|
ATCC
primer premier 5 0 software Primer Premier 5 0 Software, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+s-30/Dulbecco's+PBS+w%2Fo+Ca+or+Mg/pm28334247-58-14-21 Average 95 stars, based on 1 article reviews
primer premier 5 0 software - by Bioz Stars,
2026-11
95/100 stars
|
Buy from Supplier |
|
Thermo Fisher
sense primer vhcc s-sr (9.14 mg/mmol) (50 cca tgg cac ata tga gca caa atc cta aac 30) Sense Primer Vhcc S Sr (9.14 Mg/Mmol) (50 Cca Tgg Cac Ata Tga Gca Caa Atc Cta Aac 30), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+s-30/Custom+Primer%2C+Special+Handling/pm23618172-44-22-60 Average 90 stars, based on 1 article reviews
sense primer vhcc s-sr (9.14 mg/mmol) (50 cca tgg cac ata tga gca caa atc cta aac 30) - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
Promega
primer s-30 Primer S 30, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+s-30/primer+s+30/pmc03866770-85-4-13 Average 90 stars, based on 1 article reviews
primer s-30 - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
Millipore
the forward primer alb-s (50-gctg tcatctcttgtgggctgt-30) The Forward Primer Alb S (50 Gctg Tcatctcttgtgggctgt 30), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+s-30/the+forward+primer+alb+s++50+gctg+tcatctcttgtgggctgt+30+/pm17657714-50-19-13 Average 90 stars, based on 1 article reviews
the forward primer alb-s (50-gctg tcatctcttgtgggctgt-30) - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
Promega
(1) s ize ense terminal primer: 50-caccattatcgtttcag-30 (1) S Ize Ense Terminal Primer: 50 Caccattatcgtttcag 30, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+s-30/+1++s+ize+ense+terminal+primer++50+caccattatcgtttcag+30/10__1097_slash_qad__0b013e3280118fb6-39-11-28 Average 90 stars, based on 1 article reviews
(1) s ize ense terminal primer: 50-caccattatcgtttcag-30 - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
New England Biolabs
50 actttattgtcatagtttagatctattttg 30 primer s 50 Actttattgtcatagtttagatctattttg 30 Primer S, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+s-30/pm15533824-107-17-20 Average 86 stars, based on 1 article reviews
50 actttattgtcatagtttagatctattttg 30 primer s - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
|
MJ Research
gapdh-specific primers (sense (s): 50- gtcgtattgggcgcctggtcac-30; anti-sense (as): 50-cacgacgtact cagcgccagca-30) Gapdh Specific Primers (Sense (S): 50 Gtcgtattgggcgcctggtcac 30; Anti Sense (As): 50 Cacgacgtact Cagcgccagca 30), supplied by MJ Research, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+s-30/gapdh+specific+primers++sense++s+++50++gtcgtattgggcgcctggtcac+30++anti+sense++as+++50+cacgacgtact+cagcgccagca+30+/pm14973505-55-16-27 Average 90 stars, based on 1 article reviews
gapdh-specific primers (sense (s): 50- gtcgtattgggcgcctggtcac-30; anti-sense (as): 50-cacgacgtact cagcgccagca-30) - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |