Review



virus strains shcontrol addgene  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc virus strains shcontrol addgene
    Virus Strains Shcontrol Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1156 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shcontrol/scramble+shRNA+(Plasmid+%231864)/pm42776838-284-232-235
    Average 96 stars, based on 1156 article reviews
    virus strains shcontrol addgene - by Bioz Stars, 2026-11
    96/100 stars

    Images

    Related Articles

    shRNA:

    Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells
    Article Snippet: shHSPD1 with the following oligonucleotide sequence: 5'-GCTAAACTTGTTCAAGATGTTTCAAGAGAACATCTTGAACAAGTTTAGCTTTTTT-3' was cloned into the pLKO.1-puro plasmid (a gift from Dr Bob Weinberg, Whitehead Institute for Biomedical Research and Department of Biology, Massachusetts Institute of Technology, MA, USA; Addgene plasmid no. 8453). .. The scrambled shRNA (shControl) with the oligonucleotide sequence: 5'-CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG-3' inserted into the pLKO.1-puro plasmid (a gift from Dr David Sabatini, Whitehead Institute for Biomedical Research and Department of Biology, Massachusetts Institute of Technology, MA, USA; Addgene plasmid no. 1864) served as a negative control. .. Using a third-generation lentivirus system, lentiviral particles were produced by co-transfecting 293T cells (CRL-3216; ATCC) with either pLKO.1-puro-shHSPD1 (6 μg) or pLKO.1-puro-shControl (6 μg), along with packaging plasmids, including pMDLg/pRRE (a gift from Dr Didier Trono, Department of Genetics and Microbiology, Faculty of Medicine, University of Geneva, Switzerland; Addgene plasmid no. 12251), pRSV-Rev (a gift from Dr Didier Trono, Addgene no. 12253), and pCMV-VSV-G (a gift from Dr Bob Weinberg, Addgene plasmid no. 8454) using jetPRIME transfection reagent (Polyplus) for 12 h at 37 ̊C.

    Article Title: Downregulation of ankyrin 3 (ANK3) promotes malignant behaviors associated with altered adhesion dynamics and actin cytoskeleton remodeling in renal cell carcinoma.
    Article Snippet: Clear cell renal cell carcinoma (ccRCC) is the most common type of kidney cancer, with existing therapies largely ineffective for advanced stages.. Ankyrin 3 (ANK3), a protein involved in various cellular processes, has been associated with poor prognosis and immune infiltration in ccRCC.. However, its role in ccRCC development and progression remains poorly understood.

    Article Title: CXCR4/CXCL12 axis promotes lymphatic metastasis in tongue squamous cell carcinoma via PI3K/AKT signaling pathway
    Article Snippet: .. Lentiviral vectors expressing CXCR4 shRNA (shCXCR4) or non-targeting control shRNA (shControl) were constructed by cloning the target sequences into the pLKO.1 vector (Addgene, Cat10878). ..

    Sequencing:

    Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells
    Article Snippet: shHSPD1 with the following oligonucleotide sequence: 5'-GCTAAACTTGTTCAAGATGTTTCAAGAGAACATCTTGAACAAGTTTAGCTTTTTT-3' was cloned into the pLKO.1-puro plasmid (a gift from Dr Bob Weinberg, Whitehead Institute for Biomedical Research and Department of Biology, Massachusetts Institute of Technology, MA, USA; Addgene plasmid no. 8453). .. The scrambled shRNA (shControl) with the oligonucleotide sequence: 5'-CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG-3' inserted into the pLKO.1-puro plasmid (a gift from Dr David Sabatini, Whitehead Institute for Biomedical Research and Department of Biology, Massachusetts Institute of Technology, MA, USA; Addgene plasmid no. 1864) served as a negative control. .. Using a third-generation lentivirus system, lentiviral particles were produced by co-transfecting 293T cells (CRL-3216; ATCC) with either pLKO.1-puro-shHSPD1 (6 μg) or pLKO.1-puro-shControl (6 μg), along with packaging plasmids, including pMDLg/pRRE (a gift from Dr Didier Trono, Department of Genetics and Microbiology, Faculty of Medicine, University of Geneva, Switzerland; Addgene plasmid no. 12251), pRSV-Rev (a gift from Dr Didier Trono, Addgene no. 12253), and pCMV-VSV-G (a gift from Dr Bob Weinberg, Addgene plasmid no. 8454) using jetPRIME transfection reagent (Polyplus) for 12 h at 37 ̊C.

    Plasmid Preparation:

    Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells
    Article Snippet: shHSPD1 with the following oligonucleotide sequence: 5'-GCTAAACTTGTTCAAGATGTTTCAAGAGAACATCTTGAACAAGTTTAGCTTTTTT-3' was cloned into the pLKO.1-puro plasmid (a gift from Dr Bob Weinberg, Whitehead Institute for Biomedical Research and Department of Biology, Massachusetts Institute of Technology, MA, USA; Addgene plasmid no. 8453). .. The scrambled shRNA (shControl) with the oligonucleotide sequence: 5'-CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG-3' inserted into the pLKO.1-puro plasmid (a gift from Dr David Sabatini, Whitehead Institute for Biomedical Research and Department of Biology, Massachusetts Institute of Technology, MA, USA; Addgene plasmid no. 1864) served as a negative control. .. Using a third-generation lentivirus system, lentiviral particles were produced by co-transfecting 293T cells (CRL-3216; ATCC) with either pLKO.1-puro-shHSPD1 (6 μg) or pLKO.1-puro-shControl (6 μg), along with packaging plasmids, including pMDLg/pRRE (a gift from Dr Didier Trono, Department of Genetics and Microbiology, Faculty of Medicine, University of Geneva, Switzerland; Addgene plasmid no. 12251), pRSV-Rev (a gift from Dr Didier Trono, Addgene no. 12253), and pCMV-VSV-G (a gift from Dr Bob Weinberg, Addgene plasmid no. 8454) using jetPRIME transfection reagent (Polyplus) for 12 h at 37 ̊C.

    Article Title: Downregulation of ankyrin 3 (ANK3) promotes malignant behaviors associated with altered adhesion dynamics and actin cytoskeleton remodeling in renal cell carcinoma.
    Article Snippet: Clear cell renal cell carcinoma (ccRCC) is the most common type of kidney cancer, with existing therapies largely ineffective for advanced stages.. Ankyrin 3 (ANK3), a protein involved in various cellular processes, has been associated with poor prognosis and immune infiltration in ccRCC.. However, its role in ccRCC development and progression remains poorly understood.

    Article Title: Repeat-element RNAs integrate a neuronal growth circuit
    Article Snippet: AAV-U6-B2_EF1a-YFP plasmid , This paper , N/A. .. AAV-U6-shControl_EF1a-YFP plasmid , Addgene , Plasmid # 85741; RRID:Addgene_85741. .. pAAV-hSyn-A-Fos-WPRE plasmid (AAV-A-Fos) , Marvaldi et al. , N/A.

    Article Title: CXCR4/CXCL12 axis promotes lymphatic metastasis in tongue squamous cell carcinoma via PI3K/AKT signaling pathway
    Article Snippet: .. Lentiviral vectors expressing CXCR4 shRNA (shCXCR4) or non-targeting control shRNA (shControl) were constructed by cloning the target sequences into the pLKO.1 vector (Addgene, Cat10878). ..

    Negative Control:

    Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells
    Article Snippet: shHSPD1 with the following oligonucleotide sequence: 5'-GCTAAACTTGTTCAAGATGTTTCAAGAGAACATCTTGAACAAGTTTAGCTTTTTT-3' was cloned into the pLKO.1-puro plasmid (a gift from Dr Bob Weinberg, Whitehead Institute for Biomedical Research and Department of Biology, Massachusetts Institute of Technology, MA, USA; Addgene plasmid no. 8453). .. The scrambled shRNA (shControl) with the oligonucleotide sequence: 5'-CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG-3' inserted into the pLKO.1-puro plasmid (a gift from Dr David Sabatini, Whitehead Institute for Biomedical Research and Department of Biology, Massachusetts Institute of Technology, MA, USA; Addgene plasmid no. 1864) served as a negative control. .. Using a third-generation lentivirus system, lentiviral particles were produced by co-transfecting 293T cells (CRL-3216; ATCC) with either pLKO.1-puro-shHSPD1 (6 μg) or pLKO.1-puro-shControl (6 μg), along with packaging plasmids, including pMDLg/pRRE (a gift from Dr Didier Trono, Department of Genetics and Microbiology, Faculty of Medicine, University of Geneva, Switzerland; Addgene plasmid no. 12251), pRSV-Rev (a gift from Dr Didier Trono, Addgene no. 12253), and pCMV-VSV-G (a gift from Dr Bob Weinberg, Addgene plasmid no. 8454) using jetPRIME transfection reagent (Polyplus) for 12 h at 37 ̊C.

    Article Title: Downregulation of ankyrin 3 (ANK3) promotes malignant behaviors associated with altered adhesion dynamics and actin cytoskeleton remodeling in renal cell carcinoma.
    Article Snippet: Clear cell renal cell carcinoma (ccRCC) is the most common type of kidney cancer, with existing therapies largely ineffective for advanced stages.. Ankyrin 3 (ANK3), a protein involved in various cellular processes, has been associated with poor prognosis and immune infiltration in ccRCC.. However, its role in ccRCC development and progression remains poorly understood.

    other:

    Article Title: m 6 A RNA methylation-mediated control of global APC expression is required for local translation of β-actin and axon development.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Neuro-2a neuroblastoma cells ATCC CCL-131 RRID:CVCL_0470 Experimental models: Organisms/strains ICR mice Japan SLC RRID:MGI:2160272 Oligonucleotides SELECT_qPCR_F 5′ATGCAGCGACTCAGCCTCTG3′ FASMAC N/A SELECT_qPCR_R 5′TAGCCAGTACCGTAGTGCGTG3′ FASMAC N/A APC m6A 7836 up 5′tagccagtaccgtagtgcgtg GAAGGGAAGGGCTTAAAACTGGGG3’ FASMAC N/A APC m6A 7836 down 5phos/CTGTGCC TGCGACCTGGTcagaggctgagtcgctgcat3’ FASMAC N/A APC m6A 11110 up 5′tagccagtaccgtagt gcgtgCAGCCATTATCTCTAGCCAAAGGG3’ FASMAC N/A APC m6A 11110 down 5phos/TTAATCCAGCA ACTCCATCTTCAAGGcagaggctgagtcgctgcat3’ FASMAC N/A APC m6A 12324 up 5′tagccagtaccgtagtgc gtgGAACAGGAGGAAAATGACCTGGG3’ FASMAC N/A APC m6A 12324 down 5phos/TTACAGAAGTCA CGGTTCATAGAATTCCcagaggctgagtcgctgcat3’ FASMAC N/A APC A 11121 up 5′tagccagtaccgtagtgcgtg CCCTTTGCTTTCACAGCCATTATCTC3’ FASMAC N/A APC A 11121 down 5phos/AGCCAAAGGGTTT AATCCAGCAACcagaggctgagtcgctgcat3’ FASMAC N/A Ythdf1 forward qPCR 5′GCATCAGAAGGATGCAGTTCATG3′ FASMAC N/A Ythdf1 Reverse qPCR 5′GATGGTGGATAGTAACTGGACAG3′ FASMAC N/A Mettl14 forward qPCR 5′AGAGTGCGGATAGCATTGGTGC3′ FASMAC N/A Mettl14 Reverse qPCR 5′CTCCTTCATCCAGACACTTCCG3′ FASMAC N/A Apc forward qPCR 5′CCCCAGTGACCTTCCAGATA3′ FASMAC N/A Apc reverse qPCR 5′GCACTGTCTGTGGAGGAGGT3′ FASMAC N/A shYthdf1 5′-CTAATACATCCCAAAGATA-3′ FASMAC N/A shYthdf2 5′-GGATTAATTTGATTTCAAA-3′ FASMAC N/A shYthdf3 5′-GCCAAACAGTACATAATCTA-3′ FASMAC N/A shMettl14 5′-CTTACACTTGCATCTTTAT-3′ FASMAC N/A shApc 5′-GTACTAACTAGGTAAATA-3′ FASMAC N/A shControl 5′-GCTACCTCCATTTAGTGT-3′ FASMAC N/A Recombinant DNA pCALSL-mir30 Addgene #13786 pCAG-ERT2CreERT2 Addgene #13777 pCAGGS-HA Gift from Kengaku Mineko N/A (Continued on next page) 20 Cell Reports 44, 115727, June 24, 2025

    Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells
    Article Snippet: Using a third-generation lentivirus system, lentiviral particles were produced by co-transfecting 293T cells (CRL-3216; ATCC) with either pLKO.1-puro-shHSPD1 (6 μg) or pLKO.1-puro-shControl (6 μg), along with packaging plasmids, including pMDLg/pRRE (a gift from Dr Didier Trono, Department of Genetics and Microbiology, Faculty of Medicine, University of Geneva, Switzerland; Addgene plasmid no. 12251), pRSV-Rev (a gift from Dr Didier Trono, Addgene no. 12253), and pCMV-VSV-G (a gift from Dr Bob Weinberg, Addgene plasmid no. 8454) using jetPRIME transfection reagent (Polyplus) for 12 h at 37 ̊C.

    Bioprocessing:

    Article Title: Repeat-element RNAs integrate a neuronal growth circuit
    Article Snippet: AAV-U6-B2_EF1a-YFP plasmid , This paper , N/A. .. AAV-U6-shControl_EF1a-YFP plasmid , Addgene , Plasmid # 85741; RRID:Addgene_85741. .. pAAV-hSyn-A-Fos-WPRE plasmid (AAV-A-Fos) , Marvaldi et al. , N/A.

    Construct:

    Article Title: Chemical reprogramming of fibroblasts into retinal pigment epithelium cells for vision restoration.
    Article Snippet: .. The next day, when the cells reached 70–80% confluence, the 943 constructed vectors (pLKO.1-shAscl1-1, pLKO.1-shAscl1-2, pLKO.1-shOlig2-1, pLKO.1-944 shOlig2-2 and pLKO.1-shControl) were co-transfected with the lentiviral packaging vectors 945 pMD2.G (Addgene, 12259) and psPAX2 (Addgene, 12260) into 293T cells using 946 Lipofectamine 3000 (Invitrogen, L3000015) transfection reagent, following the manufacturer's 947 instructions. .. Viral supernatants were collected at 48- and 72-hours post-transfection, filtered 948 through a 0.45 μm syringe filter to remove cellular debris, and concentrated overnight using 949 the Universal Virus Concentration Kit (Beyotime, C2901S).

    Article Title: CXCR4/CXCL12 axis promotes lymphatic metastasis in tongue squamous cell carcinoma via PI3K/AKT signaling pathway
    Article Snippet: .. Lentiviral vectors expressing CXCR4 shRNA (shCXCR4) or non-targeting control shRNA (shControl) were constructed by cloning the target sequences into the pLKO.1 vector (Addgene, Cat10878). ..

    Transfection:

    Article Title: Chemical reprogramming of fibroblasts into retinal pigment epithelium cells for vision restoration.
    Article Snippet: .. The next day, when the cells reached 70–80% confluence, the 943 constructed vectors (pLKO.1-shAscl1-1, pLKO.1-shAscl1-2, pLKO.1-shOlig2-1, pLKO.1-944 shOlig2-2 and pLKO.1-shControl) were co-transfected with the lentiviral packaging vectors 945 pMD2.G (Addgene, 12259) and psPAX2 (Addgene, 12260) into 293T cells using 946 Lipofectamine 3000 (Invitrogen, L3000015) transfection reagent, following the manufacturer's 947 instructions. .. Viral supernatants were collected at 48- and 72-hours post-transfection, filtered 948 through a 0.45 μm syringe filter to remove cellular debris, and concentrated overnight using 949 the Universal Virus Concentration Kit (Beyotime, C2901S).

    Expressing:

    Article Title: CXCR4/CXCL12 axis promotes lymphatic metastasis in tongue squamous cell carcinoma via PI3K/AKT signaling pathway
    Article Snippet: .. Lentiviral vectors expressing CXCR4 shRNA (shCXCR4) or non-targeting control shRNA (shControl) were constructed by cloning the target sequences into the pLKO.1 vector (Addgene, Cat10878). ..

    Control:

    Article Title: CXCR4/CXCL12 axis promotes lymphatic metastasis in tongue squamous cell carcinoma via PI3K/AKT signaling pathway
    Article Snippet: .. Lentiviral vectors expressing CXCR4 shRNA (shCXCR4) or non-targeting control shRNA (shControl) were constructed by cloning the target sequences into the pLKO.1 vector (Addgene, Cat10878). ..

    Article Title: piRNA-mediated silencing of exogenous retrovirus in mouse spermatogonial stem cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-ACTB SIGMA Cat# A5441; RRID: AB_476744 Rabbit anti-DNMT3A(E9P2F) Cell Signal Cat# 49768; RRID: AB_2799365 Mouse anti-Dnmt3b(G-9) Santa Cruz Cat# sc-376043; RRID: AB_10988201 GFP Polyclonal Antibody invitrogen Cat# A-11122; RRID: AB_221569 Mouse anti-GLP/EHMT1 R&D SYSTEMS Cat# PP-B0422-00; RRID: AB_2097494 Rabbit anti-G9a/EHMT2 Cell Signal Cat# 3306S; RRID: AB_2097647 Goat anti-GFRA1 R&D SYSTEMS Cat# AF560; RRID: AB_2110307 Mouse anti-trimethyl-Histone H3 (Lys9) Millipore Cat# 07-442; RRID: AB_310620 Mouse anti-dimethyl-Histone H3 (Lys9) Millipore Cat# 07-441; RRID: AB_11212297 Mouse anti-MAGE-A(6C1) Santa Cruz Cat# sc-20034; RRID: AB_627907 Rabbit anti-MPP8 (MPHOSPH8) proteintech Cat# 16796-1-AP; RRID: AB_2266644 Rabbit anti-PIWIL2 abcam Cat# ab36764; RRID: AB_777284 Rabbit anti-PIWIL1-C Kuramochi-Miyagawa et al.26 N/A Rabbit anti-SETDB1 proteintech Cat# 11231-1-AP; RRID: AB_2186069 Rabbit anti-SYCP3 Novus Bio Cat# NB300-231; RRID: AB_10002746 Rabbit anti-TRP53 Novus Bio Cat# NBP2-62555; RRID: AB_3352998 Rabbit IgG control proteintech Cat# 30000-0-AP; RRID: AB_2819035 Normal mouse IgG Santa Cruz Cat# sc-2025; RRID: AB_737182 Alexa Fluor 488 donkey anti-rabbit IgG (H + L) Molecular Probes Cat# A21206; RRID: AB_2535792 Alexa Fluor 555 donkey anti-rabbit IgG (H + L) Molecular Probes Cat# A31572; RRID: AB_162543 Alexa Fluor 555 anti-goat IgG Molecular Probes Cat# A21432; RRID: AB_141788 Anti-rabbit IgG, HRP-linked antibody Cell signal Cat# 7074; RRID: AB_2099233 Anti-mouse IgG, HRP-linked antibody Cell signal Cat# 7076; RRID: AB_330924 Donkey anti-Goat IgG H&L (HRP) abcam Cat# ab97110; RRID: AB_10679463 Mouse TrueBlot ULTRA Anti-Mouse Ig HRP ROCLAND Cat# 18-8817-30; RRID: AB_2610849 Bacterial and virus strains shControl Addgene #1864 shPiwil2 Horizon Discovery TRCN0000009646 TRCN0000009647 TRCN0000009648 TRCN0000011812 TRCN0000011811 shPiwil1 Horizon Discovery TRCN0000009642 TRCN0000009643 TRCN0000009644 TRCN0000009645 shTrp53 Horizon Discovery TRCN0000012358 TRCN0000012359 TRCN0000012360 TRCN0000012361 TRCN0000012362 shMagea Horizon Discovery TRCN0000112760 TRCN0000112761 TRCN0000112762 TRCN0000112763 TRCN0000112764 (Continued on next page) Cell Reports 45, 117992, October 27, 2026 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER shTrim28 Horizon Discovery TRCN0000071363 TRCN0000071364 TRCN0000071365 TRCN0000071366 TRCN0000071367 shMphosph8 Horizon Discovery TRCN0000085438 TRCN0000085439 TRCN0000085440 TRCN0000085441 TRCN0000085442 shSetdb1 Horizon Discovery TRCN0000092973 TRCN0000092974 TRCN0000092975 TRCN0000092976 TRCN0000092977 shEhmt1 Horizon Discovery TRCN0000086068 TRCN0000086070 TRCN0000086071 TRCN0000086072 shEhmt2 Horizon Discovery TRCN0000054543 TRCN0000054544 TRCN0000054546 TRCN0000054547 pLV-CMV-Egfp In(WT) Dr. M. Ikawa (Osaka University) N/A pLV-CMV-Egfp In(D64V) Dr. M. Ikawa (Osaka University), Certo et al.36 N/A CSII-Piwil2-WT This study N/A CSII-Piwil2-D813A This study N/A CSII-Trp53 This study N/A CSII-Magea5 This study N/A CSII-Dnmt3a1 This study N/A CSII-Dnmt3a2 This study N/A pLKO-Control sponge This study N/A pLKO-miR-224 sponge This study N/A pLKO-miR-543 sponge This study N/A pLKO-miR-224 mimic This study N/A pLKO-miR-543 mimic This study N/A Deposited data Small RNA-seq This study GSE299335 RNA-seq This study GSE242728 Experimental models: Cell lines WT GSC Kanatsu-Shinohara et al.34 N/A Trp53-KO GSC Kanatsu-Shinohara et al.69 N/A Piwil2-KO GSC Shiromoto et al.39 AES0197 Piwil4-KO GSC Kuramochi-Miyagawa et al.40 N/A Dnmt3a/3b floxed GSC Takashima et al.46 N/A Experimental models: Organisms/strains DBA/2 mouse (M. musculus) Japan SLC DBA/2CrSlc WBB6F1-W/Wv (W) mice (M. musculus) Japan SLC WBB6F1/Kit-KitW/KitW-v/Slc Piwil2-KO mouse (M. musculus) Dr. T. Nakano (Osaka University, Osaka, Japan) RBRC01361 Trp53-KO mouse (M. musculus) RIKEN BRC – (Continued on next page) 18 Cell Reports 45, 117992, October 27, 2026

    Cloning:

    Article Title: CXCR4/CXCL12 axis promotes lymphatic metastasis in tongue squamous cell carcinoma via PI3K/AKT signaling pathway
    Article Snippet: .. Lentiviral vectors expressing CXCR4 shRNA (shCXCR4) or non-targeting control shRNA (shControl) were constructed by cloning the target sequences into the pLKO.1 vector (Addgene, Cat10878). ..

    Virus:

    Article Title: piRNA-mediated silencing of exogenous retrovirus in mouse spermatogonial stem cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-ACTB SIGMA Cat# A5441; RRID: AB_476744 Rabbit anti-DNMT3A(E9P2F) Cell Signal Cat# 49768; RRID: AB_2799365 Mouse anti-Dnmt3b(G-9) Santa Cruz Cat# sc-376043; RRID: AB_10988201 GFP Polyclonal Antibody invitrogen Cat# A-11122; RRID: AB_221569 Mouse anti-GLP/EHMT1 R&D SYSTEMS Cat# PP-B0422-00; RRID: AB_2097494 Rabbit anti-G9a/EHMT2 Cell Signal Cat# 3306S; RRID: AB_2097647 Goat anti-GFRA1 R&D SYSTEMS Cat# AF560; RRID: AB_2110307 Mouse anti-trimethyl-Histone H3 (Lys9) Millipore Cat# 07-442; RRID: AB_310620 Mouse anti-dimethyl-Histone H3 (Lys9) Millipore Cat# 07-441; RRID: AB_11212297 Mouse anti-MAGE-A(6C1) Santa Cruz Cat# sc-20034; RRID: AB_627907 Rabbit anti-MPP8 (MPHOSPH8) proteintech Cat# 16796-1-AP; RRID: AB_2266644 Rabbit anti-PIWIL2 abcam Cat# ab36764; RRID: AB_777284 Rabbit anti-PIWIL1-C Kuramochi-Miyagawa et al.26 N/A Rabbit anti-SETDB1 proteintech Cat# 11231-1-AP; RRID: AB_2186069 Rabbit anti-SYCP3 Novus Bio Cat# NB300-231; RRID: AB_10002746 Rabbit anti-TRP53 Novus Bio Cat# NBP2-62555; RRID: AB_3352998 Rabbit IgG control proteintech Cat# 30000-0-AP; RRID: AB_2819035 Normal mouse IgG Santa Cruz Cat# sc-2025; RRID: AB_737182 Alexa Fluor 488 donkey anti-rabbit IgG (H + L) Molecular Probes Cat# A21206; RRID: AB_2535792 Alexa Fluor 555 donkey anti-rabbit IgG (H + L) Molecular Probes Cat# A31572; RRID: AB_162543 Alexa Fluor 555 anti-goat IgG Molecular Probes Cat# A21432; RRID: AB_141788 Anti-rabbit IgG, HRP-linked antibody Cell signal Cat# 7074; RRID: AB_2099233 Anti-mouse IgG, HRP-linked antibody Cell signal Cat# 7076; RRID: AB_330924 Donkey anti-Goat IgG H&L (HRP) abcam Cat# ab97110; RRID: AB_10679463 Mouse TrueBlot ULTRA Anti-Mouse Ig HRP ROCLAND Cat# 18-8817-30; RRID: AB_2610849 Bacterial and virus strains shControl Addgene #1864 shPiwil2 Horizon Discovery TRCN0000009646 TRCN0000009647 TRCN0000009648 TRCN0000011812 TRCN0000011811 shPiwil1 Horizon Discovery TRCN0000009642 TRCN0000009643 TRCN0000009644 TRCN0000009645 shTrp53 Horizon Discovery TRCN0000012358 TRCN0000012359 TRCN0000012360 TRCN0000012361 TRCN0000012362 shMagea Horizon Discovery TRCN0000112760 TRCN0000112761 TRCN0000112762 TRCN0000112763 TRCN0000112764 (Continued on next page) Cell Reports 45, 117992, October 27, 2026 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER shTrim28 Horizon Discovery TRCN0000071363 TRCN0000071364 TRCN0000071365 TRCN0000071366 TRCN0000071367 shMphosph8 Horizon Discovery TRCN0000085438 TRCN0000085439 TRCN0000085440 TRCN0000085441 TRCN0000085442 shSetdb1 Horizon Discovery TRCN0000092973 TRCN0000092974 TRCN0000092975 TRCN0000092976 TRCN0000092977 shEhmt1 Horizon Discovery TRCN0000086068 TRCN0000086070 TRCN0000086071 TRCN0000086072 shEhmt2 Horizon Discovery TRCN0000054543 TRCN0000054544 TRCN0000054546 TRCN0000054547 pLV-CMV-Egfp In(WT) Dr. M. Ikawa (Osaka University) N/A pLV-CMV-Egfp In(D64V) Dr. M. Ikawa (Osaka University), Certo et al.36 N/A CSII-Piwil2-WT This study N/A CSII-Piwil2-D813A This study N/A CSII-Trp53 This study N/A CSII-Magea5 This study N/A CSII-Dnmt3a1 This study N/A CSII-Dnmt3a2 This study N/A pLKO-Control sponge This study N/A pLKO-miR-224 sponge This study N/A pLKO-miR-543 sponge This study N/A pLKO-miR-224 mimic This study N/A pLKO-miR-543 mimic This study N/A Deposited data Small RNA-seq This study GSE299335 RNA-seq This study GSE242728 Experimental models: Cell lines WT GSC Kanatsu-Shinohara et al.34 N/A Trp53-KO GSC Kanatsu-Shinohara et al.69 N/A Piwil2-KO GSC Shiromoto et al.39 AES0197 Piwil4-KO GSC Kuramochi-Miyagawa et al.40 N/A Dnmt3a/3b floxed GSC Takashima et al.46 N/A Experimental models: Organisms/strains DBA/2 mouse (M. musculus) Japan SLC DBA/2CrSlc WBB6F1-W/Wv (W) mice (M. musculus) Japan SLC WBB6F1/Kit-KitW/KitW-v/Slc Piwil2-KO mouse (M. musculus) Dr. T. Nakano (Osaka University, Osaka, Japan) RBRC01361 Trp53-KO mouse (M. musculus) RIKEN BRC – (Continued on next page) 18 Cell Reports 45, 117992, October 27, 2026



