Review





Similar Products

95
New England Biolabs anti reverse cap analog
Anti Reverse Cap Analog, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti reverse cap analog/product/New England Biolabs
Average 95 stars, based on 1 article reviews
anti reverse cap analog - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

99
Thermo Fisher reverse 3 5 beta 2 microglobuli n b2m gcgctactctctctttctgg gctggatgacgtgagtaaac ribosomal protein s18 s18 accaacatcgatgggcggcg tggtgatcacacgttccacctc
Reverse 3 5 Beta 2 Microglobuli N B2m Gcgctactctctctttctgg Gctggatgacgtgagtaaac Ribosomal Protein S18 S18 Accaacatcgatgggcggcg Tggtgatcacacgttccacctc, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse 3 5 beta 2 microglobuli n b2m gcgctactctctctttctgg gctggatgacgtgagtaaac ribosomal protein s18 s18 accaacatcgatgggcggcg tggtgatcacacgttccacctc/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
reverse 3 5 beta 2 microglobuli n b2m gcgctactctctctttctgg gctggatgacgtgagtaaac ribosomal protein s18 s18 accaacatcgatgggcggcg tggtgatcacacgttccacctc - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

96
TaKaRa 5 race with smartscribe tm reverse transcriptase kit
5 Race With Smartscribe Tm Reverse Transcriptase Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/5 race with smartscribe tm reverse transcriptase kit/product/TaKaRa
Average 96 stars, based on 1 article reviews
5 race with smartscribe tm reverse transcriptase kit - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

96
New England Biolabs 5×neb reverse transcription buffer
5×Neb Reverse Transcription Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/5×neb reverse transcription buffer/product/New England Biolabs
Average 96 stars, based on 1 article reviews
5×neb reverse transcription buffer - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

94
MACHEREY NAGEL phase hplc column
Phase Hplc Column, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phase hplc column/product/MACHEREY NAGEL
Average 94 stars, based on 1 article reviews
phase hplc column - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

96
YMC America phase ymc triart c18 0 5
Phase Ymc Triart C18 0 5, supplied by YMC America, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phase ymc triart c18 0 5/product/YMC America
Average 96 stars, based on 1 article reviews
phase ymc triart c18 0 5 - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

99
Qiagen dengue 5 4 3 1 reverse transcriptase polymerase chain reaction rt pcr total nucleic acid
Dengue 5 4 3 1 Reverse Transcriptase Polymerase Chain Reaction Rt Pcr Total Nucleic Acid, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dengue 5 4 3 1 reverse transcriptase polymerase chain reaction rt pcr total nucleic acid/product/Qiagen
Average 99 stars, based on 1 article reviews
dengue 5 4 3 1 reverse transcriptase polymerase chain reaction rt pcr total nucleic acid - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

90
Tornier Inc aequalis reverse shoulder prosthesis (tornier-wright, bloomington, usa) (5)
Aequalis Reverse Shoulder Prosthesis (Tornier Wright, Bloomington, Usa) (5), supplied by Tornier Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aequalis reverse shoulder prosthesis (tornier-wright, bloomington, usa) (5)/product/Tornier Inc
Average 90 stars, based on 1 article reviews
aequalis reverse shoulder prosthesis (tornier-wright, bloomington, usa) (5) - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Sangon Biotech reverse primer 5′- cgagccgatcagaccgatgt -3′
Reverse Primer 5′ Cgagccgatcagaccgatgt 3′, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse primer 5′- cgagccgatcagaccgatgt -3′/product/Sangon Biotech
Average 90 stars, based on 1 article reviews
reverse primer 5′- cgagccgatcagaccgatgt -3′ - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results