Review





Similar Products

99
Thermo Fisher whole genome dna microarrays
Whole Genome Dna Microarrays, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/whole-genome+dna+microarray/DNA/pmc11288355-127-22-28
Average 99 stars, based on 1 article reviews
whole genome dna microarrays - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier

90
Dawley Inc whole-genome dna microarray expression data
Whole Genome Dna Microarray Expression Data, supplied by Dawley Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/whole-genome+dna+microarray/whole+genome+dna+microarray+expression+data/10__37897_slash_rjphp__2024__1___2__3-111-3-14
Average 90 stars, based on 1 article reviews
whole-genome dna microarray expression data - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Agilent technologies whole human genome dna microarray 4× 44k v2 slides
Points in time for sublingual vaccinations and assessments of anti-HA (hemagglutinin) antibodies, blood tests, plasma cytokines, quantitative reverse transcription PCR (RT-qPCR), and DNA <t>microarray</t> analyses. RT-qPCR and DNA microarray analyses were conducted with RNA isolated from white blood cells (WBC). Vaccinations were performed four times at 0 (1st), 6 (2nd), 18 (3rd), and 30 (4th) weeks. Arrows indicate sampling timepoints for each assay.
Whole Human Genome Dna Microarray 4× 44k V2 Slides, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/whole-genome+dna+microarray/pmc11209156-124-22-31
Average 90 stars, based on 1 article reviews
whole human genome dna microarray 4× 44k v2 slides - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Agilent technologies dna microarray slides (44k whole human genome
Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
Dna Microarray Slides (44k Whole Human Genome, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/whole-genome+dna+microarray/pmc11106736-200-7-15
Average 90 stars, based on 1 article reviews
dna microarray slides (44k whole human genome - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Agilent technologies dna-microarray 44k whole human genome
Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
Dna Microarray 44k Whole Human Genome, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/whole-genome+dna+microarray/pmc11106736-173-199-205
Average 90 stars, based on 1 article reviews
dna-microarray 44k whole human genome - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Agilent technologies whole human genome dna microarray 4 × 44 k
Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
Whole Human Genome Dna Microarray 4 × 44 K, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/whole-genome+dna+microarray/pmc11079073-204-7-15
Average 90 stars, based on 1 article reviews
whole human genome dna microarray 4 × 44 k - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Agilent technologies 4x44k whole genome oligo dna microarray chip
Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
4x44k Whole Genome Oligo Dna Microarray Chip, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/whole-genome+dna+microarray/pm38278317-40-10-19
Average 90 stars, based on 1 article reviews
4x44k whole genome oligo dna microarray chip - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Agilent technologies whole mouse genome dna microarray 4 × 44k ver.2.0 (g4846a)
Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
Whole Mouse Genome Dna Microarray 4 × 44k Ver.2.0 (G4846a), supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/whole-genome+dna+microarray/pm37625588-191-0-10
Average 90 stars, based on 1 article reviews
whole mouse genome dna microarray 4 × 44k ver.2.0 (g4846a) - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Agilent technologies whole mouse genome dna microarray 4 × 44k ver.2.0
Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
Whole Mouse Genome Dna Microarray 4 × 44k Ver.2.0, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/whole-genome+dna+microarray/pmc10518718-259-0-10
Average 90 stars, based on 1 article reviews
whole mouse genome dna microarray 4 × 44k ver.2.0 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results


Points in time for sublingual vaccinations and assessments of anti-HA (hemagglutinin) antibodies, blood tests, plasma cytokines, quantitative reverse transcription PCR (RT-qPCR), and DNA microarray analyses. RT-qPCR and DNA microarray analyses were conducted with RNA isolated from white blood cells (WBC). Vaccinations were performed four times at 0 (1st), 6 (2nd), 18 (3rd), and 30 (4th) weeks. Arrows indicate sampling timepoints for each assay.

Journal: Vaccines

Article Title: Molecular Events in Immune Responses to Sublingual Influenza Vaccine with Hemagglutinin Antigen and Poly(I:C) Adjuvant in Nonhuman Primates, Cynomolgus Macaques

doi: 10.3390/vaccines12060643

Figure Lengend Snippet: Points in time for sublingual vaccinations and assessments of anti-HA (hemagglutinin) antibodies, blood tests, plasma cytokines, quantitative reverse transcription PCR (RT-qPCR), and DNA microarray analyses. RT-qPCR and DNA microarray analyses were conducted with RNA isolated from white blood cells (WBC). Vaccinations were performed four times at 0 (1st), 6 (2nd), 18 (3rd), and 30 (4th) weeks. Arrows indicate sampling timepoints for each assay.

Article Snippet: The labeled cRNA was subsequently fragmented using the Gene Expression Hybridization Kit (Agilent Technologies, Santa Clara, CA, USA) and then set onto Whole Human Genome DNA Microarray 4× 44K v2 slides (Agilent Technologies, Santa Clara, CA, USA).

Techniques: Reverse Transcription, Quantitative RT-PCR, Microarray, Isolation, Sampling

Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

Article Snippet: Labeled cRNA samples were applied on the DNA microarray slides (44k whole human genome, G4112F, Agilent).

Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Lysis, Concentration Assay, Sequencing, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction

Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop ™ qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Lysis, Concentration Assay, Sequencing, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction