|
InvivoGen
puromycin resistance sequence Puromycin Resistance Sequence, supplied by InvivoGen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/puromycin+sequence/10__1158_slash_2767___9764__crc___25___0119-70-17-29?v=InvivoGen Average 99 stars, based on 1 article reviews
puromycin resistance sequence - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
|
TaKaRa
puromycin resistance gene sequences Puromycin Resistance Gene Sequences, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/puromycin+sequence/pmc12450470-160-7-46?v=TaKaRa Average 96 stars, based on 1 article reviews
puromycin resistance gene sequences - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Addgene inc
puromycin resistance gene 22 rd114a glycoprotein coding sequences Puromycin Resistance Gene 22 Rd114a Glycoprotein Coding Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/puromycin+sequence/pm41481387-44-13-26?v=Addgene+inc Average 94 stars, based on 1 article reviews
puromycin resistance gene 22 rd114a glycoprotein coding sequences - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
Addgene inc
puromycin sequence Puromycin Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/puromycin+sequence/pm41067888-237-29-31?v=Addgene+inc Average 93 stars, based on 1 article reviews
puromycin sequence - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
TaKaRa
sv40 early promotor puromycin resistance gene polyadenylation signal sequence Sv40 Early Promotor Puromycin Resistance Gene Polyadenylation Signal Sequence, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/puromycin+sequence/bio_rxiv__2025__04__29__650889-160-28-40?v=TaKaRa Average 96 stars, based on 1 article reviews
sv40 early promotor puromycin resistance gene polyadenylation signal sequence - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Genechem
gv112 (hu6-mcs-cmv-puromycin, sifzd5 sequence: cggcatcttcacgctgctcta Gv112 (Hu6 Mcs Cmv Puromycin, Sifzd5 Sequence: Cggcatcttcacgctgctcta, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/puromycin+sequence/pm39834100-54-8-17?v=Genechem Average 90 stars, based on 1 article reviews
gv112 (hu6-mcs-cmv-puromycin, sifzd5 sequence: cggcatcttcacgctgctcta - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Genechem
element sequence hu6mcs-ubiquitin-egfp-ires-puromycin Element Sequence Hu6mcs Ubiquitin Egfp Ires Puromycin, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/puromycin+sequence/pm39798771-124-11-12?v=Genechem Average 90 stars, based on 1 article reviews
element sequence hu6mcs-ubiquitin-egfp-ires-puromycin - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
VectorBuilder GmbH
lentivirus: scrambled- and tβriii-targeted lentiviral shrna expression vectors with predesigned sequences including puromycin-resistant gene Lentivirus: Scrambled And Tβriii Targeted Lentiviral Shrna Expression Vectors With Predesigned Sequences Including Puromycin Resistant Gene, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/puromycin+sequence/pm39481440-347-17-21?v=VectorBuilder+GmbH Average 90 stars, based on 1 article reviews
lentivirus: scrambled- and tβriii-targeted lentiviral shrna expression vectors with predesigned sequences including puromycin-resistant gene - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
MedChemExpress
sequence Sequence, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/puromycin+sequence/pmc11515743-120-10-18?v=MedChemExpress Average 96 stars, based on 1 article reviews
sequence - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |