|
ATCC
cell lines hela cells atcc ccl 2 cos7 cells atcc n a hek293ft cells atcc n a ss rfp gfp kdel hela stable cells Cell Lines Hela Cells Atcc Ccl 2 Cos7 Cells Atcc N A Hek293ft Cells Atcc N A Ss Rfp Gfp Kdel Hela Stable Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cell lines hela cells atcc ccl 2 cos7 cells atcc n a hek293ft cells atcc n a ss rfp gfp kdel hela stable cells/product/ATCC Average 99 stars, based on 1 article reviews
cell lines hela cells atcc ccl 2 cos7 cells atcc n a hek293ft cells atcc n a ss rfp gfp kdel hela stable cells - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
|
Vector Biolabs
ad-rfp Ad Rfp, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ad-rfp/product/Vector Biolabs Average 96 stars, based on 1 article reviews
ad-rfp - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
|
Surfix Inc
bglii rfp rfc10 surfix ![]() Bglii Rfp Rfc10 Surfix, supplied by Surfix Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/bglii rfp rfc10 surfix/product/Surfix Inc Average 86 stars, based on 1 article reviews
bglii rfp rfc10 surfix - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
gttcgaactggtctaagttta sangon biotech n a shrna trim27 ![]() Gttcgaactggtctaagttta Sangon Biotech N A Shrna Trim27, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gttcgaactggtctaagttta sangon biotech n a shrna trim27/product/Sangon Biotech Average 86 stars, based on 1 article reviews
gttcgaactggtctaagttta sangon biotech n a shrna trim27 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
TaKaRa
a 6455 mouse monoclonal anti rfp takara ![]() A 6455 Mouse Monoclonal Anti Rfp Takara, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/a 6455 mouse monoclonal anti rfp takara/product/TaKaRa Average 97 stars, based on 1 article reviews
a 6455 mouse monoclonal anti rfp takara - by Bioz Stars,
2026-05
97/100 stars
|
Buy from Supplier |
|
TaKaRa
mouse anti rfp ![]() Mouse Anti Rfp, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse anti rfp/product/TaKaRa Average 97 stars, based on 1 article reviews
mouse anti rfp - by Bioz Stars,
2026-05
97/100 stars
|
Buy from Supplier |
|
Ozgene Inc
cell lines g5c luc rfp ![]() Cell Lines G5c Luc Rfp, supplied by Ozgene Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cell lines g5c luc rfp/product/Ozgene Inc Average 86 stars, based on 1 article reviews
cell lines g5c luc rfp - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
il5 rfp cre mice ![]() Il5 Rfp Cre Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/il5 rfp cre mice/product/Jackson Laboratory Average 86 stars, based on 1 article reviews
il5 rfp cre mice - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
ccr2 rfp rfp ![]() Ccr2 Rfp Rfp, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ccr2 rfp rfp/product/Jackson Laboratory Average 86 stars, based on 1 article reviews
ccr2 rfp rfp - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Addgene inc
lentivirus rfp ![]() Lentivirus Rfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lentivirus rfp/product/Addgene inc Average 95 stars, based on 1 article reviews
lentivirus rfp - by Bioz Stars,
2026-05
95/100 stars
|
Buy from Supplier |
Journal: STAR Protocols
Article Title: Protocol for condensate-based stabilization of gene circuit dynamics under growth-mediated dilution in E. coli
doi: 10.1016/j.xpro.2026.104536
Figure Lengend Snippet: Design of gene circuits used in this protocol (A) DNA sequence of B0034-MCS1-pSB1A2 between RFC10 prefix and suffix. The solid green arrow marks the start codon of the open reading frame. (B) Schematic diagrams of synthetic gene circuits constructed and characterized in this study. Self-activation circuits include non–phase-separating controls (OP152 and OP177) and phase-separating circuits incorporating intrinsically disordered regions (OP153 and OP203). (C) Colocalization circuits include CT149, which contains 12× lacO operator sites adjacent to the target promoter, and IC41, a matched control lacking lacO sites. All circuits are based on AraC-mediated positive feedback and are expressed in E. coli.
Article Snippet:
Techniques: Sequencing, Construct, Activation Assay, Control
Journal: JCI Insight
Article Title: Vancomycin eliminates gut deoxycholic acid, restoring ER proteostasis in ILC2s and relieving colitis
doi: 10.1172/jci.insight.197470
Figure Lengend Snippet: ( A – C ) Large intestinal ILC2s were sorted from WT mice and cultured in the presence of IL-2, IL-7, IL-25, and IL-33 for 5 days. ILC2s were treated with DCA (100 μM) at the indicated concentrations for 24 hours and then subjected to RNA-Seq. ( A ) Experimental strategy, ( B ) volcano plot, and ( C ) heatmap of ILC2-characteristic genes. ( D – F ) Sorted large intestinal ILC2s from Il5 RFP-Cre mice were treated with DCA (100 μM) for 24 hours. ( D ) Experimental strategy. ( E ) Representative flow cytometry plots. ( F ) Percentages of RFP + ILC2s (CD45.2 + Lin – GATA3 + ) in large intestine. n = 6 wells per group. The experiment was repeated 3 times. ( G – I ) Rabbit reticulocyte lysate system. ( G ) Experimental strategy. Protein levels of Areg, IL-5, and IL-13 were analyzed by ( H ) Western blotting and ( I ) cytometric bead array in samples treated or untreated with DCA. n = 6 wells per group. The experiment was repeated twice. Data are shown as mean ± SD. Statistical analysis was performed using unpaired 2-tailed t test. *** P < 0.001, **** P < 0.0001.
Article Snippet:
Techniques: Cell Culture, RNA Sequencing, Flow Cytometry, Western Blot
Journal: bioRxiv
Article Title: Meningeal neutrophil infiltration drives inflammation-exacerbated pediatric stroke through IL-36γ signaling
doi: 10.64898/2026.04.03.716365
Figure Lengend Snippet: a, Expression of neutrophil activation markers (ICAM1, iNOS, CD62L and CXCR2) in the ipsilateral hemisphere was assessed by flow cytometry at 24 h post-stroke in PT and LPS/PT groups (N = 7 per group). Data were presented as mean ± S.E.M. ****p < 0.0001 compared with the PT group by unpaired t-test. b-c, Mice were treated with a neutrophil-depleting anti-Ly6G antibody (clone 1A8) or an isotype control antibody beginning one day prior to stroke induction and continuing daily for three consecutive days (P15–P17). Brain sections (1mm sections) were collected 3 days post-stroke and stained with TTC. Infarct volumes were quantified in mm3. (N> 10 per group). *p < 0.05 by one-way ANOVA. d, CCR2–RFP knock-in mice, including homozygous CCR2-deficient (CCR2RFP/RFP) and heterozygous CCR2-sufficient (CCR2RFP/+) littermates, were subjected to PT or LPS/PT. Brain sections were harvested 3 days post-stroke and infarct volumes were quantified by TTC staining and expressed as a percentage of the contralateral hemisphere (N > 5 per group). ns, Not significant, p>0.05; **p < 0.01; ***p < 0.001 by one-way ANOVA.
Article Snippet: C57BL/6J,
Techniques: Expressing, Activation Assay, Flow Cytometry, Control, Staining, Knock-In