representative blot ( n = 3), GSK3β phosphorylation, ( J ) Representative imagens of glycogen synthesis assay and ( K ) Glycogen synthesis ( n = 4). One-way analysis of variance (ANOVA) followed by Tukey post hoc test. * p < 0.05 compared with control and square brackets with FKBP51 with insulin. Data are shown as means ± SEM.

Article Snippet: Cells were transfected with either a plasmid encoding Myc-DDK-tagged human FKBP51 or an empty pCMV6 plasmid (RC210608 and PS100001 , OriGene Technologies, Rockville, MD, USA), using Lipofectamine 2000® (11668019, Thermo Fisher Scientific) in opti-MEM (31985-070, Thermo Fisher Scientific) overnight.

Techniques: Over Expression, Transfection, Plasmid Preparation, Control, Phospho-proteomics

FKBP51 is partially localized in mitochondria in HepG2 cells, but does not alter mitochondrial morphology. HepG2 cells were transfected with either a plasmid coding Myc-DDK-tagged human FKBP51 (FKBP51) or an empty pCMV6 plasmid (Control) and were stimulated for 3 h with 100 nM insulin and 200 nM CCCP for 2 h. ( A ) Representative image of immunofluorescence confocal microscopy, mtHSP70 (red) for mitochondria, FKBP51 (green). Segment lines represent the cellular contours. Scale bar: 24 μm, ( B ) Quantification of mitochondria (mtHSP70)-FKBP51 colocalization using Mander’s coefficient for cell imagens, ( C ) Quantification of FKBP51-mitochondria (mtHSP70) colocalization using Mander’s coefficient for cell imagens ( n = 6), ( D ) Representative blot mitochondria-cytosol subcellular fractionation ( n = 4), ( E ) Representative image of immunofluorescence confocal microscopy MitoTracker Green FM (200 nM for 0.2 h) in live-cells, ( F ) Quantification of average mitochondrial area, ( G ) Quantification of the of mitochondria number per cell in images cells and ( H ) Mean individual mitochondrial volume of HepG2 cells ( n = 5), ( I ) Representative image of Transmission Electron Microscopy, ( J ) Quantification of mitochondrial area, ( K ) Quantification of mitochondrial perimeter, ( L ) Quantification of mitochondrial aspect ratio. One-way analysis of variance (ANOVA) followed by Tukey post hoc test. * p < 0.05 compared with control. Data are shown as means ± SEM.

Journal: Scientific Reports

Article Title: FKBP51 disrupts the insulin signaling pathway and impairs mitochondrial bioenergetics in HepG2 cells

doi: 10.1038/s41598-026-40414-9

Figure Lengend Snippet: FKBP51 is partially localized in mitochondria in HepG2 cells, but does not alter mitochondrial morphology. HepG2 cells were transfected with either a plasmid coding Myc-DDK-tagged human FKBP51 (FKBP51) or an empty pCMV6 plasmid (Control) and were stimulated for 3 h with 100 nM insulin and 200 nM CCCP for 2 h. ( A ) Representative image of immunofluorescence confocal microscopy, mtHSP70 (red) for mitochondria, FKBP51 (green). Segment lines represent the cellular contours. Scale bar: 24 μm, ( B ) Quantification of mitochondria (mtHSP70)-FKBP51 colocalization using Mander’s coefficient for cell imagens, ( C ) Quantification of FKBP51-mitochondria (mtHSP70) colocalization using Mander’s coefficient for cell imagens ( n = 6), ( D ) Representative blot mitochondria-cytosol subcellular fractionation ( n = 4), ( E ) Representative image of immunofluorescence confocal microscopy MitoTracker Green FM (200 nM for 0.2 h) in live-cells, ( F ) Quantification of average mitochondrial area, ( G ) Quantification of the of mitochondria number per cell in images cells and ( H ) Mean individual mitochondrial volume of HepG2 cells ( n = 5), ( I ) Representative image of Transmission Electron Microscopy, ( J ) Quantification of mitochondrial area, ( K ) Quantification of mitochondrial perimeter, ( L ) Quantification of mitochondrial aspect ratio. One-way analysis of variance (ANOVA) followed by Tukey post hoc test. * p < 0.05 compared with control. Data are shown as means ± SEM.

