Review





Similar Products

99
ATCC cell lines hela cells atcc ccl 2 cos7 cells atcc n a hek293ft cells atcc n a ss rfp gfp kdel hela stable cells
Cell Lines Hela Cells Atcc Ccl 2 Cos7 Cells Atcc N A Hek293ft Cells Atcc N A Ss Rfp Gfp Kdel Hela Stable Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cell lines hela cells atcc ccl 2 cos7 cells atcc n a hek293ft cells atcc n a ss rfp gfp kdel hela stable cells/product/ATCC
Average 99 stars, based on 1 article reviews
cell lines hela cells atcc ccl 2 cos7 cells atcc n a hek293ft cells atcc n a ss rfp gfp kdel hela stable cells - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

96
Vector Biolabs ad-rfp
Ad Rfp, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ad-rfp/product/Vector Biolabs
Average 96 stars, based on 1 article reviews
ad-rfp - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

86
Surfix Inc bglii rfp rfc10 surfix
Design of gene circuits used in this protocol (A) DNA sequence of B0034-MCS1-pSB1A2 between <t>RFC10</t> prefix and suffix. The solid green arrow marks the start codon of the open reading frame. (B) Schematic diagrams of synthetic gene circuits constructed and characterized in this study. Self-activation circuits include non–phase-separating controls (OP152 and OP177) and phase-separating circuits incorporating intrinsically disordered regions (OP153 and OP203). (C) Colocalization circuits include CT149, which contains 12× lacO operator sites adjacent to the target promoter, and IC41, a matched control lacking lacO sites. All circuits are based on AraC-mediated positive feedback and are expressed in E. coli.
Bglii Rfp Rfc10 Surfix, supplied by Surfix Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bglii rfp rfc10 surfix/product/Surfix Inc
Average 86 stars, based on 1 article reviews
bglii rfp rfc10 surfix - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Sangon Biotech gttcgaactggtctaagttta sangon biotech n a shrna trim27
Design of gene circuits used in this protocol (A) DNA sequence of B0034-MCS1-pSB1A2 between <t>RFC10</t> prefix and suffix. The solid green arrow marks the start codon of the open reading frame. (B) Schematic diagrams of synthetic gene circuits constructed and characterized in this study. Self-activation circuits include non–phase-separating controls (OP152 and OP177) and phase-separating circuits incorporating intrinsically disordered regions (OP153 and OP203). (C) Colocalization circuits include CT149, which contains 12× lacO operator sites adjacent to the target promoter, and IC41, a matched control lacking lacO sites. All circuits are based on AraC-mediated positive feedback and are expressed in E. coli.
Gttcgaactggtctaagttta Sangon Biotech N A Shrna Trim27, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gttcgaactggtctaagttta sangon biotech n a shrna trim27/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
gttcgaactggtctaagttta sangon biotech n a shrna trim27 - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

97
TaKaRa a 6455 mouse monoclonal anti rfp takara
Design of gene circuits used in this protocol (A) DNA sequence of B0034-MCS1-pSB1A2 between <t>RFC10</t> prefix and suffix. The solid green arrow marks the start codon of the open reading frame. (B) Schematic diagrams of synthetic gene circuits constructed and characterized in this study. Self-activation circuits include non–phase-separating controls (OP152 and OP177) and phase-separating circuits incorporating intrinsically disordered regions (OP153 and OP203). (C) Colocalization circuits include CT149, which contains 12× lacO operator sites adjacent to the target promoter, and IC41, a matched control lacking lacO sites. All circuits are based on AraC-mediated positive feedback and are expressed in E. coli.
A 6455 Mouse Monoclonal Anti Rfp Takara, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/a 6455 mouse monoclonal anti rfp takara/product/TaKaRa
Average 97 stars, based on 1 article reviews
a 6455 mouse monoclonal anti rfp takara - by Bioz Stars, 2026-05
97/100 stars
  Buy from Supplier

97
TaKaRa mouse anti rfp
Design of gene circuits used in this protocol (A) DNA sequence of B0034-MCS1-pSB1A2 between <t>RFC10</t> prefix and suffix. The solid green arrow marks the start codon of the open reading frame. (B) Schematic diagrams of synthetic gene circuits constructed and characterized in this study. Self-activation circuits include non–phase-separating controls (OP152 and OP177) and phase-separating circuits incorporating intrinsically disordered regions (OP153 and OP203). (C) Colocalization circuits include CT149, which contains 12× lacO operator sites adjacent to the target promoter, and IC41, a matched control lacking lacO sites. All circuits are based on AraC-mediated positive feedback and are expressed in E. coli.
Mouse Anti Rfp, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse anti rfp/product/TaKaRa
Average 97 stars, based on 1 article reviews
mouse anti rfp - by Bioz Stars, 2026-05
97/100 stars
  Buy from Supplier

