Review





Similar Products

spike in template f  (Sangon Biotech)
86
Sangon Biotech spike in template f
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Spike In Template F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/spike in template f/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
spike in template f - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
spike in template r  (Sangon Biotech)
86
Sangon Biotech spike in template r
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Spike In Template R, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/spike in template r/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
spike in template r - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
smrtbell express template prep kit 3 0  (Pacific Biosciences)
86
Pacific Biosciences smrtbell express template prep kit 3 0
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Smrtbell Express Template Prep Kit 3 0, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/smrtbell express template prep kit 3 0/product/Pacific Biosciences
Average 86 stars, based on 1 article reviews
smrtbell express template prep kit 3 0 - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
smrtbell templates  (Pacific Biosciences)
86
Pacific Biosciences smrtbell templates
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Smrtbell Templates, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/smrtbell templates/product/Pacific Biosciences
Average 86 stars, based on 1 article reviews
smrtbell templates - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
smrtbell express template prep kit 2 0  (Pacific Biosciences)
86
Pacific Biosciences smrtbell express template prep kit 2 0
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Smrtbell Express Template Prep Kit 2 0, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/smrtbell express template prep kit 2 0/product/Pacific Biosciences
Average 86 stars, based on 1 article reviews
smrtbell express template prep kit 2 0 - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
pacbio dna template prep kit  (Pacific Biosciences)
86
Pacific Biosciences pacbio dna template prep kit
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Pacbio Dna Template Prep Kit, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pacbio dna template prep kit/product/Pacific Biosciences
Average 86 stars, based on 1 article reviews
pacbio dna template prep kit - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
template plasmid pb210pa 1  (System Biosciences Inc)
86
System Biosciences Inc template plasmid pb210pa 1
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Template Plasmid Pb210pa 1, supplied by System Biosciences Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/template plasmid pb210pa 1/product/System Biosciences Inc
Average 86 stars, based on 1 article reviews
template plasmid pb210pa 1 - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

Image Search Results


Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Journal: STAR Protocols

Article Title: Protocol to produce and apply barcoded rabies virus for single-neuron input mapping in mice

doi: 10.1016/j.xpro.2026.104537

Figure Lengend Snippet: Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Article Snippet: Spike-In template F , TAATACGACTCACTATAGGGAGTGAC AATGAAACCTACGTAGTGCAAAGAGA AGTGGCAGTTGCCAAATACAGCAACC TTGGTGGTGGCATGGACGAGCTGTAC AAGTAAGGTACCGGCCAT , Sangon Biotech.

Techniques: Amplification, Purification, Control, In Vitro, Reverse Transcription

Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Journal: STAR Protocols

Article Title: Protocol to produce and apply barcoded rabies virus for single-neuron input mapping in mice

doi: 10.1016/j.xpro.2026.104537

Figure Lengend Snippet: Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Article Snippet: Spike-In template R , TTTTTTTCTCGACTGAAATGCTTAGAT GACCCAGCCCTCAATAGGGCCGCCT CGGCCNNNTGNNNACNNNATNNNG CNNNTGNNNACNNNGGCCGTAATG GCCGGTACCTTA , Sangon Biotech.

Techniques: Amplification, Purification, Control, In Vitro, Reverse Transcription