Article Snippet: Cells were transfected with either a plasmid encoding Myc-DDK-tagged human FKBP51 or an empty pCMV6 plasmid (RC210608 and PS100001 , OriGene Technologies, Rockville, MD, USA), using Lipofectamine 2000® (11668019, Thermo Fisher Scientific) in opti-MEM (31985-070, Thermo Fisher Scientific) overnight.

Techniques: Transfection, Plasmid Preparation, Control, Immunofluorescence, Confocal Microscopy, Fractionation, Transmission Assay, Electron Microscopy

FKBP51 overexpression decreases Mitofusin 2 protein levels in HepG2 cells. Cells were transfected with either a plasmid coding Myc-DDK-tagged human FKBP51 (FKBP51) or an empty pCMV6 plasmid (Control) and were stimulated for 3 h with 100 nM insulin, mtHSP70 was used as loading control. ( A ) Representative blot of proteins of mitochondrial dynamics ( n = 10), ( B ) Mitofusin 1 protein levels (MFN1), ( C ) Mitofusin 2 protein levels (MFN2), ( E ) Ratio LOPA/SOPA1, ( D ) Dynamin-related protein 1 (Drp1) phosphorylation, ( F ) Mitochondrial fission protein 1 (Fis1 protein levels), ( G ) Dynamin-related protein 1 (Drp1), protein levels, ( H ) Representative blot of mitochondrial oxidative phosphorylation chain (OXPHOS), ( I ) NADH: ubiquinone oxidoreductase subunit B8 (NDUFB8, complex I) protein level, J Succinate dehydrogenase iron-sulfur subunit (SDHB, complex II), ( K ) Ubiquinol-cytochome c reductase core protein 2 (UQCRC2, complex III), ( L ) Cytochrome c oxidase subuni1 (MTCO1, complex IV) and ( M ) ATP synthase subunit alpha (ATP5A, complex V) ( n = 8). One-way analysis of variance (ANOVA) followed by Tukey post hoc test. * p < 0.05 compared with control. Data are shown as means ± SEM.

Journal: Scientific Reports

Article Title: FKBP51 disrupts the insulin signaling pathway and impairs mitochondrial bioenergetics in HepG2 cells

doi: 10.1038/s41598-026-40414-9

Figure Lengend Snippet: FKBP51 overexpression decreases Mitofusin 2 protein levels in HepG2 cells. Cells were transfected with either a plasmid coding Myc-DDK-tagged human FKBP51 (FKBP51) or an empty pCMV6 plasmid (Control) and were stimulated for 3 h with 100 nM insulin, mtHSP70 was used as loading control. ( A ) Representative blot of proteins of mitochondrial dynamics ( n = 10), ( B ) Mitofusin 1 protein levels (MFN1), ( C ) Mitofusin 2 protein levels (MFN2), ( E ) Ratio LOPA/SOPA1, ( D ) Dynamin-related protein 1 (Drp1) phosphorylation, ( F ) Mitochondrial fission protein 1 (Fis1 protein levels), ( G ) Dynamin-related protein 1 (Drp1), protein levels, ( H ) Representative blot of mitochondrial oxidative phosphorylation chain (OXPHOS), ( I ) NADH: ubiquinone oxidoreductase subunit B8 (NDUFB8, complex I) protein level, J Succinate dehydrogenase iron-sulfur subunit (SDHB, complex II), ( K ) Ubiquinol-cytochome c reductase core protein 2 (UQCRC2, complex III), ( L ) Cytochrome c oxidase subuni1 (MTCO1, complex IV) and ( M ) ATP synthase subunit alpha (ATP5A, complex V) ( n = 8). One-way analysis of variance (ANOVA) followed by Tukey post hoc test. * p < 0.05 compared with control. Data are shown as means ± SEM.

Article Snippet: Cells were transfected with either a plasmid encoding Myc-DDK-tagged human FKBP51 or an empty pCMV6 plasmid (RC210608 and PS100001 , OriGene Technologies, Rockville, MD, USA), using Lipofectamine 2000® (11668019, Thermo Fisher Scientific) in opti-MEM (31985-070, Thermo Fisher Scientific) overnight.

Techniques: Over Expression, Transfection, Plasmid Preparation, Control, Phospho-proteomics

FKBP51 overexpression impairs mitochondrial bioenergetics. HepG2 cells were transfected with either a plasmid coding Myc-DDK-tagged human FKBP51 (FKBP51) or an empty pCMV6 plasmid (Control) and were stimulated for 3 h with 100 nM insulin. ( A ) Oxygen consumption rate (OCR) of cell, measured sequentially for 5 min, (CCCP 100 nM) ( n = 5), ( B ) Representative image of confocal microscopy of HepG2 cells loaded with TMRM then treated with CCCP 100 nM to dissipate the mitochondrial transmembrane potential. ΔB-C (ΔBasal-CCCP) was calculated as the mean fluorescence at 60 s before CCCP addition minus mean fluorescence during the last of the last 60 s of the recording, ( C ) Quantification of Δbasal-CCCP fluorescence ( n = 8), ( D ) Representative image of confocal microscopy MitoSOX 5 µM for 0.2 h with CCCP 200 nM for 1 h positive control, ( E ) Quantification of MitoSOX fluorescence ( n = 6), ( F ) Intracellular ATP levels of cells, ( G ) Graphical representation of the movement of calcium into the mitochondria by the Rhod-2 AM (4 µM for 0.2 h) probe in response to histamine 100 mM, ( H ) Area under the curve (AUC) of Ca 2+ movement to the mitochondria by the Rhod-2 AM probe in response to histamine and Slope the first 10 s in response to histamine by the Rhod-2 probe ( n = 4), ( I ) Graphical representation of the cytosolic Ca 2+ by the Fluo-4 AM (4.4 µM for 0.2 h) probe in response to histamine 100 mM, ( J ) Area under the curve (AUC) of Ca 2+ movement to the mitochondria by the Fluo-4 AM probe in response to histamine and Slope the first 10 s in response to histamine by the Fluo-4 AM probe ( n = 5). ( K ) proposed model. One-way analysis of variance (ANOVA) followed by Tukey post hoc test. * p < 0.05 compared with control and square brackets compared with FKBP51 with insulin. Data are shown as means + SEM.

Journal: Scientific Reports

Article Title: FKBP51 disrupts the insulin signaling pathway and impairs mitochondrial bioenergetics in HepG2 cells

doi: 10.1038/s41598-026-40414-9

Figure Lengend Snippet: FKBP51 overexpression impairs mitochondrial bioenergetics. HepG2 cells were transfected with either a plasmid coding Myc-DDK-tagged human FKBP51 (FKBP51) or an empty pCMV6 plasmid (Control) and were stimulated for 3 h with 100 nM insulin. ( A ) Oxygen consumption rate (OCR) of cell, measured sequentially for 5 min, (CCCP 100 nM) ( n = 5), ( B ) Representative image of confocal microscopy of HepG2 cells loaded with TMRM then treated with CCCP 100 nM to dissipate the mitochondrial transmembrane potential. ΔB-C (ΔBasal-CCCP) was calculated as the mean fluorescence at 60 s before CCCP addition minus mean fluorescence during the last of the last 60 s of the recording, ( C ) Quantification of Δbasal-CCCP fluorescence ( n = 8), ( D ) Representative image of confocal microscopy MitoSOX 5 µM for 0.2 h with CCCP 200 nM for 1 h positive control, ( E ) Quantification of MitoSOX fluorescence ( n = 6), ( F ) Intracellular ATP levels of cells, ( G ) Graphical representation of the movement of calcium into the mitochondria by the Rhod-2 AM (4 µM for 0.2 h) probe in response to histamine 100 mM, ( H ) Area under the curve (AUC) of Ca 2+ movement to the mitochondria by the Rhod-2 AM probe in response to histamine and Slope the first 10 s in response to histamine by the Rhod-2 probe ( n = 4), ( I ) Graphical representation of the cytosolic Ca 2+ by the Fluo-4 AM (4.4 µM for 0.2 h) probe in response to histamine 100 mM, ( J ) Area under the curve (AUC) of Ca 2+ movement to the mitochondria by the Fluo-4 AM probe in response to histamine and Slope the first 10 s in response to histamine by the Fluo-4 AM probe ( n = 5). ( K ) proposed model. One-way analysis of variance (ANOVA) followed by Tukey post hoc test. * p < 0.05 compared with control and square brackets compared with FKBP51 with insulin. Data are shown as means + SEM.

Article Snippet: Cells were transfected with either a plasmid encoding Myc-DDK-tagged human FKBP51 or an empty pCMV6 plasmid (RC210608 and PS100001 , OriGene Technologies, Rockville, MD, USA), using Lipofectamine 2000® (11668019, Thermo Fisher Scientific) in opti-MEM (31985-070, Thermo Fisher Scientific) overnight.

Techniques: Over Expression, Transfection, Plasmid Preparation, Control, Confocal Microscopy, Fluorescence, Positive Control

Demographics, cortisol metrics,  FKBP5  expression and psychosocial measures by sex

Journal: Psychoneuroendocrinology

Article Title: DNA methylation and sex-specific expression of FKBP5 as correlates of one-month bedtime cortisol levels in healthy individuals

doi: 10.1016/j.psyneuen.2018.07.003

Figure Lengend Snippet: Demographics, cortisol metrics, FKBP5 expression and psychosocial measures by sex

Article Snippet: PCR Efficiency/Analytical Sensitivity A plasmid DNA containing the full coding sequence for human FKBP5 was obtained from OriGene (Rockville, MD).

Techniques: Expressing, Methylation

Shown are: A) CpG-3 methylation vs. awakening cortisol for all subjects, B) CpG-1 methylation vs. bedtime cortisol for all subjects, C) FKBP5 expression vs. bedtime cortisol for all subjects, and D) FKBP5 expression vs. bedtime cortisol for females.

Journal: Psychoneuroendocrinology

Article Title: DNA methylation and sex-specific expression of FKBP5 as correlates of one-month bedtime cortisol levels in healthy individuals

doi: 10.1016/j.psyneuen.2018.07.003

Figure Lengend Snippet: Shown are: A) CpG-3 methylation vs. awakening cortisol for all subjects, B) CpG-1 methylation vs. bedtime cortisol for all subjects, C) FKBP5 expression vs. bedtime cortisol for all subjects, and D) FKBP5 expression vs. bedtime cortisol for females.

Article Snippet: PCR Efficiency/Analytical Sensitivity A plasmid DNA containing the full coding sequence for human FKBP5 was obtained from OriGene (Rockville, MD).

Techniques: Methylation, Expressing

Correlation between  FKBP5  methylation (males and females) and expression (females only) vs. mean weekly awakening and bedtime cortisol.

Journal: Psychoneuroendocrinology

Article Title: DNA methylation and sex-specific expression of FKBP5 as correlates of one-month bedtime cortisol levels in healthy individuals

doi: 10.1016/j.psyneuen.2018.07.003

Figure Lengend Snippet: Correlation between FKBP5 methylation (males and females) and expression (females only) vs. mean weekly awakening and bedtime cortisol.

Article Snippet: PCR Efficiency/Analytical Sensitivity A plasmid DNA containing the full coding sequence for human FKBP5 was obtained from OriGene (Rockville, MD).

Techniques: Methylation, Expressing

Correlation between  FKBP5  expression and mean cortisol metrics, by sex

Journal: Psychoneuroendocrinology

Article Title: DNA methylation and sex-specific expression of FKBP5 as correlates of one-month bedtime cortisol levels in healthy individuals

doi: 10.1016/j.psyneuen.2018.07.003

Figure Lengend Snippet: Correlation between FKBP5 expression and mean cortisol metrics, by sex

Article Snippet: PCR Efficiency/Analytical Sensitivity A plasmid DNA containing the full coding sequence for human FKBP5 was obtained from OriGene (Rockville, MD).

Techniques: Expressing

Fig. 7. FKBP12 and FKBP51 protein expressions in Tacrolimus-, Sirolimus- and Everolimus-treated HepG2 (A and B, respectively) and Huh7 (C and D, respectively) cells. Treatments were administered at different concentrations (0, 10 nM, 10 µM, and 100 µM). The protein expression of FKBP12 and FKBP51 was evaluated by Western‐blot analysis as described in Material and Methods. Results are expressed as mean ± SEM, and blots are representative of four to six independent experiments. *p ≤ 0.05 between control and immunosuppressant‐treated cells. The groups with different letters (a, b, c or d) were significantly different (p ≤ 0.05).

Journal: Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology

Article Title: Molecular Pathways Leading to Induction of Cell Death and Anti-Proliferative Properties by Tacrolimus and mTOR Inhibitors in Liver Cancer Cells.

doi: 10.33594/000000230

Figure Lengend Snippet: Fig. 7. FKBP12 and FKBP51 protein expressions in Tacrolimus-, Sirolimus- and Everolimus-treated HepG2 (A and B, respectively) and Huh7 (C and D, respectively) cells. Treatments were administered at different concentrations (0, 10 nM, 10 µM, and 100 µM). The protein expression of FKBP12 and FKBP51 was evaluated by Western‐blot analysis as described in Material and Methods. Results are expressed as mean ± SEM, and blots are representative of four to six independent experiments. *p ≤ 0.05 between control and immunosuppressant‐treated cells. The groups with different letters (a, b, c or d) were significantly different (p ≤ 0.05).

Article Snippet: KG Navarro-Villarán et al.: Role of Immunosuppressant and FK506-Binding Protein Complex in Liver Cancer and Ser15P-p53 (#9284) obtained from Cell Signaling Technology (Danvers, Massachusetts, USA); LC3 (PM036) purchased from MBL International (Woburn, Massachusetts, USA); GADD153 (C/EBP homologous protein or CHOP) (sc-575), Beclin (sc-48341), p21 (sc-397) and p53 (sc-6243) obtained from Santa Cruz Biotechnology (Dallas, Texas, USA); Thr172P-Cdk4 (PA5-64482) obtained from ThermoFisher (Waltham, Massachusetts, USA); FKBP12 (Ref NB300-508) and FKBP38 (Ref NBP1-77909) obtained from Novus Biologicals (Centennial, Colorado, USA); and FKBP51 (Ref MAB4094) and FKBP52 (Ref MAB4095) obtained from R&D Systems (Minneapolis, Minnesota, USA).

Techniques: Expressing, Western Blot, Control

Fig. 9. Impact of FKBP51 downregulation on BrdU incorporation (A) and caspase-3 activity (B) in Tacrolimus-, Sirolimus- and Everolimus-treated HepG2 cells. The downregulation of FKBP51 was carried using siRNA technologies. Cell proliferation and apoptosis were determined using commercial BrdU incorporation and caspase‐3 activity assays respectively as described in Material and Methods. Results are expressed as mean ± SEM of six independent experiments. *p ≤ 0.05 and **p ≤ 0.01 between control and immunosuppressant‐ treated cells. The groups with different letters (a, b, c, d, e or f) were significantly different (p ≤ 0.05).

Journal: Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology

Article Title: Molecular Pathways Leading to Induction of Cell Death and Anti-Proliferative Properties by Tacrolimus and mTOR Inhibitors in Liver Cancer Cells.

doi: 10.33594/000000230

Figure Lengend Snippet: Fig. 9. Impact of FKBP51 downregulation on BrdU incorporation (A) and caspase-3 activity (B) in Tacrolimus-, Sirolimus- and Everolimus-treated HepG2 cells. The downregulation of FKBP51 was carried using siRNA technologies. Cell proliferation and apoptosis were determined using commercial BrdU incorporation and caspase‐3 activity assays respectively as described in Material and Methods. Results are expressed as mean ± SEM of six independent experiments. *p ≤ 0.05 and **p ≤ 0.01 between control and immunosuppressant‐ treated cells. The groups with different letters (a, b, c, d, e or f) were significantly different (p ≤ 0.05).

