Journal: Biological & pharmaceutical bulletin

Article Title: Pharmacokinetics and brain distribution of tetrahydropalmatine and tetrahydroberberine after oral administration of DA-9701, a new botanical gastroprokinetic agent, in rats.

doi: 10.1248/bpb.b14-00678

Figure Lengend Snippet: Fig. 1. Chemical Structures of Tetrahydropalmatine (THP; A) and Tetrahydroberberine (THB; B)

Article Snippet: THP (purity 99.1%) and THB (purity 97.2%) were obtained from ChromaDex (Irvine, CA, U.S.A.).

Techniques:

Journal: Biological & pharmaceutical bulletin

Article Title: Pharmacokinetics and brain distribution of tetrahydropalmatine and tetrahydroberberine after oral administration of DA-9701, a new botanical gastroprokinetic agent, in rats.

doi: 10.1248/bpb.b14-00678

Figure Lengend Snippet: Fig. 4. Mean Plasma and Brain Concentration–Time Profiles of THP (A) and THB (B), and Their Brain-to-Plasma Concentration (Br/P) Ratios (C) Following Single Oral Administration of 328 mg/kg DA-9701 (Equivalent to 1.5 mg/kg THP and 0.39 mg/kg THB; n=3 at Each Time Point)

Article Snippet: THP (purity 99.1%) and THB (purity 97.2%) were obtained from ChromaDex (Irvine, CA, U.S.A.).

Techniques: Clinical Proteomics, Concentration Assay

Journal: Biological & pharmaceutical bulletin

Article Title: Pharmacokinetics and brain distribution of tetrahydropalmatine and tetrahydroberberine after oral administration of DA-9701, a new botanical gastroprokinetic agent, in rats.

doi: 10.1248/bpb.b14-00678

Figure Lengend Snippet: Fig. 5. Mean Plasma and Brain Concentration–Time Profiles of THP (A) and THB (B), and Their Brain-to-Plasma Concentration (Br/P) Ratios (C) Following Multiple Oral Administration of DA-9701 (150 mg/kg/d of DA-9701 for 7 d; Equivalent to 0.77 mg/kg/d as THP and 0.21 mg/kg/d as THB; n=4 at Each Time Point)

Article Snippet: THP (purity 99.1%) and THB (purity 97.2%) were obtained from ChromaDex (Irvine, CA, U.S.A.).

Techniques: Clinical Proteomics, Concentration Assay

Journal: Current biology : CB

Article Title: Regulation of glucose-dependent Golgi-derived microtubules by cAMP/EPAC2 promotes secretory vesicle biogenesis in pancreatic β-cells

doi: 10.1016/j.cub.2019.06.032

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-EB1 BD Transduction Cat#: 610535 Rat anti-EB3 Absea Cat#: 010314H04 Rabbit anti-Giantin Abcam Cat#: ab24586 Mouse anti-GM130 BD Transduction Cat#:610823 Rabbit EPAC1 Abcam Cat#: ab124162 Rabbit EPAC2 Abcam Cat#: ab124189 Mouse GAPDH Santa Cruz Cat#: sc-32233 Mouse anti-E cadherin BD Transduction Cat#: 610181 Guinea Pig anti-GCC185 [ 44 ] N/A Guinea Pig anti-Insulin Agilent Technologies Cat#: A0564 Rabbit anti-β-tubulin Abcam Cat#: ab18251 Anti-GFP FITC Abcam Cat#: ab6662 Chemicals Vectashield Mounting Medium Vector Labs Cat#: H-1000 Nocodazole Sigma-Aldrich Cat#: M1404 Verapamil hydrochloride MP Biomedicals Cat#: 0219554501 MPA Sigma-Aldrich Cat#: M5255 GKA50 Sigma-Aldrich Cat#: SML0849 Diazoxide Tocris Bioscience Cat#: 0934 Metformin Sigma-Aldrich Cat#: PHR1084 Sodium Pyruvate ThermoFisher Cat#: 11360070 KCl EM Science Cat#: PX1405-1 8-br-cAMP Sigma-Aldrich Cat#: B7880 8-br-cAMP-AM Biolog Cat#: B 020 Ionomycin Sigma-Aldrich Cat#: I3909 PKI Sigma-Aldrich Cat#: P9115 Forskolin Sigma-Aldrich Cat#: F6886 8-pCPT-2O-Me-cAMP Sigma-Aldrich Cat#: C8988 HJC0197 Cayman Chemical Cat#: 19092 ESI-09 Sigma-Aldrich Cat#: SML0814 BAPTA-AM Invitrogen Cat#: B1205 D (+)-glucose Acros Cat# 41095-0010 NaHCO 3 HyClone Cat# SH30173.04 EGTA Sigma-Aldrich Cat# E3889 NaCl Sigma-Aldrich Cat# S9625 MgSO 4 Sigma-Aldrich Cat# M7506 KH 2 PO 4 ThermoFisher Cat# BP363 HEPES Sigma-Aldrich Cat# H4034 CaCl 2 Sigma-Aldrich Cat# C1016 BSA ThermoFisher Cat# BP1605 Critical Commercial Assays Mouse Ultrasensitive Insulin ELISA Alpco 80-INSMSU-E10 Experimental Models: Cell Lines MIN6 cells [ 52 ] N/A hTERT RPE-1 cells ATCC Cat#: CRL-4000 Experimental Models: Organisms/Strains CD-1 (ICR) Mice Charles River Inc. Stain code:022 Oligonucleotides Cdk5Rap2 51-100 Fwd Sigma-Aldrich GGCTCGAGGCCGCGAATTCCACAGT Cdk5Rap2 51-100 Rev Sigma-Aldrich GGATGCCACCCCGGGATCCTC shRNA EPAC2 Mouse shRNA #1 Origene TL509420A CGACAAGGAAGACTTCAATCGGATTCTGA EPAC2 Mouse shRNA #2 Origene TL50942C CCATTACCACGCACAGCCTTCTCAAGGTA Recombinant DNA pCMV Cdk5Rap2 51-100 F75A [ 42 ] N/A pCIG McMahon Plasmid Database 2165 Emerald-EB3 Addgene Plasmid# 54076 TGN-RFP [ 53 ] N/A Dominant negative AKAP450 [ 41 ] N/A Software and Algorithms Graphpad Prism Graphpad https://www.graphpad.com Image J Image J https://imagej.nih.gov/ij/ Adobe illustrator/photoshop Adobe http://www.adobe.com Imaris Bitplane http://www.bitplane.com Open in a separate window KEY RESOURCES TABLE Glucose triggers GDMT nucleation in β-cells, which mirrors biphasic insulin release Glucose-dependent GDMT nucleation is regulated by EPAC2 downstream of cAMP GDMTs are necessary for insulin granule biogenesis at the TGN Glucose-dependent GDMT nucleation maintains the secretion/storage insulin balance

Techniques: Transduction, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Staining, shRNA, Recombinant, Dominant Negative Mutation, Software