    Similar Products

    virus strains shcontrol addgene  (Addgene inc)
    96
    Addgene inc virus strains shcontrol addgene
    Virus Strains Shcontrol Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shcontrol/scramble+shRNA+(Plasmid+%231864)/pm42776838-284-232-235
    Average 96 stars, based on 1 article reviews
    virus strains shcontrol addgene - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    control lentivirus shcontrol  (Shanghai Genechem Ltd)
    86
    Shanghai Genechem Ltd control lentivirus shcontrol
    Control Lentivirus Shcontrol, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shcontrol/lentiviruses/pm42240927-62-13-8
    Average 86 stars, based on 1 article reviews
    control lentivirus shcontrol - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    aav8 shcontrol paav gfaabc1d egfp 3xflag mir30shrna nc wpre  (Obio Technology Corp Ltd)
    86
    Obio Technology Corp Ltd aav8 shcontrol paav gfaabc1d egfp 3xflag mir30shrna nc wpre
    Aav8 Shcontrol Paav Gfaabc1d Egfp 3xflag Mir30shrna Nc Wpre, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shcontrol/particles+viral/pm41775257-612-3-12
    Average 86 stars, based on 1 article reviews
    aav8 shcontrol paav gfaabc1d egfp 3xflag mir30shrna nc wpre - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    aav8 shcontrol paav tbg zsgreen1 mir30shrna nc wpre  (Obio Technology Corp Ltd)
    86
    Obio Technology Corp Ltd aav8 shcontrol paav tbg zsgreen1 mir30shrna nc wpre
    Aav8 Shcontrol Paav Tbg Zsgreen1 Mir30shrna Nc Wpre, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shcontrol/cbg+dio+egfp+mir30shrna+paav+sptlc1+targeting/pm41775257-612-17-12
    Average 86 stars, based on 1 article reviews
    aav8 shcontrol paav tbg zsgreen1 mir30shrna nc wpre - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    non targeting control short hairpin rna shcontrol llc phosphate buffered saline  (Sangon Biotech)
    86
    Sangon Biotech non targeting control short hairpin rna shcontrol llc phosphate buffered saline
    Ribavirin has synergistic effects on 5′-adenosine monophosphate (AMP)-activated protein kinase (AMPK) downregulation. (A) Three AMPK-targeting short hairpin RNAs (shRNAs) were screened to evaluate their knockdown efficiency and suppress AMPK expression in lung cancer cells. The data shown are representative of n = 3 biological replicates. (B) Tumor anatomy of mouse Lewis lung carcinoma (LLC) cells subcutaneous tumor-bearing mice in different treatment groups. (C) Tumor volume of LLC subcutaneous tumor-bearing mice in different treatment groups. Statistical significance between datasets was assessed by one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparisons post hoc test between all groups. The values are the means ± standard error of the mean (SEM); n = 8 mice per group, with differences denoted by ∗ P < 0.05 and ∗∗ P < 0.01. (D) Tumor weights of LLC subcutaneous tumor-bearing mice in different treatment groups. Statistical significance between datasets was assessed by one-way ANOVA, followed by Tukey’s multiple comparisons post hoc test between all groups. The values are the means ± SEM; n = 8 mice per group, with differences denoted by ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001. (E) Schematic illustration of the mechanism by which Ribavirin regulates AMPK activation. AMPK is phosphorylated in response to an increased AMP/adenosine triphosphate (ATP) or adenosine diphosphate (ADP)/ATP ratio, influencing cell growth and proliferation by inactivating mechanistic target of rapamycin complex 1 (mTORC1). Ribavirin exerts its regulatory effect by inhibiting AMPK phosphorylation. Created with www.BioRender.com . <t>shControl:</t> <t>non-targeting</t> control short hairpin <t>RNA;</t> shAMPKα: AMPKα-targeting short hairpin RNA; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; PBS: phosphate buffered saline; mTOR: mechanistic target of rapamycin; Raptor: regulatory-associated protein of mTOR; Deptor: DEP domain-containing mTOR-interacting protein; PRAS40: proline-rich Akt substrate of 40 kDa; mLST8: mammalian lethal with SEC13 protein 8; 4EBP1:eukaryotic translation initiation factor 4E-binding protein 1; P: phosphorylation.
    Non Targeting Control Short Hairpin Rna Shcontrol Llc Phosphate Buffered Saline, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shcontrol/buffered+phosphate+saline/pmc12962084-75-13-24
    Average 86 stars, based on 1 article reviews
    non targeting control short hairpin rna shcontrol llc phosphate buffered saline - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    vectors plko 1 shascl1 1  (Addgene inc)
    93
    Addgene inc vectors plko 1 shascl1 1
    Ribavirin has synergistic effects on 5′-adenosine monophosphate (AMP)-activated protein kinase (AMPK) downregulation. (A) Three AMPK-targeting short hairpin RNAs (shRNAs) were screened to evaluate their knockdown efficiency and suppress AMPK expression in lung cancer cells. The data shown are representative of n = 3 biological replicates. (B) Tumor anatomy of mouse Lewis lung carcinoma (LLC) cells subcutaneous tumor-bearing mice in different treatment groups. (C) Tumor volume of LLC subcutaneous tumor-bearing mice in different treatment groups. Statistical significance between datasets was assessed by one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparisons post hoc test between all groups. The values are the means ± standard error of the mean (SEM); n = 8 mice per group, with differences denoted by ∗ P < 0.05 and ∗∗ P < 0.01. (D) Tumor weights of LLC subcutaneous tumor-bearing mice in different treatment groups. Statistical significance between datasets was assessed by one-way ANOVA, followed by Tukey’s multiple comparisons post hoc test between all groups. The values are the means ± SEM; n = 8 mice per group, with differences denoted by ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001. (E) Schematic illustration of the mechanism by which Ribavirin regulates AMPK activation. AMPK is phosphorylated in response to an increased AMP/adenosine triphosphate (ATP) or adenosine diphosphate (ADP)/ATP ratio, influencing cell growth and proliferation by inactivating mechanistic target of rapamycin complex 1 (mTORC1). Ribavirin exerts its regulatory effect by inhibiting AMPK phosphorylation. Created with www.BioRender.com . <t>shControl:</t> <t>non-targeting</t> control short hairpin <t>RNA;</t> shAMPKα: AMPKα-targeting short hairpin RNA; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; PBS: phosphate buffered saline; mTOR: mechanistic target of rapamycin; Raptor: regulatory-associated protein of mTOR; Deptor: DEP domain-containing mTOR-interacting protein; PRAS40: proline-rich Akt substrate of 40 kDa; mLST8: mammalian lethal with SEC13 protein 8; 4EBP1:eukaryotic translation initiation factor 4E-binding protein 1; P: phosphorylation.
    Vectors Plko 1 Shascl1 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shcontrol/pLKO%2E1+shControl+(Plasmid+%2374972)/pm41366246-472-19-29
    Average 93 stars, based on 1 article reviews
    vectors plko 1 shascl1 1 - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    scramble shrna shcontrol  (Addgene inc)
    96
    Addgene inc scramble shrna shcontrol
    Ribavirin has synergistic effects on 5′-adenosine monophosphate (AMP)-activated protein kinase (AMPK) downregulation. (A) Three AMPK-targeting short hairpin RNAs (shRNAs) were screened to evaluate their knockdown efficiency and suppress AMPK expression in lung cancer cells. The data shown are representative of n = 3 biological replicates. (B) Tumor anatomy of mouse Lewis lung carcinoma (LLC) cells subcutaneous tumor-bearing mice in different treatment groups. (C) Tumor volume of LLC subcutaneous tumor-bearing mice in different treatment groups. Statistical significance between datasets was assessed by one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparisons post hoc test between all groups. The values are the means ± standard error of the mean (SEM); n = 8 mice per group, with differences denoted by ∗ P < 0.05 and ∗∗ P < 0.01. (D) Tumor weights of LLC subcutaneous tumor-bearing mice in different treatment groups. Statistical significance between datasets was assessed by one-way ANOVA, followed by Tukey’s multiple comparisons post hoc test between all groups. The values are the means ± SEM; n = 8 mice per group, with differences denoted by ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001. (E) Schematic illustration of the mechanism by which Ribavirin regulates AMPK activation. AMPK is phosphorylated in response to an increased AMP/adenosine triphosphate (ATP) or adenosine diphosphate (ADP)/ATP ratio, influencing cell growth and proliferation by inactivating mechanistic target of rapamycin complex 1 (mTORC1). Ribavirin exerts its regulatory effect by inhibiting AMPK phosphorylation. Created with www.BioRender.com . <t>shControl:</t> <t>non-targeting</t> control short hairpin <t>RNA;</t> shAMPKα: AMPKα-targeting short hairpin RNA; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; PBS: phosphate buffered saline; mTOR: mechanistic target of rapamycin; Raptor: regulatory-associated protein of mTOR; Deptor: DEP domain-containing mTOR-interacting protein; PRAS40: proline-rich Akt substrate of 40 kDa; mLST8: mammalian lethal with SEC13 protein 8; 4EBP1:eukaryotic translation initiation factor 4E-binding protein 1; P: phosphorylation.
    Scramble Shrna Shcontrol, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shcontrol/scramble+shRNA+(Plasmid+%231864)/pm41186628-40-5-8
    Average 96 stars, based on 1 article reviews
    scramble shrna shcontrol - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    control shrna shcontrol  (Sangon Biotech)
    86
