|
Sangon Biotech
tcccgtaaccctctagggaata sangon biotech n a primer pdk2 forward Tcccgtaaccctctagggaata Sangon Biotech N A Primer Pdk2 Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk2/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pm42054210-662-136-137 Average 86 stars, based on 1 article reviews
tcccgtaaccctctagggaata sangon biotech n a primer pdk2 forward - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
atgaaagagatcaacctgcttcc sangon biotech n a primer pdk2 reverse Atgaaagagatcaacctgcttcc Sangon Biotech N A Primer Pdk2 Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk2/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pm42054210-662-143-144 Average 86 stars, based on 1 article reviews
atgaaagagatcaacctgcttcc sangon biotech n a primer pdk2 reverse - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Servicebio Inc
antibody against pdk2 Antibody Against Pdk2, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk2/anti+pdk2/10__1016_slash_j__aquaculture__2026__743947-116-11-15 Average 86 stars, based on 1 article reviews
antibody against pdk2 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Proteintech
anti pdk2 Anti Pdk2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk2/PDK2+Antibody/pm41865618-47-0-12 Average 93 stars, based on 1 article reviews
anti pdk2 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp pdk2 rn00446679 m1 ![]() Gene Exp Pdk2 Rn00446679 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk2/Gene+Exp%2E+Pdk2%2C+Rn00446679_m1/bio_rxiv__64898__2026__03__16__710895-79-51-15 Average 85 stars, based on 1 article reviews
gene exp pdk2 rn00446679 m1 - by Bioz Stars,
2026-09
85/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp pdk2 hs04965351 m1 ![]() Gene Exp Pdk2 Hs04965351 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk2/Gene+Exp%2E+PDK2%2C+Hs04965351_m1/bio_rxiv__64898__2026__03__16__710895-79-49-15 Average 94 stars, based on 1 article reviews
gene exp pdk2 hs04965351 m1 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp pdk2 hs00176865 m1 ![]() Gene Exp Pdk2 Hs00176865 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk2/Gene+Exp%2E+PDK2%2C+Hs00176865_m1/bio_rxiv__64898__2026__02__17__706443-66-35-3 Average 94 stars, based on 1 article reviews
gene exp pdk2 hs00176865 m1 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Proteintech
pyruvate dehydrogenase kinase 2 pdk2 ![]() Pyruvate Dehydrogenase Kinase 2 Pdk2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk2/PDK2+Antibody/pmc12688951-81-24-60 Average 93 stars, based on 1 article reviews
pyruvate dehydrogenase kinase 2 pdk2 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
pdk2 ![]() Pdk2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk2/PDK2+Antibody/pmc12887202-10-0-3 Average 93 stars, based on 1 article reviews
pdk2 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
santa cruz sc ![]() Santa Cruz Sc, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk2/PDK2+Antibody/pmc12887202-10-3-3 Average 93 stars, based on 1 article reviews
santa cruz sc - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
Journal: bioRxiv
Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth
doi: 10.64898/2026.03.16.710895
Figure Lengend Snippet: A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.
Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (
Techniques: RNA Extraction, Western Blot, Marker
Journal: bioRxiv
Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth
doi: 10.64898/2026.03.16.710895
Figure Lengend Snippet: A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.
Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (
Techniques: RNA Extraction, Western Blot, Marker
Journal: bioRxiv
Article Title: A PERK-FOXO1 AXIS LINKS DNA DAMAGE TO FIBROBLAST SURVIVAL IN DIFFUSE CUTANEOUS SYSTEMIC SCLEROSIS
doi: 10.64898/2026.02.17.706443
Figure Lengend Snippet: A) Immunoblot analysis of senescence-associated signals p21 (normalized to ß-actin) upregulated in dcSSc FB than HC and post-ASCT (N: HC=5, dcSSc=8 and post-ASCT=6). B) After seeding equal numbers of cells, FB growth was quantified by cell counts, revealing a reduced growth rate in dcSSc FB compared with HC and post-ASCT. (N: HC=5, dcSSc=5 and post-ASCT=5, independent biological replicates). C) PDK1 and D) PDK2 mRNA levels are not different between HC and dcSSc FB as determined by qRT-PCR analysis.
Article Snippet: The Taqman probes (
Techniques: Western Blot, Quantitative RT-PCR
Journal: Annals of Medicine and Surgery
Article Title: Targeting aerobic glycolysis by quercetin inhibits acute monocytic leukemia SHI-1 cells
doi: 10.1097/MS9.0000000000004180
Figure Lengend Snippet: Influence of Que on the glycolysis and energy metabolism-related protein expression level by western blotting and RT-qPCR in SHI-1 cells (mean ± SD, n = 3) . (A) Que down-regulated the expression of c-Myc, GLUT1, HK2, PKM2, LDHA, and PDK2 proteins in SHI-1 cells. (B) The expression of AMPK, mTOR, and p-mTOR protein in SHI-1 cells was significantly reduced after the treatment of Que. (C) Que decreased mRNA expression of c-Myc, GLUT1, HK2, PKM2, LDHA, and PDK2 in SHI-1 cells (mean ± SD, n=3). * P < 0.5, ** P < 0.01 vs untreated control group.
Article Snippet: The membranes were incubated with primary antibodies, including c-Myc (1:1000), GLUT1 (1:2000), HK2 (1:1000), PKM2 (1:2000), LDHA (Hangzhou HuaAn Biotechnology Co., Ltd; 1:800 M1007-7),
Techniques: Expressing, Western Blot, Quantitative RT-PCR, Control
Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease
Article Title: PFKFB2 Is Pivotal for Metabolic Flexibility and Differential Glucose Utilization
doi: 10.1161/JAHA.125.043921
Figure Lengend Snippet: A , PDH enzyme activity was measured across groups in isolated cardiac mitochondria from fed and fasted, control and cKO hearts (n=7–9). B , Pyruvate and malate‐dependent mitochondrial respiration was measured as oxygen consumption in the ADP‐dependent state (state 3; n=7–9). C and D , Relative abundance of total PDH ( C ) and p‐PDH (serine 293; D ) were measured by western blot in the mitochondrial fraction of hearts (n=7–9). E , The ratio of p‐PDH (serine 293) to total PDH was taken. F , Representative western blots are shown for phosphorylated (serine 293) and total PDH. G , PDK4 abundance was measured by western blot in whole‐heart homogenate (n=7–9). H and I , PDK1 ( H ) and PDK2 ( I ) abundances were measured by western blot in whole heart homogenate (n=5–6). J , Palmitoylcarnitine and malate‐dependent respiration was measured in state 3 (n=7–9). K , The ratio of PC/Pyr‐dependent State 3 respiration was calculated using measures from ( B ) and ( J ) (n=7–9). A statistical outlier in PC and malate‐dependent respiration was detected in the fed control group via a robust outlier detection test with Q=1% and excluded in panels ( J ) and ( K ). L , CPT1 activity was measured in isolated mitochondria (n=5). Statistics were performed as 2‐way ANOVA. Individual comparisons were also performed between the fed and fasted states within genotype groups by unpaired Student t test. Data are shown as mean±SD. Not significant (ns) indicates P >0.05. * P ≤0.05, ** P ≤0.01, *** P ≤0.001. cKO indicates PFKFB2 knockout; CON, control; CPT1, carnitine palmitoyl transferase 1; PC, palmitoyl carnitine; PDH, pyruvate dehydrogenase; PDK, pyruvate dehydrogenase kinase; PFKFB2, phosphofructokinase‐2/fructose‐2,6‐bisphosphatase 2; p‐PDH, phosphorylated pyruvate dehydrogenase; Pyr, pyruvate; and Ser, serine.
Article Snippet:
Techniques: Activity Assay, Isolation, Control, Western Blot, Knock-Out