Review





Similar Products

plko 1 shrictor plasmids  (Addgene inc)
96
Addgene inc plko 1 shrictor plasmids
Plko 1 Shrictor Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 shrictor plasmids/product/Addgene inc
Average 96 stars, based on 1 article reviews
plko 1 shrictor plasmids - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier
shrictor  (Addgene inc)
93
Addgene inc shrictor
Shrictor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrictor/product/Addgene inc
Average 93 stars, based on 1 article reviews
shrictor - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier
plko shrictor #1853  (Addgene inc)
90
Addgene inc plko shrictor #1853
Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
Plko Shrictor #1853, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko shrictor #1853/product/Addgene inc
Average 90 stars, based on 1 article reviews
plko shrictor #1853 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
plko 1 shrictor  (Addgene inc)
93
Addgene inc plko 1 shrictor
Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
Plko 1 Shrictor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 shrictor/product/Addgene inc
Average 93 stars, based on 1 article reviews
plko 1 shrictor - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier
lentiviral plko 1 shrictor  (Addgene inc)
93
Addgene inc lentiviral plko 1 shrictor
Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
Lentiviral Plko 1 Shrictor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral plko 1 shrictor/product/Addgene inc
Average 93 stars, based on 1 article reviews
lentiviral plko 1 shrictor - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier
shrictor plasmids  (Addgene inc)
90
Addgene inc shrictor plasmids
Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
Shrictor Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrictor plasmids/product/Addgene inc
Average 90 stars, based on 1 article reviews
shrictor plasmids - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
pzip-mcmv-zsgreen-shrictor  (Transomic Technologies Inc)
90
Transomic Technologies Inc pzip-mcmv-zsgreen-shrictor
Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
Pzip Mcmv Zsgreen Shrictor, supplied by Transomic Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pzip-mcmv-zsgreen-shrictor/product/Transomic Technologies Inc
Average 90 stars, based on 1 article reviews
pzip-mcmv-zsgreen-shrictor - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
shrna expression vectors against human rictor (shrictor 1 shrictor 2  (Addgene inc)
90
Addgene inc shrna expression vectors against human rictor (shrictor 1 shrictor 2
Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
Shrna Expression Vectors Against Human Rictor (Shrictor 1 Shrictor 2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna expression vectors against human rictor (shrictor 1 shrictor 2/product/Addgene inc
Average 90 stars, based on 1 article reviews
shrna expression vectors against human rictor (shrictor 1 shrictor 2 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
shrictor vectors  (Addgene inc)
90
Addgene inc shrictor vectors
Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
Shrictor Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrictor vectors/product/Addgene inc
Average 90 stars, based on 1 article reviews
shrictor vectors - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls

Journal: Cell & Bioscience

Article Title: NUAK1 coordinates growth factor-dependent activation of mTORC2 and Akt signaling

doi: 10.1186/s13578-023-01185-2

Figure Lengend Snippet: Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls

Article Snippet: To generate pCW57 FLAG-hNUAK1 WT, hNUAK1 WT was amplified from pCMV FLAG-hNUAK1 and subcloned into pCW57-MCS1-2 A-MCS2 using NheI and AgeI restriction sites. pCMV FLAG-hNUAK1 K84A was generated by subcloning of FLAG-hNUAK1 K84A from pBABE FLAG-hNUAK1 K84A using EcoRI restriction sites. pBABE FLAG-hNUAK1 K84A was previously generated by site direct mutagenesis using the following primers: hNUAK1_K84A_F: GGCCGAGTGGTTGCTATAGCCTCCATTCGTAAGG, hNUAK1_K84A_R: CCTTACGAATGGAGGCTATAGCAACCACTCGGCC. pCMV FLAG-NUAK1 K84A mutation was confirmed by sequencing (Additional file : Fig. S6). pCW57-MCS1-2 A-MCS2 (#71782), FLAG FOXO3a (#8360), pCMV dR8.2 (#8360), pCMV VSVG (#8454), pLKO scramble (#1864), pLKO shRictor (#1853), Lamp1-YFP (#2532), Lamp1-RFP (#1817), EGFR-GFP (#32751), pRK5 Myc Rictor (#11367), pRK5 Myc Raptor (#1859), and mRFP-Rab5 (#14437) from Addgene. pCMV6 Myr-Akt1-HA was kindly provided by Dr. Philip Tsichlis, The Ohio State University, Rab7-GFP by Dr. Julio Tapia, Universidad de Chile, Chile, and pINDUCER10 shNUAK1 #1 and shNUAK1 #2 by Drs. Giacomo Cossa and Martin Eilers, University of Würzburg, Germany.

Techniques: Inhibition, Phospho-proteomics