    Sangon Biotech control shrna shcontrol
    Ribavirin has synergistic effects on 5′-adenosine monophosphate (AMP)-activated protein kinase (AMPK) downregulation. (A) Three AMPK-targeting short hairpin RNAs (shRNAs) were screened to evaluate their knockdown efficiency and suppress AMPK expression in lung cancer cells. The data shown are representative of n = 3 biological replicates. (B) Tumor anatomy of mouse Lewis lung carcinoma (LLC) cells subcutaneous tumor-bearing mice in different treatment groups. (C) Tumor volume of LLC subcutaneous tumor-bearing mice in different treatment groups. Statistical significance between datasets was assessed by one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparisons post hoc test between all groups. The values are the means ± standard error of the mean (SEM); n = 8 mice per group, with differences denoted by ∗ P < 0.05 and ∗∗ P < 0.01. (D) Tumor weights of LLC subcutaneous tumor-bearing mice in different treatment groups. Statistical significance between datasets was assessed by one-way ANOVA, followed by Tukey’s multiple comparisons post hoc test between all groups. The values are the means ± SEM; n = 8 mice per group, with differences denoted by ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001. (E) Schematic illustration of the mechanism by which Ribavirin regulates AMPK activation. AMPK is phosphorylated in response to an increased AMP/adenosine triphosphate (ATP) or adenosine diphosphate (ADP)/ATP ratio, influencing cell growth and proliferation by inactivating mechanistic target of rapamycin complex 1 (mTORC1). Ribavirin exerts its regulatory effect by inhibiting AMPK phosphorylation. Created with www.BioRender.com . <t>shControl:</t> <t>non-targeting</t> control short hairpin <t>RNA;</t> shAMPKα: AMPKα-targeting short hairpin RNA; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; PBS: phosphate buffered saline; mTOR: mechanistic target of rapamycin; Raptor: regulatory-associated protein of mTOR; Deptor: DEP domain-containing mTOR-interacting protein; PRAS40: proline-rich Akt substrate of 40 kDa; mLST8: mammalian lethal with SEC13 protein 8; 4EBP1:eukaryotic translation initiation factor 4E-binding protein 1; P: phosphorylation.
    Control Shrna Shcontrol, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shcontrol/control+shrna/pm41084177-84-7-16
    Average 86 stars, based on 1 article reviews
    control shrna shcontrol - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    control shcontrol  (New England Biolabs)
    97
    New England Biolabs control shcontrol
    Ribavirin has synergistic effects on 5′-adenosine monophosphate (AMP)-activated protein kinase (AMPK) downregulation. (A) Three AMPK-targeting short hairpin RNAs (shRNAs) were screened to evaluate their knockdown efficiency and suppress AMPK expression in lung cancer cells. The data shown are representative of n = 3 biological replicates. (B) Tumor anatomy of mouse Lewis lung carcinoma (LLC) cells subcutaneous tumor-bearing mice in different treatment groups. (C) Tumor volume of LLC subcutaneous tumor-bearing mice in different treatment groups. Statistical significance between datasets was assessed by one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparisons post hoc test between all groups. The values are the means ± standard error of the mean (SEM); n = 8 mice per group, with differences denoted by ∗ P < 0.05 and ∗∗ P < 0.01. (D) Tumor weights of LLC subcutaneous tumor-bearing mice in different treatment groups. Statistical significance between datasets was assessed by one-way ANOVA, followed by Tukey’s multiple comparisons post hoc test between all groups. The values are the means ± SEM; n = 8 mice per group, with differences denoted by ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001. (E) Schematic illustration of the mechanism by which Ribavirin regulates AMPK activation. AMPK is phosphorylated in response to an increased AMP/adenosine triphosphate (ATP) or adenosine diphosphate (ADP)/ATP ratio, influencing cell growth and proliferation by inactivating mechanistic target of rapamycin complex 1 (mTORC1). Ribavirin exerts its regulatory effect by inhibiting AMPK phosphorylation. Created with www.BioRender.com . <t>shControl:</t> <t>non-targeting</t> control short hairpin <t>RNA;</t> shAMPKα: AMPKα-targeting short hairpin RNA; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; PBS: phosphate buffered saline; mTOR: mechanistic target of rapamycin; Raptor: regulatory-associated protein of mTOR; Deptor: DEP domain-containing mTOR-interacting protein; PRAS40: proline-rich Akt substrate of 40 kDa; mLST8: mammalian lethal with SEC13 protein 8; 4EBP1:eukaryotic translation initiation factor 4E-binding protein 1; P: phosphorylation.
    Control Shcontrol, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shcontrol/Mag+mRNA+Isolation/pm33412003__cb0c00841_si_001-204-56-57
    Average 97 stars, based on 1 article reviews
    control shcontrol - by Bioz Stars, 2026-11
    97/100 stars
    		  Buy from Supplier
    aav shcontrol  (Applied Biological Materials Inc)
    86
    Applied Biological Materials Inc aav shcontrol
    Ribavirin has synergistic effects on 5′-adenosine monophosphate (AMP)-activated protein kinase (AMPK) downregulation. (A) Three AMPK-targeting short hairpin RNAs (shRNAs) were screened to evaluate their knockdown efficiency and suppress AMPK expression in lung cancer cells. The data shown are representative of n = 3 biological replicates. (B) Tumor anatomy of mouse Lewis lung carcinoma (LLC) cells subcutaneous tumor-bearing mice in different treatment groups. (C) Tumor volume of LLC subcutaneous tumor-bearing mice in different treatment groups. Statistical significance between datasets was assessed by one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparisons post hoc test between all groups. The values are the means ± standard error of the mean (SEM); n = 8 mice per group, with differences denoted by ∗ P < 0.05 and ∗∗ P < 0.01. (D) Tumor weights of LLC subcutaneous tumor-bearing mice in different treatment groups. Statistical significance between datasets was assessed by one-way ANOVA, followed by Tukey’s multiple comparisons post hoc test between all groups. The values are the means ± SEM; n = 8 mice per group, with differences denoted by ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001. (E) Schematic illustration of the mechanism by which Ribavirin regulates AMPK activation. AMPK is phosphorylated in response to an increased AMP/adenosine triphosphate (ATP) or adenosine diphosphate (ADP)/ATP ratio, influencing cell growth and proliferation by inactivating mechanistic target of rapamycin complex 1 (mTORC1). Ribavirin exerts its regulatory effect by inhibiting AMPK phosphorylation. Created with www.BioRender.com . <t>shControl:</t> <t>non-targeting</t> control short hairpin <t>RNA;</t> shAMPKα: AMPKα-targeting short hairpin RNA; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; PBS: phosphate buffered saline; mTOR: mechanistic target of rapamycin; Raptor: regulatory-associated protein of mTOR; Deptor: DEP domain-containing mTOR-interacting protein; PRAS40: proline-rich Akt substrate of 40 kDa; mLST8: mammalian lethal with SEC13 protein 8; 4EBP1:eukaryotic translation initiation factor 4E-binding protein 1; P: phosphorylation.
    Aav Shcontrol, supplied by Applied Biological Materials Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shcontrol/aav+shcontrol/bio_rxiv__2025__09__09__674670-47-36-26
    Average 86 stars, based on 1 article reviews
    aav shcontrol - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    Ribavirin has synergistic effects on 5′-adenosine monophosphate (AMP)-activated protein kinase (AMPK) downregulation. (A) Three AMPK-targeting short hairpin RNAs (shRNAs) were screened to evaluate their knockdown efficiency and suppress AMPK expression in lung cancer cells. The data shown are representative of n = 3 biological replicates. (B) Tumor anatomy of mouse Lewis lung carcinoma (LLC) cells subcutaneous tumor-bearing mice in different treatment groups. (C) Tumor volume of LLC subcutaneous tumor-bearing mice in different treatment groups. Statistical significance between datasets was assessed by one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparisons post hoc test between all groups. The values are the means ± standard error of the mean (SEM); n = 8 mice per group, with differences denoted by ∗ P < 0.05 and ∗∗ P < 0.01. (D) Tumor weights of LLC subcutaneous tumor-bearing mice in different treatment groups. Statistical significance between datasets was assessed by one-way ANOVA, followed by Tukey’s multiple comparisons post hoc test between all groups. The values are the means ± SEM; n = 8 mice per group, with differences denoted by ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001. (E) Schematic illustration of the mechanism by which Ribavirin regulates AMPK activation. AMPK is phosphorylated in response to an increased AMP/adenosine triphosphate (ATP) or adenosine diphosphate (ADP)/ATP ratio, influencing cell growth and proliferation by inactivating mechanistic target of rapamycin complex 1 (mTORC1). Ribavirin exerts its regulatory effect by inhibiting AMPK phosphorylation. Created with www.BioRender.com . shControl: non-targeting control short hairpin RNA; shAMPKα: AMPKα-targeting short hairpin RNA; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; PBS: phosphate buffered saline; mTOR: mechanistic target of rapamycin; Raptor: regulatory-associated protein of mTOR; Deptor: DEP domain-containing mTOR-interacting protein; PRAS40: proline-rich Akt substrate of 40 kDa; mLST8: mammalian lethal with SEC13 protein 8; 4EBP1:eukaryotic translation initiation factor 4E-binding protein 1; P: phosphorylation.

    Journal: Journal of Pharmaceutical Analysis

    Article Title: Oblique-incidence reflectivity difference technology identifies the antiviral drug Ribavirin as an inhibitor of lung tumor progression by targeting AMPK signaling

    doi: 10.1016/j.jpha.2025.101306

    Figure Lengend Snippet: Ribavirin has synergistic effects on 5′-adenosine monophosphate (AMP)-activated protein kinase (AMPK) downregulation. (A) Three AMPK-targeting short hairpin RNAs (shRNAs) were screened to evaluate their knockdown efficiency and suppress AMPK expression in lung cancer cells. The data shown are representative of n = 3 biological replicates. (B) Tumor anatomy of mouse Lewis lung carcinoma (LLC) cells subcutaneous tumor-bearing mice in different treatment groups. (C) Tumor volume of LLC subcutaneous tumor-bearing mice in different treatment groups. Statistical significance between datasets was assessed by one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparisons post hoc test between all groups. The values are the means ± standard error of the mean (SEM); n = 8 mice per group, with differences denoted by ∗ P < 0.05 and ∗∗ P < 0.01. (D) Tumor weights of LLC subcutaneous tumor-bearing mice in different treatment groups. Statistical significance between datasets was assessed by one-way ANOVA, followed by Tukey’s multiple comparisons post hoc test between all groups. The values are the means ± SEM; n = 8 mice per group, with differences denoted by ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001. (E) Schematic illustration of the mechanism by which Ribavirin regulates AMPK activation. AMPK is phosphorylated in response to an increased AMP/adenosine triphosphate (ATP) or adenosine diphosphate (ADP)/ATP ratio, influencing cell growth and proliferation by inactivating mechanistic target of rapamycin complex 1 (mTORC1). Ribavirin exerts its regulatory effect by inhibiting AMPK phosphorylation. Created with www.BioRender.com . shControl: non-targeting control short hairpin RNA; shAMPKα: AMPKα-targeting short hairpin RNA; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; PBS: phosphate buffered saline; mTOR: mechanistic target of rapamycin; Raptor: regulatory-associated protein of mTOR; Deptor: DEP domain-containing mTOR-interacting protein; PRAS40: proline-rich Akt substrate of 40 kDa; mLST8: mammalian lethal with SEC13 protein 8; 4EBP1:eukaryotic translation initiation factor 4E-binding protein 1; P: phosphorylation.

    Article Snippet: The mice were randomly divided into four groups ( n = 8): the non-targeting control short hairpin RNA (shControl)-LLC + phosphate buffered saline (PBS) (Sangon Biotech, Shanghai, China) group, shControl-LLC + Ribavirin group, shAMPKα-LLC + PBS group, and shAMPKα-LLC + Ribavirin group.

    Techniques: Knockdown, Expressing, Activation Assay, Phospho-proteomics, Control, shRNA, Saline, Binding Assay