Journal: bioRxiv

Article Title: X-Chromosome Target Specificity Diverged Between Dosage Compensation Mechanisms of Two Closely Related Caenorhabditis Species

doi: 10.1101/2022.12.05.519163

Figure Lengend Snippet: DNA sequence changes mediated by genome editing. (A) DNA sequences of mutant Cbr sdc-2 alleles that were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . Mutations include short insertions (green) and deletions (red colons) that generate in-frame deletions and frame-shift mutations. Inserted sequences (green) frequently share homology (underlined in green) with sequences flanking the break site, as is typical of NHEJ-mediated repair. The deletions in both sdc-2(y467) and sdc-2(y469) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For y467 , the wild-type sequence ends at codon 926-Asp. The deletion and insertion cause 18 incorrect amino acids to be translated, and a stop codon occurs in place of codon 945. For y469 , the wild-type sequence ends at codon 921-Thr. The deletion causes 26 incorrect amino acids to be translated, and a stop codon occurs in place of codon 948. (B) DNA sequence of mutant Cbr dpy-27(y705) allele created by genome editing using CRISPR/Cas9. The Cas9 target sequence was 5’ CGCTCTGGAGTACGGTAAAA 3’. The PAM is the CGC (red) immediately 3’ of the target sequence. The double strand break (DSB) site is indicated by a blue line. The mutation is a 52 bp deletion (red colons) in exon 4 that creates a premature translation stop codon and prevents formation of the full-length DPY-27 protein. The deletion starts at codon 689, and the in-frame stop codon is 2 codons past the 3’ end of the deletion. (C, D) DNA sequences of mutant Cbr sdc-2 alleles that were obtained as suppressors of the XO-specific lethality caused by a xol-1 mutation. Alleles sdc-2(y453) , sdc-2(y454) , sdc-2(y455) , and sdc-2(y460) , were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . The mutations in both sdc-2(y453) and sdc-2(y454) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For sdc-2(y453) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 6 incorrect amino acids to be translated, and a stop codon occurs in place of codon 570 (554). For sdc-2(y454) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 11 incorrect amino acids to be translated, and a stop codon occurs in place of codon 575. The mutations in both sdc-2(y455) and sdc-2(y460) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins. For sdc-2(y455) , the wild-type sequence ends at codon 927-His. The deletion causes 27 incorrect amino acids to be translated, and a stop codon occurs in place of codon 955. For sdc-2(y460) , the wild-type sequence ends at codon 925-Ile. The deletion and insertion cause 34 incorrect amino acids to be translated, and a stop codon occurs in place of codon 960.

Article Snippet: The Cas9 RNP mix was incubated at 37 °C for 15 min, and 1 μl of the resulting Cas9 RNP mix was combined with 0.5 μl 10 μM dpy-10 repair oligo (IDT), 0.5 μl 10 μM rex repair oligo (IDT), and 8 μl nuclease-free water.

Techniques: Sequencing, Mutagenesis, Zinc-Fingers, CRISPR

Journal: bioRxiv

Article Title: X-Chromosome Target Specificity Diverged Between Dosage Compensation Mechanisms of Two Closely Related Caenorhabditis Species

doi: 10.1101/2022.12.05.519163

Figure Lengend Snippet: List of target-specific sequences for guide RNAs used in CRISPR / Cas9 genome editing experiments

Article Snippet: The Cas9 RNP mix was incubated at 37 °C for 15 min, and 1 μl of the resulting Cas9 RNP mix was combined with 0.5 μl 10 μM dpy-10 repair oligo (IDT), 0.5 μl 10 μM rex repair oligo (IDT), and 8 μl nuclease-free water.

Techniques: CRISPR

Journal: bioRxiv

Article Title: X-Chromosome Target Specificity Diverged Between Dosage Compensation Mechanisms of Two Closely Related Caenorhabditis Species

doi: 10.1101/2022.12.05.519163

Figure Lengend Snippet: DNA sequences of repair templates used in CRISPR / Cas9 genome editing experiments

Article Snippet: The Cas9 RNP mix was incubated at 37 °C for 15 min, and 1 μl of the resulting Cas9 RNP mix was combined with 0.5 μl 10 μM dpy-10 repair oligo (IDT), 0.5 μl 10 μM rex repair oligo (IDT), and 8 μl nuclease-free water.

Techniques: CRISPR

Journal: Journal of Lipid Research

Article Title: Generation of hepatoma cell lines deficient in microsomal triglyceride transfer protein

doi: 10.1016/j.jlr.2022.100257

Figure Lengend Snippet: Guide RNA design, RNA–protein complex formation and electroporation. A: A schematic representation of exon 2 of human MTTP gene. Three different guide RNAs (gRNAs) (red arrows) were designed within exon 2 for targeting. Forward and reverse primers (blue arrows) were used for amplification of the exon 2. B: Single guide RNA (sgRNA) consists of gRNA (red) and a recruiting sequence (green) for Cas9 enzyme. The RNP of sgRNA and Cas-9 protein complex was made in vitro by mixing 2.5 μmol of sgRNA and 2.0 μmol of Cas-9 protein in a microcentrifuge tube. This mixture was transfected into Huh-7 cells by electroporation using various electric pulses of different voltages (800 V, 1,250 V, 1,450 V, and 1,650 V) for 10 ms each. The control cells were also given similar pulses without RNP. The electroporated cells were resuspended in prewarmed media and plated in 6-well plate. C: A schematic representation showing the binding of gRNAs and expected cleavage sites on the target DNA. Cleavage followed by repair is expected to cause indels at cleavage site leading to gene disruption. CRISPR/Cas9, RNA-guided clustered regularly interspaced short palindromic repeats–associated sequence 9; RNP, ribonucleoprotein; sgRNA, single guide ribonucleic acid.

Article Snippet: For electroporation, 10 μl of Huh-7 cells and RNP complex mixture were aspirated into gold plated tips using pipette supplied with kit (# MPK1096, ThermoFisher Scientific).

Techniques: Electroporation, Amplification, Sequencing, In Vitro, Transfection, Binding Assay, CRISPR

Journal: Lupus Science & Medicine

Article Title: Neutrophil gelatinase-associated lipocalin (NGAL) in lupus nephritis and beyond

doi: 10.1136/lupus-2024-001418

Figure Lengend Snippet: ( A ) Neutrophil gelatinase-associated lipocalin (NGAL) plasma levels in patients with lupus nephritis (w/ LN), compared with those without lupus nephritis (w/o LN). ( B ) Correlation between serum creatinine (sCr) and plasma NGAL in patients with SLE. ( C ) Receiver operating characteristic (ROC) curve of NGAL for discriminating patients with SLE with a creatinine clearance <60 mL/min. ( D ) OR with 95% CI for every increase in 10 ng/mL of NGAL regarding history of lupus nephritis (LN), adjusted for sex, age, SLE disease activity index (SLEDAI) and prednisone dose. ( E ) NGAL plasma levels in patients with an SLEDAI ≥10 (corresponding to high disease activity), compared with those with an SLEDAI <10. ( F ) NGAL plasma levels in patients taking a daily dose of prednisone (pred) ≤5 mg/day, compared with those taking a dose >5 mg/day. ( G ) NGAL plasma levels in patients with a Systemic Lupus International Collaborating Clinics—SLICC damage index (SDI) >2, compared with those with an SDI ≤2. ( H ) NGAL plasma levels in patients with SLE with secondary antiphospholipid syndrome (SLE+APS), compared with those without (SLE only). ( I ) NGAL plasma levels in patients with SLE with lupus anticoagulant (LA pos), compared with those without (LA neg). ( J ) NGAL plasma levels in patients with SLE positive for any antiphospholipid antibody (aPL pos), compared with those negative (aPL neg). ( K ) Correlation between anticardiolipin (aCL) IgG titres and plasma NGAL.

Article Snippet: Neutrophils from healthy donors were cultured for 4 hours in RPMI media in the absence (non-stimulated) or the presence of ribonucleoprotein (RNP) and Smith (Sm) IC composed of IgG purified from patients with SLE mixed with Sm/RNP antigen (Arotec Diagnostic # ATR01-10), and used at a final concentration of 10 μg/mL.

Techniques: Clinical Proteomics, Activity Assay

Journal: Lupus Science & Medicine

Article Title: Neutrophil gelatinase-associated lipocalin (NGAL) in lupus nephritis and beyond

doi: 10.1136/lupus-2024-001418

Figure Lengend Snippet: ( A ) Correlation between calprotectin (S100A8/A9) and neutrophil gelatinase-associated lipocalin (NGAL) plasma levels in patients with SLE. ( B ) NGAL levels, expressed as a ratio relative to baseline, in supernatant of neutrophils cultured for 4 hours in the absence of stimulus (non-stimulated (NS)), in the presence of Smith (Sm)/ribonucleoprotein (RNP) immune complexes (IC), and in the presence of IC and a TLR8 inhibitor (+TLR8i). N=16 for each condition; data are representative of three repeated experiments.

Article Snippet: Neutrophils from healthy donors were cultured for 4 hours in RPMI media in the absence (non-stimulated) or the presence of ribonucleoprotein (RNP) and Smith (Sm) IC composed of IgG purified from patients with SLE mixed with Sm/RNP antigen (Arotec Diagnostic # ATR01-10), and used at a final concentration of 10 μg/mL.

Techniques: Clinical Proteomics, Cell Culture