Article Snippet: KG Navarro-Villarán et al.: Role of Immunosuppressant and FK506-Binding Protein Complex in Liver Cancer and Ser15P-p53 (#9284) obtained from Cell Signaling Technology (Danvers, Massachusetts, USA); LC3 (PM036) purchased from MBL International (Woburn, Massachusetts, USA); GADD153 (C/EBP homologous protein or CHOP) (sc-575), Beclin (sc-48341), p21 (sc-397) and p53 (sc-6243) obtained from Santa Cruz Biotechnology (Dallas, Texas, USA); Thr172P-Cdk4 (PA5-64482) obtained from ThermoFisher (Waltham, Massachusetts, USA); FKBP12 (Ref NB300-508) and FKBP38 (Ref NBP1-77909) obtained from Novus Biologicals (Centennial, Colorado, USA); and FKBP51 (Ref MAB4094) and FKBP52 (Ref MAB4095) obtained from R&D Systems (Minneapolis, Minnesota, USA).

Techniques: BrdU Incorporation Assay, Activity Assay, Control

Figure 7 AR signaling modulates 11BHSD1 and contributes to GR-regulated transcriptional activity in WAT but not liver. (A, B, C and D) Hsd11b1 mRNA and 11BHSD1 protein expression in WAT and liver upon glucocorticoid and androgen interventions. (E and F) The relationship between CORT levels and the expression of GR-responsive genes Fkbp5, Gilz and Mt2a in WAT and liver. Data are mean ± s.e.m. and N = 6–7 per group. Statistical significance was calculated using a one-way ANOVA with the Tukey multiple-comparisons test. *P < 0.05 vs Vehicle, **P < 0.01 vs Vehicle, $P < 0.05 vs CORT, $$P < 0.01 vs CORT. Representative Western images are shown and quantification of protein expression is based on 6 per group. GAPDH loading controls in Fig. 7D are identical to the ones shown in Fig. 3K.

Journal: Journal of Endocrinology

Article Title: Androgens modulate glucocorticoid receptor activity in adipose tissue and liver

doi: 10.1530/joe-18-0503

Figure Lengend Snippet: Figure 7 AR signaling modulates 11BHSD1 and contributes to GR-regulated transcriptional activity in WAT but not liver. (A, B, C and D) Hsd11b1 mRNA and 11BHSD1 protein expression in WAT and liver upon glucocorticoid and androgen interventions. (E and F) The relationship between CORT levels and the expression of GR-responsive genes Fkbp5, Gilz and Mt2a in WAT and liver. Data are mean ± s.e.m. and N = 6–7 per group. Statistical significance was calculated using a one-way ANOVA with the Tukey multiple-comparisons test. *P < 0.05 vs Vehicle, **P < 0.01 vs Vehicle, $P < 0.05 vs CORT, $$P < 0.01 vs CORT. Representative Western images are shown and quantification of protein expression is based on 6 per group. GAPDH loading controls in Fig. 7D are identical to the ones shown in Fig. 3K.

Article Snippet: The following primary and secondary antibodies were used: 11BHSD1 (in house antibody University of Edinburgh, 1:10), FKBP5 (AB_2103136, R&D systems, AF4094, 1:70), GAPDH (AB_10167668, Santa Cruz Biotechnology, sc25778, 1:50), GR (AB_2631286, Cell Signaling, 12401, 1:10), HPR anti-goat (ProteinSimple, DM006), HRP antirabbit (ProteinSimple, DM001) and HRP anti-sheep (AB_955452, Abcam, ab6900, 1:100).

Techniques: Activity Assay, Expressing, Western Blot