Review





Similar Products

99
InvivoGen puromycin resistance sequence
Puromycin Resistance Sequence, supplied by InvivoGen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/puromycin+sequence/10__1158_slash_2767___9764__crc___25___0119-70-17-29?v=InvivoGen
Average 99 stars, based on 1 article reviews
puromycin resistance sequence - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

96
TaKaRa puromycin resistance gene sequences
Puromycin Resistance Gene Sequences, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/puromycin+sequence/pmc12450470-160-7-46?v=TaKaRa
Average 96 stars, based on 1 article reviews
puromycin resistance gene sequences - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

94
Addgene inc puromycin resistance gene 22 rd114a glycoprotein coding sequences
Puromycin Resistance Gene 22 Rd114a Glycoprotein Coding Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/puromycin+sequence/pm41481387-44-13-26?v=Addgene+inc
Average 94 stars, based on 1 article reviews
puromycin resistance gene 22 rd114a glycoprotein coding sequences - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

93
Addgene inc puromycin sequence
Puromycin Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/puromycin+sequence/pm41067888-237-29-31?v=Addgene+inc
Average 93 stars, based on 1 article reviews
puromycin sequence - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

96
TaKaRa sv40 early promotor puromycin resistance gene polyadenylation signal sequence
Sv40 Early Promotor Puromycin Resistance Gene Polyadenylation Signal Sequence, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/puromycin+sequence/bio_rxiv__2025__04__29__650889-160-28-40?v=TaKaRa
Average 96 stars, based on 1 article reviews
sv40 early promotor puromycin resistance gene polyadenylation signal sequence - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

90
Genechem gv112 (hu6-mcs-cmv-puromycin, sifzd5 sequence: cggcatcttcacgctgctcta
Gv112 (Hu6 Mcs Cmv Puromycin, Sifzd5 Sequence: Cggcatcttcacgctgctcta, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/puromycin+sequence/pm39834100-54-8-17?v=Genechem
Average 90 stars, based on 1 article reviews
gv112 (hu6-mcs-cmv-puromycin, sifzd5 sequence: cggcatcttcacgctgctcta - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Genechem element sequence hu6mcs-ubiquitin-egfp-ires-puromycin
Element Sequence Hu6mcs Ubiquitin Egfp Ires Puromycin, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/puromycin+sequence/pm39798771-124-11-12?v=Genechem
Average 90 stars, based on 1 article reviews
element sequence hu6mcs-ubiquitin-egfp-ires-puromycin - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH lentivirus: scrambled- and tβriii-targeted lentiviral shrna expression vectors with predesigned sequences including puromycin-resistant gene
Lentivirus: Scrambled And Tβriii Targeted Lentiviral Shrna Expression Vectors With Predesigned Sequences Including Puromycin Resistant Gene, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/puromycin+sequence/pm39481440-347-17-21?v=VectorBuilder+GmbH
Average 90 stars, based on 1 article reviews
lentivirus: scrambled- and tβriii-targeted lentiviral shrna expression vectors with predesigned sequences including puromycin-resistant gene - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

96
MedChemExpress sequence
Sequence, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/puromycin+sequence/pmc11515743-120-10-18?v=MedChemExpress
Average 96 stars, based on 1 article reviews
sequence - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

Image Search Results