86
Ozgene Inc cell lines g5c luc rfp
Design of gene circuits used in this protocol (A) DNA sequence of B0034-MCS1-pSB1A2 between <t>RFC10</t> prefix and suffix. The solid green arrow marks the start codon of the open reading frame. (B) Schematic diagrams of synthetic gene circuits constructed and characterized in this study. Self-activation circuits include non–phase-separating controls (OP152 and OP177) and phase-separating circuits incorporating intrinsically disordered regions (OP153 and OP203). (C) Colocalization circuits include CT149, which contains 12× lacO operator sites adjacent to the target promoter, and IC41, a matched control lacking lacO sites. All circuits are based on AraC-mediated positive feedback and are expressed in E. coli.
Cell Lines G5c Luc Rfp, supplied by Ozgene Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cell lines g5c luc rfp/product/Ozgene Inc
Average 86 stars, based on 1 article reviews
cell lines g5c luc rfp - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Jackson Laboratory il5 rfp cre mice
( A – C ) Large intestinal ILC2s were sorted from WT mice and cultured in the presence of IL-2, IL-7, IL-25, and IL-33 for 5 days. ILC2s were treated with DCA (100 μM) at the indicated concentrations for 24 hours and then subjected to RNA-Seq. ( A ) Experimental strategy, ( B ) volcano plot, and ( C ) heatmap of ILC2-characteristic genes. ( D – F ) Sorted large intestinal ILC2s from <t>Il5</t> RFP-Cre mice were treated with DCA (100 μM) for 24 hours. ( D ) Experimental strategy. ( E ) Representative flow cytometry plots. ( F ) Percentages of RFP + ILC2s (CD45.2 + Lin – GATA3 + ) in large intestine. n = 6 wells per group. The experiment was repeated 3 times. ( G – I ) Rabbit reticulocyte lysate system. ( G ) Experimental strategy. Protein levels of Areg, IL-5, and IL-13 were analyzed by ( H ) Western blotting and ( I ) cytometric bead array in samples treated or untreated with DCA. n = 6 wells per group. The experiment was repeated twice. Data are shown as mean ± SD. Statistical analysis was performed using unpaired 2-tailed t test. *** P < 0.001, **** P < 0.0001.
Il5 Rfp Cre Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/il5 rfp cre mice/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
il5 rfp cre mice - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Jackson Laboratory ccr2 rfp rfp
a, Expression of neutrophil activation markers (ICAM1, iNOS, CD62L and CXCR2) in the ipsilateral hemisphere was assessed by flow cytometry at 24 h post-stroke in PT and LPS/PT groups (N = 7 per group). Data were presented as mean ± S.E.M. ****p < 0.0001 compared with the PT group by unpaired t-test. b-c, Mice were treated with a neutrophil-depleting anti-Ly6G antibody (clone 1A8) or an isotype control antibody beginning one day prior to stroke induction and continuing daily for three consecutive days (P15–P17). Brain sections (1mm sections) were collected 3 days post-stroke and stained with TTC. Infarct volumes were quantified in mm3. (N> 10 per group). *p < 0.05 by one-way ANOVA. d, <t>CCR2–RFP</t> knock-in mice, including homozygous CCR2-deficient (CCR2RFP/RFP) and heterozygous CCR2-sufficient (CCR2RFP/+) littermates, were subjected to PT or LPS/PT. Brain sections were harvested 3 days post-stroke and infarct volumes were quantified by TTC staining and expressed as a percentage of the contralateral hemisphere (N > 5 per group). ns, Not significant, p>0.05; **p < 0.01; ***p < 0.001 by one-way ANOVA.
Ccr2 Rfp Rfp, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ccr2 rfp rfp/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
ccr2 rfp rfp - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

95
Addgene inc lentivirus rfp
a, Expression of neutrophil activation markers (ICAM1, iNOS, CD62L and CXCR2) in the ipsilateral hemisphere was assessed by flow cytometry at 24 h post-stroke in PT and LPS/PT groups (N = 7 per group). Data were presented as mean ± S.E.M. ****p < 0.0001 compared with the PT group by unpaired t-test. b-c, Mice were treated with a neutrophil-depleting anti-Ly6G antibody (clone 1A8) or an isotype control antibody beginning one day prior to stroke induction and continuing daily for three consecutive days (P15–P17). Brain sections (1mm sections) were collected 3 days post-stroke and stained with TTC. Infarct volumes were quantified in mm3. (N> 10 per group). *p < 0.05 by one-way ANOVA. d, <t>CCR2–RFP</t> knock-in mice, including homozygous CCR2-deficient (CCR2RFP/RFP) and heterozygous CCR2-sufficient (CCR2RFP/+) littermates, were subjected to PT or LPS/PT. Brain sections were harvested 3 days post-stroke and infarct volumes were quantified by TTC staining and expressed as a percentage of the contralateral hemisphere (N > 5 per group). ns, Not significant, p>0.05; **p < 0.01; ***p < 0.001 by one-way ANOVA.
Lentivirus Rfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentivirus rfp/product/Addgene inc
Average 95 stars, based on 1 article reviews
lentivirus rfp - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

Image Search Results


Design of gene circuits used in this protocol (A) DNA sequence of B0034-MCS1-pSB1A2 between RFC10 prefix and suffix. The solid green arrow marks the start codon of the open reading frame. (B) Schematic diagrams of synthetic gene circuits constructed and characterized in this study. Self-activation circuits include non–phase-separating controls (OP152 and OP177) and phase-separating circuits incorporating intrinsically disordered regions (OP153 and OP203). (C) Colocalization circuits include CT149, which contains 12× lacO operator sites adjacent to the target promoter, and IC41, a matched control lacking lacO sites. All circuits are based on AraC-mediated positive feedback and are expressed in E. coli.

Journal: STAR Protocols

Article Title: Protocol for condensate-based stabilization of gene circuit dynamics under growth-mediated dilution in E. coli

doi: 10.1016/j.xpro.2026.104536

Figure Lengend Snippet: Design of gene circuits used in this protocol (A) DNA sequence of B0034-MCS1-pSB1A2 between RFC10 prefix and suffix. The solid green arrow marks the start codon of the open reading frame. (B) Schematic diagrams of synthetic gene circuits constructed and characterized in this study. Self-activation circuits include non–phase-separating controls (OP152 and OP177) and phase-separating circuits incorporating intrinsically disordered regions (OP153 and OP203). (C) Colocalization circuits include CT149, which contains 12× lacO operator sites adjacent to the target promoter, and IC41, a matched control lacking lacO sites. All circuits are based on AraC-mediated positive feedback and are expressed in E. coli.

Article Snippet: BglII-RFP- RFC10 surfix , E1010 , RFP-BglII-F , VR , 880 bp.

Techniques: Sequencing, Construct, Activation Assay, Control

( A – C ) Large intestinal ILC2s were sorted from WT mice and cultured in the presence of IL-2, IL-7, IL-25, and IL-33 for 5 days. ILC2s were treated with DCA (100 μM) at the indicated concentrations for 24 hours and then subjected to RNA-Seq. ( A ) Experimental strategy, ( B ) volcano plot, and ( C ) heatmap of ILC2-characteristic genes. ( D – F ) Sorted large intestinal ILC2s from Il5 RFP-Cre mice were treated with DCA (100 μM) for 24 hours. ( D ) Experimental strategy. ( E ) Representative flow cytometry plots. ( F ) Percentages of RFP + ILC2s (CD45.2 + Lin – GATA3 + ) in large intestine. n = 6 wells per group. The experiment was repeated 3 times. ( G – I ) Rabbit reticulocyte lysate system. ( G ) Experimental strategy. Protein levels of Areg, IL-5, and IL-13 were analyzed by ( H ) Western blotting and ( I ) cytometric bead array in samples treated or untreated with DCA. n = 6 wells per group. The experiment was repeated twice. Data are shown as mean ± SD. Statistical analysis was performed using unpaired 2-tailed t test. *** P < 0.001, **** P < 0.0001.

Journal: JCI Insight

Article Title: Vancomycin eliminates gut deoxycholic acid, restoring ER proteostasis in ILC2s and relieving colitis

doi: 10.1172/jci.insight.197470

Figure Lengend Snippet: ( A – C ) Large intestinal ILC2s were sorted from WT mice and cultured in the presence of IL-2, IL-7, IL-25, and IL-33 for 5 days. ILC2s were treated with DCA (100 μM) at the indicated concentrations for 24 hours and then subjected to RNA-Seq. ( A ) Experimental strategy, ( B ) volcano plot, and ( C ) heatmap of ILC2-characteristic genes. ( D – F ) Sorted large intestinal ILC2s from Il5 RFP-Cre mice were treated with DCA (100 μM) for 24 hours. ( D ) Experimental strategy. ( E ) Representative flow cytometry plots. ( F ) Percentages of RFP + ILC2s (CD45.2 + Lin – GATA3 + ) in large intestine. n = 6 wells per group. The experiment was repeated 3 times. ( G – I ) Rabbit reticulocyte lysate system. ( G ) Experimental strategy. Protein levels of Areg, IL-5, and IL-13 were analyzed by ( H ) Western blotting and ( I ) cytometric bead array in samples treated or untreated with DCA. n = 6 wells per group. The experiment was repeated twice. Data are shown as mean ± SD. Statistical analysis was performed using unpaired 2-tailed t test. *** P < 0.001, **** P < 0.0001.

Article Snippet: Il5 RFP-Cre mice (catalog R5/+) and CD45.1/CD45.1 mice (catalog 002014) were purchased from The Jackson Laboratory.

Techniques: Cell Culture, RNA Sequencing, Flow Cytometry, Western Blot

a, Expression of neutrophil activation markers (ICAM1, iNOS, CD62L and CXCR2) in the ipsilateral hemisphere was assessed by flow cytometry at 24 h post-stroke in PT and LPS/PT groups (N = 7 per group). Data were presented as mean ± S.E.M. ****p < 0.0001 compared with the PT group by unpaired t-test. b-c, Mice were treated with a neutrophil-depleting anti-Ly6G antibody (clone 1A8) or an isotype control antibody beginning one day prior to stroke induction and continuing daily for three consecutive days (P15–P17). Brain sections (1mm sections) were collected 3 days post-stroke and stained with TTC. Infarct volumes were quantified in mm3. (N> 10 per group). *p < 0.05 by one-way ANOVA. d, CCR2–RFP knock-in mice, including homozygous CCR2-deficient (CCR2RFP/RFP) and heterozygous CCR2-sufficient (CCR2RFP/+) littermates, were subjected to PT or LPS/PT. Brain sections were harvested 3 days post-stroke and infarct volumes were quantified by TTC staining and expressed as a percentage of the contralateral hemisphere (N > 5 per group). ns, Not significant, p>0.05; **p < 0.01; ***p < 0.001 by one-way ANOVA.

Journal: bioRxiv

Article Title: Meningeal neutrophil infiltration drives inflammation-exacerbated pediatric stroke through IL-36γ signaling

doi: 10.64898/2026.04.03.716365

Figure Lengend Snippet: a, Expression of neutrophil activation markers (ICAM1, iNOS, CD62L and CXCR2) in the ipsilateral hemisphere was assessed by flow cytometry at 24 h post-stroke in PT and LPS/PT groups (N = 7 per group). Data were presented as mean ± S.E.M. ****p < 0.0001 compared with the PT group by unpaired t-test. b-c, Mice were treated with a neutrophil-depleting anti-Ly6G antibody (clone 1A8) or an isotype control antibody beginning one day prior to stroke induction and continuing daily for three consecutive days (P15–P17). Brain sections (1mm sections) were collected 3 days post-stroke and stained with TTC. Infarct volumes were quantified in mm3. (N> 10 per group). *p < 0.05 by one-way ANOVA. d, CCR2–RFP knock-in mice, including homozygous CCR2-deficient (CCR2RFP/RFP) and heterozygous CCR2-sufficient (CCR2RFP/+) littermates, were subjected to PT or LPS/PT. Brain sections were harvested 3 days post-stroke and infarct volumes were quantified by TTC staining and expressed as a percentage of the contralateral hemisphere (N > 5 per group). ns, Not significant, p>0.05; **p < 0.01; ***p < 0.001 by one-way ANOVA.

Article Snippet: C57BL/6J, CCR2 RFP/RFP (JAX#017586), and GFAP-Cre (JAX#012886) mice were purchased from The Jackson Laboratory.

Techniques: Expressing, Activation Assay, Flow Cytometry, Control, Staining, Knock-In