|
New England Biolabs
anti reverse cap analog Anti Reverse Cap Analog, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti reverse cap analog/product/New England Biolabs Average 95 stars, based on 1 article reviews
anti reverse cap analog - by Bioz Stars,
2026-05
95/100 stars
|
Buy from Supplier |
|
Thermo Fisher
reverse 3 5 beta 2 microglobuli n b2m gcgctactctctctttctgg gctggatgacgtgagtaaac ribosomal protein s18 s18 accaacatcgatgggcggcg tggtgatcacacgttccacctc Reverse 3 5 Beta 2 Microglobuli N B2m Gcgctactctctctttctgg Gctggatgacgtgagtaaac Ribosomal Protein S18 S18 Accaacatcgatgggcggcg Tggtgatcacacgttccacctc, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse 3 5 beta 2 microglobuli n b2m gcgctactctctctttctgg gctggatgacgtgagtaaac ribosomal protein s18 s18 accaacatcgatgggcggcg tggtgatcacacgttccacctc/product/Thermo Fisher Average 99 stars, based on 1 article reviews
reverse 3 5 beta 2 microglobuli n b2m gcgctactctctctttctgg gctggatgacgtgagtaaac ribosomal protein s18 s18 accaacatcgatgggcggcg tggtgatcacacgttccacctc - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
|
TaKaRa
5 race with smartscribe tm reverse transcriptase kit 5 Race With Smartscribe Tm Reverse Transcriptase Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5 race with smartscribe tm reverse transcriptase kit/product/TaKaRa Average 96 stars, based on 1 article reviews
5 race with smartscribe tm reverse transcriptase kit - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
|
New England Biolabs
5×neb reverse transcription buffer 5×Neb Reverse Transcription Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5×neb reverse transcription buffer/product/New England Biolabs Average 96 stars, based on 1 article reviews
5×neb reverse transcription buffer - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
|
MACHEREY NAGEL
phase hplc column Phase Hplc Column, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phase hplc column/product/MACHEREY NAGEL Average 94 stars, based on 1 article reviews
phase hplc column - by Bioz Stars,
2026-05
94/100 stars
|
Buy from Supplier |
|
YMC America
phase ymc triart c18 0 5 Phase Ymc Triart C18 0 5, supplied by YMC America, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phase ymc triart c18 0 5/product/YMC America Average 96 stars, based on 1 article reviews
phase ymc triart c18 0 5 - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
|
Qiagen
dengue 5 4 3 1 reverse transcriptase polymerase chain reaction rt pcr total nucleic acid Dengue 5 4 3 1 Reverse Transcriptase Polymerase Chain Reaction Rt Pcr Total Nucleic Acid, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dengue 5 4 3 1 reverse transcriptase polymerase chain reaction rt pcr total nucleic acid/product/Qiagen Average 99 stars, based on 1 article reviews
dengue 5 4 3 1 reverse transcriptase polymerase chain reaction rt pcr total nucleic acid - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
|
Tornier Inc
aequalis reverse shoulder prosthesis (tornier-wright, bloomington, usa) (5) Aequalis Reverse Shoulder Prosthesis (Tornier Wright, Bloomington, Usa) (5), supplied by Tornier Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aequalis reverse shoulder prosthesis (tornier-wright, bloomington, usa) (5)/product/Tornier Inc Average 90 stars, based on 1 article reviews
aequalis reverse shoulder prosthesis (tornier-wright, bloomington, usa) (5) - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Sangon Biotech
reverse primer 5′- cgagccgatcagaccgatgt -3′ Reverse Primer 5′ Cgagccgatcagaccgatgt 3′, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primer 5′- cgagccgatcagaccgatgt -3′/product/Sangon Biotech Average 90 stars, based on 1 article reviews
reverse primer 5′- cgagccgatcagaccgatgt -3′ - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |