|
Sangon Biotech
target sequences shnc Target Sequences Shnc, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequences+shnc/shnc/pm42107206-51-2-19 Average 86 stars, based on 1 article reviews
target sequences shnc - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Tree Star Inc
gpt oligonucleotides shnc targeting sequence Gpt Oligonucleotides Shnc Targeting Sequence, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequences+shnc/gpt+oligonucleotides+sequence+shnc+targeting/pm40780215-263-221-255 Average 86 stars, based on 1 article reviews
gpt oligonucleotides shnc targeting sequence - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Shanghai Genechem Ltd
lentiviral plasmid containing non-target control sequence (shnc) Lentiviral Plasmid Containing Non Target Control Sequence (Shnc), supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequences+shnc/lentiviral+plasmid+containing+non+target+control+sequence++shnc+/pmc11740035-103-1-26 Average 90 stars, based on 1 article reviews
lentiviral plasmid containing non-target control sequence (shnc) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
corresponding non-targeting sequences (shnc) Corresponding Non Targeting Sequences (Shnc), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequences+shnc/corresponding+non+targeting+sequences++shnc+/pm37708708-71-20-29 Average 90 stars, based on 1 article reviews
corresponding non-targeting sequences (shnc) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
sequences targeting prncr1 and shnc Sequences Targeting Prncr1 And Shnc, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequences+shnc/si+dgcr5/pm33647908-61-6-10 Average 90 stars, based on 1 article reviews
sequences targeting prncr1 and shnc - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Genechem
lentiviral plasmids containing shrna sequences targeting cenpk and yap1 (shcenpk and shyap1) or negative control (shnc) Lentiviral Plasmids Containing Shrna Sequences Targeting Cenpk And Yap1 (Shcenpk And Shyap1) Or Negative Control (Shnc), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequences+shnc/lentivirus+carrying+yap+gene/10__2147_slash_ott__s190061-38-12-25 Average 90 stars, based on 1 article reviews
lentiviral plasmids containing shrna sequences targeting cenpk and yap1 (shcenpk and shyap1) or negative control (shnc) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
pgpu6/gfp/neo-shnc (target sequence, gttctccgaacgtgtcacgt) Pgpu6/Gfp/Neo Shnc (Target Sequence, Gttctccgaacgtgtcacgt), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequences+shnc/u6+gfp+neo+plasmid/pmc06019939-155-0-16 Average 90 stars, based on 1 article reviews
pgpu6/gfp/neo-shnc (target sequence, gttctccgaacgtgtcacgt) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |