Review





Similar Products

86
Gene Tools Inc morpholino based ncor1 specific knockdown model
a) IHC-Alcian blue images showing NCoR1staining (brown colour) analysed in colon tissue biopsies sections of healthy individuals (n=5) and UC patients(n=5) (Scale bar= 100 µm). The inset shows zoomed-in areas of the image. Alcian blue (blue colour) represents colonic goblet cells and Nuclear fast red (red colour) represents nuclei. b) qRT-PCR analysis of relative fold expression of <t>NCoR1</t> gene in human UC patient colonic biopsies (n=20) relative to average control value (n=24). 18s was used for normalisation. c) Representative immunoblot of NCoR1 protein in human ulcerative colitis (UC) (n=11) and control (n=9) biopsy samples. GAPDH was used as a loading control. Graph on the right showing densitometric analysis of NCoR1 expression normalised to control GAPDH. Each dot represents (B, C) one human. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant. See also Fig S1 and Table S1.
Morpholino Based Ncor1 Specific Knockdown Model, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncor1+specific/bio_rxiv__64898__2026__05__02__722388-80-2-10?v=Gene+Tools+Inc
Average 86 stars, based on 1 article reviews
morpholino based ncor1 specific knockdown model - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

90
Shanghai GenePharma ncor1-specific small interfering rna
a) IHC-Alcian blue images showing NCoR1staining (brown colour) analysed in colon tissue biopsies sections of healthy individuals (n=5) and UC patients(n=5) (Scale bar= 100 µm). The inset shows zoomed-in areas of the image. Alcian blue (blue colour) represents colonic goblet cells and Nuclear fast red (red colour) represents nuclei. b) qRT-PCR analysis of relative fold expression of <t>NCoR1</t> gene in human UC patient colonic biopsies (n=20) relative to average control value (n=24). 18s was used for normalisation. c) Representative immunoblot of NCoR1 protein in human ulcerative colitis (UC) (n=11) and control (n=9) biopsy samples. GAPDH was used as a loading control. Graph on the right showing densitometric analysis of NCoR1 expression normalised to control GAPDH. Each dot represents (B, C) one human. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant. See also Fig S1 and Table S1.
Ncor1 Specific Small Interfering Rna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncor1+specific/pm38242347-33-0-7?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
ncor1-specific small interfering rna - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

95
Danaher Inc ncor1 specific crrnas
(a) Flow cytometry analysis of splenocytes isolated from WT and <t>NCOR1-cKO</t> mice showing CD44 and CD62L expression in CD4 + FOXP3 + cells at steady-state. (b) Diagram showing percentage of CD44 hi CD62L − and CD44 lo CD62 + cells of all mice analyzed as described in (a). (c) Diagrams show total cell numbers of CD44 hi CD62L − and CD44 lo CD62 + cells of all mice analyzed as described in (a). (d) Experimental immunization strategy: mice were s.c. injected with NP-KLH and draining LNs were analyzed six days later. (e) Flow cytometry analysis of cells isolated from draining LN of NP-KLH-immunized WT and NCOR1-cKO mice showing the expression of PD-1, CXCR5 and FOXP3 on CD4 + CD44 hi cells. (f) Diagram showing percentage of Tfh cells (CD4 + CD44 hi PD1 + CXCR5 + ) and Tfr cells (CD4 + CD44 hi PD1 + CXCR5 + FOXP3 + ) of all mice analyzed as shown in (d,e). (g) Diagrams show total cell numbers of Tfh cells (CD4 + CD44 hi PD1 + CXCR5 + ) and Tfr cells (CD4 + CD44 hi PD1 + CXCR5 + FOXP3 + ) of all mice analyzed as shown in (d,e). (a,e) Numbers indicate the percentages of cells in the respective quadrants or gates. (a-c) Cells were pre-gated on CD4 and FOXP3. (b,c,f,g) Each symbol indicates one mouse. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 (unpaired 2-tailed Student’s t test). Data are representative (a,e) or show the summary (b,c,f,g) of at least 11 (b) or 12 (e) mice that were analyzed in at least 3 independent experiments.
Ncor1 Specific Crrnas, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncor1+specific/bio_rxiv__2022__03__24__485609-249-8-37?v=Danaher+Inc
Average 95 stars, based on 1 article reviews
ncor1 specific crrnas - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

93
Bethyl ncor1 specific
(A) Hepatic triglyceride and cholesterol levels were measured in the 1 st cohort mice 12th weeks after tamoxifen treatment. Images of control and UBC-SKO mice the livers are shown. (B) The mRNA expression of lipogenic and gluconeogenic-related genes in the liver, PGWAT, and muscle (1 st cohort of mice) (C) mRNA expression of <t>NCoR1</t> in the liver, skeletal muscle, and PGWAT were quantified by qPCR. Protein expression of NCoR1 in the liver and heart were assessed by Western blot, using a NCoR1 specific antibody (n = 3–4 animals per group). Control samples are indicated by gray lanes and UBC-SKO mice are indicated by black lanes. For panel A and all qPCR analyses in panels B, and C, the data were analyzed using an unpaired t-test. These results are shown as the mean±SEM, and the p-values as; ****, p< 0.001; ***, p< 0.001; **, p< 0.01; *, p< 0.05 (1 st cohort of mice, n = 6–7 mice/group).
Ncor1 Specific, supplied by Bethyl, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncor1+specific/pmc06690520-45-19-25?v=Bethyl
Average 93 stars, based on 1 article reviews
ncor1 specific - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
Shanghai GenePharma sirnas against ncor1 or ck2α as well as a non-specific sirna
(A) Hepatic triglyceride and cholesterol levels were measured in the 1 st cohort mice 12th weeks after tamoxifen treatment. Images of control and UBC-SKO mice the livers are shown. (B) The mRNA expression of lipogenic and gluconeogenic-related genes in the liver, PGWAT, and muscle (1 st cohort of mice) (C) mRNA expression of <t>NCoR1</t> in the liver, skeletal muscle, and PGWAT were quantified by qPCR. Protein expression of NCoR1 in the liver and heart were assessed by Western blot, using a NCoR1 specific antibody (n = 3–4 animals per group). Control samples are indicated by gray lanes and UBC-SKO mice are indicated by black lanes. For panel A and all qPCR analyses in panels B, and C, the data were analyzed using an unpaired t-test. These results are shown as the mean±SEM, and the p-values as; ****, p< 0.001; ***, p< 0.001; **, p< 0.01; *, p< 0.05 (1 st cohort of mice, n = 6–7 mice/group).
Sirnas Against Ncor1 Or Ck2α As Well As A Non Specific Sirna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncor1+specific/10__1091_slash_mbc__e11___11___0947-234-10-15?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
sirnas against ncor1 or ck2α as well as a non-specific sirna - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


a) IHC-Alcian blue images showing NCoR1staining (brown colour) analysed in colon tissue biopsies sections of healthy individuals (n=5) and UC patients(n=5) (Scale bar= 100 µm). The inset shows zoomed-in areas of the image. Alcian blue (blue colour) represents colonic goblet cells and Nuclear fast red (red colour) represents nuclei. b) qRT-PCR analysis of relative fold expression of NCoR1 gene in human UC patient colonic biopsies (n=20) relative to average control value (n=24). 18s was used for normalisation. c) Representative immunoblot of NCoR1 protein in human ulcerative colitis (UC) (n=11) and control (n=9) biopsy samples. GAPDH was used as a loading control. Graph on the right showing densitometric analysis of NCoR1 expression normalised to control GAPDH. Each dot represents (B, C) one human. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant. See also Fig S1 and Table S1.

Journal: bioRxiv

Article Title: Corepressor NCoR1-mediated regulation of mucin dynamics governs gut inflammation

doi: 10.64898/2026.05.02.722388

Figure Lengend Snippet: a) IHC-Alcian blue images showing NCoR1staining (brown colour) analysed in colon tissue biopsies sections of healthy individuals (n=5) and UC patients(n=5) (Scale bar= 100 µm). The inset shows zoomed-in areas of the image. Alcian blue (blue colour) represents colonic goblet cells and Nuclear fast red (red colour) represents nuclei. b) qRT-PCR analysis of relative fold expression of NCoR1 gene in human UC patient colonic biopsies (n=20) relative to average control value (n=24). 18s was used for normalisation. c) Representative immunoblot of NCoR1 protein in human ulcerative colitis (UC) (n=11) and control (n=9) biopsy samples. GAPDH was used as a loading control. Graph on the right showing densitometric analysis of NCoR1 expression normalised to control GAPDH. Each dot represents (B, C) one human. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant. See also Fig S1 and Table S1.

Article Snippet: A customised, morpholino based NCoR1 specific knockdown model was developed (Gene Tools LLC, USA).

Techniques: Quantitative RT-PCR, Expressing, Control, Western Blot

a) Schematic representation of the experimental plan for DSS dynamics in C57Bl/6 mice. Point of DSS administration indicated by red arrows (Created with BioRender.com ). b) Graph shows percent body weight change in Control, DSS3, DSS5 and DSS7mice groups. c) Gross morphology of colon and caeca of respective mice groups. The graph on the right shows colon length quantification. d) Immunoblot of NCoR1 protein in whole tissue lysate of DSS dynamics Control, DSS3, DSS5 and DSS7 mice. The graph on the right represents densitometric analysis showing fold intensity of NCoR1 expression calculated by normalising to loading control (GAPDH). e) Immunoblot of NCoR1 protein in crypt lysate Control, DSS1, DSS3 and DSS5. The graph on the right represents densitometric analysis showing fold intensity of NCoR1 expression calculated by normalising to loading control (Actin). f) Representative immunohistochemistry images of colon from control, DSS3,DSS5 and DSS7 mice stained for NCoR1 (n=3 per group) using anti-NCoR1 antibody. (scale bar=100um) .Zoom in images are shown in the inset. Each dot represents (c, d, e) one mouse. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant. See also Fig S2, Fig S3

Journal: bioRxiv

Article Title: Corepressor NCoR1-mediated regulation of mucin dynamics governs gut inflammation

doi: 10.64898/2026.05.02.722388

Figure Lengend Snippet: a) Schematic representation of the experimental plan for DSS dynamics in C57Bl/6 mice. Point of DSS administration indicated by red arrows (Created with BioRender.com ). b) Graph shows percent body weight change in Control, DSS3, DSS5 and DSS7mice groups. c) Gross morphology of colon and caeca of respective mice groups. The graph on the right shows colon length quantification. d) Immunoblot of NCoR1 protein in whole tissue lysate of DSS dynamics Control, DSS3, DSS5 and DSS7 mice. The graph on the right represents densitometric analysis showing fold intensity of NCoR1 expression calculated by normalising to loading control (GAPDH). e) Immunoblot of NCoR1 protein in crypt lysate Control, DSS1, DSS3 and DSS5. The graph on the right represents densitometric analysis showing fold intensity of NCoR1 expression calculated by normalising to loading control (Actin). f) Representative immunohistochemistry images of colon from control, DSS3,DSS5 and DSS7 mice stained for NCoR1 (n=3 per group) using anti-NCoR1 antibody. (scale bar=100um) .Zoom in images are shown in the inset. Each dot represents (c, d, e) one mouse. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant. See also Fig S2, Fig S3

Article Snippet: A customised, morpholino based NCoR1 specific knockdown model was developed (Gene Tools LLC, USA).

Techniques: Control, Western Blot, Expressing, Immunohistochemistry, Staining

a) Schematic representation of the experimental plan for chronic colitis in IL10 -/- mice using alternate DSS treatment (Point of administration indicated by red arrows) of 0.5% DSS in drinking water treatment for 12 weeks. (Created with BioRender.com ) b) Graph showing the difference in body weight of control and IL10 -/ mice. c) Gross morphology of colon and caeca of control and IL10 -/- mice. The graph on the right shows colon length quantification. d) Representative immunoblot of NCoR1 protein in whole tissue lysate of Control and IL10 -/- mice. Graph represents densitometric analysis showing the intensity of NCoR1 expression calculated by normalizing to loading control (GAPDH). Each dot represents (b, c and d) individual mice. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant. e) Haematoxylin Eosin staining in the distal colon tissue sections of control and IL10 -/- mice (n=3 per group) (scale bar= 50um).

Journal: bioRxiv

Article Title: Corepressor NCoR1-mediated regulation of mucin dynamics governs gut inflammation

doi: 10.64898/2026.05.02.722388

Figure Lengend Snippet: a) Schematic representation of the experimental plan for chronic colitis in IL10 -/- mice using alternate DSS treatment (Point of administration indicated by red arrows) of 0.5% DSS in drinking water treatment for 12 weeks. (Created with BioRender.com ) b) Graph showing the difference in body weight of control and IL10 -/ mice. c) Gross morphology of colon and caeca of control and IL10 -/- mice. The graph on the right shows colon length quantification. d) Representative immunoblot of NCoR1 protein in whole tissue lysate of Control and IL10 -/- mice. Graph represents densitometric analysis showing the intensity of NCoR1 expression calculated by normalizing to loading control (GAPDH). Each dot represents (b, c and d) individual mice. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant. e) Haematoxylin Eosin staining in the distal colon tissue sections of control and IL10 -/- mice (n=3 per group) (scale bar= 50um).

Article Snippet: A customised, morpholino based NCoR1 specific knockdown model was developed (Gene Tools LLC, USA).

Techniques: Control, Western Blot, Expressing, Staining

a) Schematic representation of the experimental plan for galactose-mediated HT29 pluripotent cells into goblet cells differentiation.(Created with BioRender.com ). b) Brightfield images showing goblet cell morphology in HT29 Undiff and HT29 Diff cells (Scale bar =50um). c) qRT -PCR analysis of relative fold expression of LGR5, MUC2 and MUC5AC genes in HT29 Diff cells with respect to HT29 undiff cells as control. HPRT was used for normalisation. Experiment performed in triplicate. d) Immunoblotting of NCoR1 and CLCA1 in HT29 Undiff and HT29 Diff cells. The graph on right represents densitometric analysis showing fold intensity of NCoR1 and CLCA1 expression calculated by normalising to loading control (GAPDH) e) Brightfield images showing goblet cell morphology in HT29 undiff-C , HT29 Undiff-kd , HT29 Diff-C and HT29 Diff-kd cells. Superscript C represents nontargeted knockdown control and superscript kd represents NCoR1 stable knockdown. Scale bar =50um. f) Representative Confocal images of NCoR1 (red) using anti-NCoR1 antibody and MUC2 (green) using anti-MUC2 antibody in HT29 undiff-C , HT29 Undiff-kd , HT29 Diff-C and HT29 Diff-kd cells (n=90) (scale bar=2 um). Graphs on the right shows NCoR1 and MUC2 fluorescence intensity measured. Each dot represents (d) individual experiment. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant. See also Fig S4

Journal: bioRxiv

Article Title: Corepressor NCoR1-mediated regulation of mucin dynamics governs gut inflammation

doi: 10.64898/2026.05.02.722388

Figure Lengend Snippet: a) Schematic representation of the experimental plan for galactose-mediated HT29 pluripotent cells into goblet cells differentiation.(Created with BioRender.com ). b) Brightfield images showing goblet cell morphology in HT29 Undiff and HT29 Diff cells (Scale bar =50um). c) qRT -PCR analysis of relative fold expression of LGR5, MUC2 and MUC5AC genes in HT29 Diff cells with respect to HT29 undiff cells as control. HPRT was used for normalisation. Experiment performed in triplicate. d) Immunoblotting of NCoR1 and CLCA1 in HT29 Undiff and HT29 Diff cells. The graph on right represents densitometric analysis showing fold intensity of NCoR1 and CLCA1 expression calculated by normalising to loading control (GAPDH) e) Brightfield images showing goblet cell morphology in HT29 undiff-C , HT29 Undiff-kd , HT29 Diff-C and HT29 Diff-kd cells. Superscript C represents nontargeted knockdown control and superscript kd represents NCoR1 stable knockdown. Scale bar =50um. f) Representative Confocal images of NCoR1 (red) using anti-NCoR1 antibody and MUC2 (green) using anti-MUC2 antibody in HT29 undiff-C , HT29 Undiff-kd , HT29 Diff-C and HT29 Diff-kd cells (n=90) (scale bar=2 um). Graphs on the right shows NCoR1 and MUC2 fluorescence intensity measured. Each dot represents (d) individual experiment. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant. See also Fig S4

Article Snippet: A customised, morpholino based NCoR1 specific knockdown model was developed (Gene Tools LLC, USA).

Techniques: Quantitative RT-PCR, Expressing, Control, Western Blot, Knockdown, Fluorescence

a) qRT-PCR analysis of relative fold expression of NCoR1 genes in HT29 Diff cells, with respect to control HT29 undiff cells. HPRT was used for normalization. b) Confocal imaging of MUC2 (green) stained using anti-MUC2 and NCoR1 (red) stained using anti-NCoR1 antibodies in HT29 MTX NCoR1kd andHT29 MTX scr . (scale bar=3um). Graphs on the right show MUC2 fluorescence intensity measured. c) Immunoblot of NCoR1expression in J774, HT29 Undiff ,HT29 Diff , HCT8 and HT29-MTX cell lines. Graph represents NCoR1 expression calculated by normalizing to loading control (Actin) in respective cell line. Each dot represents (a,b and c) individual experiment. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant.

Journal: bioRxiv

Article Title: Corepressor NCoR1-mediated regulation of mucin dynamics governs gut inflammation

doi: 10.64898/2026.05.02.722388

Figure Lengend Snippet: a) qRT-PCR analysis of relative fold expression of NCoR1 genes in HT29 Diff cells, with respect to control HT29 undiff cells. HPRT was used for normalization. b) Confocal imaging of MUC2 (green) stained using anti-MUC2 and NCoR1 (red) stained using anti-NCoR1 antibodies in HT29 MTX NCoR1kd andHT29 MTX scr . (scale bar=3um). Graphs on the right show MUC2 fluorescence intensity measured. c) Immunoblot of NCoR1expression in J774, HT29 Undiff ,HT29 Diff , HCT8 and HT29-MTX cell lines. Graph represents NCoR1 expression calculated by normalizing to loading control (Actin) in respective cell line. Each dot represents (a,b and c) individual experiment. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant.

Article Snippet: A customised, morpholino based NCoR1 specific knockdown model was developed (Gene Tools LLC, USA).

Techniques: Quantitative RT-PCR, Expressing, Control, Imaging, Staining, Fluorescence, Western Blot

a) Schematic representation of the experimental plan for knockdown of NCoR1 in C57Bl/6 mice using vivo-morpholino w/c or w/o 2% DSS in drinking water. Point of administration of DSS (Red) control morpholino (blue) and NCoR1 Morpholino(green) is indicated by respective arrows. Morpholino(s) were administered via intraperitoneal injection on the mentioned point of administration (Created with BioRender.com ). b) Graph shows percentage body weight change in the mice groups Ctrl, DSS, Ctrl NCoR1kd and DSS NCoR1kd . c) Gross morphology of colon and caeca of indicated mice group. Graph on the right shows colon length quantification. d) Gross morphology of spleen of indicated mice group. Graph on the right shows spleen to body weight ratio. e) qRT-PCR analysis of relative fold expression of NCoR1 and MUC2 genes in DSS, Ctrl NCoR1kd and DSS NCoR1kd relative to average control values of Ctrl in colon tissues. GAPDH was used for normalisation. f) qRT-PCR analysis of relative fold expression of NCoR1 gene in DSS, Ctrl NCoR1kd and DSS NCoR1kd relative to average values of Ctrl in spleen tissues. GAPDH was used for normalisation g) Representative alcian blue staining in colon tissue sections of Ctrl, DSS, Ctrl NCoR1kd and DSS NCoR1kd mice (n=4 per group) (scale bar=50um). Zoom in images are shown in the inset of the indicated area. h) graph showing goblet cell count in the crypts of Ctrl, DSS, Ctrl NCoR1kd and DSS NCoR1kd mice colon (n=120). Each dot represents (c,d,e,f) one mouse. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant.

Journal: bioRxiv

Article Title: Corepressor NCoR1-mediated regulation of mucin dynamics governs gut inflammation

doi: 10.64898/2026.05.02.722388

Figure Lengend Snippet: a) Schematic representation of the experimental plan for knockdown of NCoR1 in C57Bl/6 mice using vivo-morpholino w/c or w/o 2% DSS in drinking water. Point of administration of DSS (Red) control morpholino (blue) and NCoR1 Morpholino(green) is indicated by respective arrows. Morpholino(s) were administered via intraperitoneal injection on the mentioned point of administration (Created with BioRender.com ). b) Graph shows percentage body weight change in the mice groups Ctrl, DSS, Ctrl NCoR1kd and DSS NCoR1kd . c) Gross morphology of colon and caeca of indicated mice group. Graph on the right shows colon length quantification. d) Gross morphology of spleen of indicated mice group. Graph on the right shows spleen to body weight ratio. e) qRT-PCR analysis of relative fold expression of NCoR1 and MUC2 genes in DSS, Ctrl NCoR1kd and DSS NCoR1kd relative to average control values of Ctrl in colon tissues. GAPDH was used for normalisation. f) qRT-PCR analysis of relative fold expression of NCoR1 gene in DSS, Ctrl NCoR1kd and DSS NCoR1kd relative to average values of Ctrl in spleen tissues. GAPDH was used for normalisation g) Representative alcian blue staining in colon tissue sections of Ctrl, DSS, Ctrl NCoR1kd and DSS NCoR1kd mice (n=4 per group) (scale bar=50um). Zoom in images are shown in the inset of the indicated area. h) graph showing goblet cell count in the crypts of Ctrl, DSS, Ctrl NCoR1kd and DSS NCoR1kd mice colon (n=120). Each dot represents (c,d,e,f) one mouse. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant.

Article Snippet: A customised, morpholino based NCoR1 specific knockdown model was developed (Gene Tools LLC, USA).

Techniques: Knockdown, Control, Injection, Quantitative RT-PCR, Expressing, Staining, Cell Characterization

a) Immunoblotting of NCoR1 in HT29 MTX cells upon vitamin D treatment at a concentration of 25uM for 24 hours. The graph on right represents densitometric analysis showing fold intensity of NCoR1 expression calculated by normalising to loading control (Actin) b) Immunoblotting of NCoR1 in HT29 MTX cells upon Tricostatin A treatment at a concentration of 5uM for 24 hours. The graph on right represents densitometric analysis showing fold intensity of NCoR1 expression calculated by normalising to loading control (Actin) c) Graph showing spleen to body weight ratio in Ctrl, DSS, Ctrl VD or DSS VD mice. Each dot represents (a and b) individual experiment and (c) individual mice. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant.

Journal: bioRxiv

Article Title: Corepressor NCoR1-mediated regulation of mucin dynamics governs gut inflammation

doi: 10.64898/2026.05.02.722388

Figure Lengend Snippet: a) Immunoblotting of NCoR1 in HT29 MTX cells upon vitamin D treatment at a concentration of 25uM for 24 hours. The graph on right represents densitometric analysis showing fold intensity of NCoR1 expression calculated by normalising to loading control (Actin) b) Immunoblotting of NCoR1 in HT29 MTX cells upon Tricostatin A treatment at a concentration of 5uM for 24 hours. The graph on right represents densitometric analysis showing fold intensity of NCoR1 expression calculated by normalising to loading control (Actin) c) Graph showing spleen to body weight ratio in Ctrl, DSS, Ctrl VD or DSS VD mice. Each dot represents (a and b) individual experiment and (c) individual mice. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant.

Article Snippet: A customised, morpholino based NCoR1 specific knockdown model was developed (Gene Tools LLC, USA).

Techniques: Western Blot, Concentration Assay, Expressing, Control

a) Schematic representation of the experimental plan for vitamin D-mediated overexpression of NCoR1 in C57Bl/6 mice w/c or w/o 2% DSS in drinking water. Vitamin D was mixed in feed at a dosage of 3000 IU/kg/day with 1% CaCl 2 throughout experiment. Duration of administration of DSS (red), and vitamin D (green triangle) are indicated by respective arrows (Created with BioRender.com ) b) Graph showing the percentage body weight change in Ctrl, DSS, Ctrl VD and DSS VD mice groups. c) Gross morphology of colon and caeca of Ctrl, DSS, Ctrl VD and DSS VD mice. Graph on the right showing colon length quantification. d) Immunoblot of NCoR1 protein in whole tissue lysate of Ctrl, DSS, Ctrl VD and DSS VD mice. The graph on the right represents densitometric analysis showing fold intensity of NCoR1 expression calculated by normalising to loading control (Tubulin) e) Immunoblot of NCoR1 protein in crypt lysate of Ctrl, DSS, Ctrl VD and DSS VD mice. The graph on the right represents densitometric analysis showing fold intensity of NCoR1 expression calculated by normalising to loading control (Tubulin). f) Representative immunohistochemistry (IHC-Alcian blue) images of colon from Ctrl, DSS, Ctrl VD and DSS VD mice stained for NCoR1 (n=4 per group) (scale bar=100um). g) Graph showing goblet cell count in the crypts of Ctrl, DSS, Ctrl VD and DSS VD mice (n=120 crypts per group). Each dot represents (c,d,e) one mouse. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant. See also fig S5a and fig S5c.

Journal: bioRxiv

Article Title: Corepressor NCoR1-mediated regulation of mucin dynamics governs gut inflammation

doi: 10.64898/2026.05.02.722388

Figure Lengend Snippet: a) Schematic representation of the experimental plan for vitamin D-mediated overexpression of NCoR1 in C57Bl/6 mice w/c or w/o 2% DSS in drinking water. Vitamin D was mixed in feed at a dosage of 3000 IU/kg/day with 1% CaCl 2 throughout experiment. Duration of administration of DSS (red), and vitamin D (green triangle) are indicated by respective arrows (Created with BioRender.com ) b) Graph showing the percentage body weight change in Ctrl, DSS, Ctrl VD and DSS VD mice groups. c) Gross morphology of colon and caeca of Ctrl, DSS, Ctrl VD and DSS VD mice. Graph on the right showing colon length quantification. d) Immunoblot of NCoR1 protein in whole tissue lysate of Ctrl, DSS, Ctrl VD and DSS VD mice. The graph on the right represents densitometric analysis showing fold intensity of NCoR1 expression calculated by normalising to loading control (Tubulin) e) Immunoblot of NCoR1 protein in crypt lysate of Ctrl, DSS, Ctrl VD and DSS VD mice. The graph on the right represents densitometric analysis showing fold intensity of NCoR1 expression calculated by normalising to loading control (Tubulin). f) Representative immunohistochemistry (IHC-Alcian blue) images of colon from Ctrl, DSS, Ctrl VD and DSS VD mice stained for NCoR1 (n=4 per group) (scale bar=100um). g) Graph showing goblet cell count in the crypts of Ctrl, DSS, Ctrl VD and DSS VD mice (n=120 crypts per group). Each dot represents (c,d,e) one mouse. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant. See also fig S5a and fig S5c.

Article Snippet: A customised, morpholino based NCoR1 specific knockdown model was developed (Gene Tools LLC, USA).

Techniques: Over Expression, Western Blot, Expressing, Control, Immunohistochemistry, Staining, Cell Characterization

a) Volcano plot of DEGs representing NCoR1 targets. The pink dots represent genes differentially expressed (adjusted P<0.05) in Tricostatin A-treated and control HT29 MTX cells. The symbol-marked dots indicate the genes with the largest negative or positive standardized mean difference. b) Heat map of genes regulated by NCoR1 in Tricostatin A-treated and control HT29 MTX cells represented in colour contrast. Expression of targets is depicted in the gradient of blue to red, indicating lowest to highest expression, respectively. c) Graph showing chromatin immunoprecipitation of KLF16 binding via chromatin pulled by IgG, H3 and NCoR1 antibodies in Tricostain A-treated and control HT29 MTX cells. Quantification done using the fold-over IgG method. d) Immunoblot of NCoR1 and KLF16 in HT29 MTX cells upon transient overexpression of NCoR1(NCoR1 CTL and NCoR1 Up ). The graph on the right represents densitometric analysis showing fold intensity of NCoR1 and KLF16 expression calculated by normalising to loading control (Actin). e) Immunoblot of NCoR1 and KLF16 in HT29 MTX cells upon transient knockdown of NCoR1(siCTL and NCoR1 KD ). The graph on the right represents densitometric analysis showing fold intensity of NCoR1 and KLF16 expression calculated by normalising to loading control (Actin). f) Representative confocal imaging of NCoR1 (blue) stained using anti- NCoR1 antibody and KLF16 (green) stained using anti-KLF16 antibody in HT29 MTX scr and HT29 MTX NCoR1kd cells scale bar=3um. Graphs on the right show fluorescence intensity of NCoR1 and KLF16 measured (n=60). Each dot represents an individual experiment (c, d, and e). All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant.

Journal: bioRxiv

Article Title: Corepressor NCoR1-mediated regulation of mucin dynamics governs gut inflammation

doi: 10.64898/2026.05.02.722388

Figure Lengend Snippet: a) Volcano plot of DEGs representing NCoR1 targets. The pink dots represent genes differentially expressed (adjusted P<0.05) in Tricostatin A-treated and control HT29 MTX cells. The symbol-marked dots indicate the genes with the largest negative or positive standardized mean difference. b) Heat map of genes regulated by NCoR1 in Tricostatin A-treated and control HT29 MTX cells represented in colour contrast. Expression of targets is depicted in the gradient of blue to red, indicating lowest to highest expression, respectively. c) Graph showing chromatin immunoprecipitation of KLF16 binding via chromatin pulled by IgG, H3 and NCoR1 antibodies in Tricostain A-treated and control HT29 MTX cells. Quantification done using the fold-over IgG method. d) Immunoblot of NCoR1 and KLF16 in HT29 MTX cells upon transient overexpression of NCoR1(NCoR1 CTL and NCoR1 Up ). The graph on the right represents densitometric analysis showing fold intensity of NCoR1 and KLF16 expression calculated by normalising to loading control (Actin). e) Immunoblot of NCoR1 and KLF16 in HT29 MTX cells upon transient knockdown of NCoR1(siCTL and NCoR1 KD ). The graph on the right represents densitometric analysis showing fold intensity of NCoR1 and KLF16 expression calculated by normalising to loading control (Actin). f) Representative confocal imaging of NCoR1 (blue) stained using anti- NCoR1 antibody and KLF16 (green) stained using anti-KLF16 antibody in HT29 MTX scr and HT29 MTX NCoR1kd cells scale bar=3um. Graphs on the right show fluorescence intensity of NCoR1 and KLF16 measured (n=60). Each dot represents an individual experiment (c, d, and e). All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant.

Article Snippet: A customised, morpholino based NCoR1 specific knockdown model was developed (Gene Tools LLC, USA).

Techniques: Control, Expressing, Chromatin Immunoprecipitation, Binding Assay, Western Blot, Over Expression, Knockdown, Imaging, Staining, Fluorescence

Journal: bioRxiv

Article Title: Corepressor NCoR1-mediated regulation of mucin dynamics governs gut inflammation

doi: 10.64898/2026.05.02.722388

Figure Lengend Snippet:

Article Snippet: A customised, morpholino based NCoR1 specific knockdown model was developed (Gene Tools LLC, USA).

Techniques:

a) Graph showing binding of AGAP3, KLF16, GLTPD2 and EXOSC6 in chromatin immunoprecipitation (ChIP) using anti- NCoR1 and anti-IgG antibodies in HT29 Undiff , HT29 Diff cells. quantification done using fold over IgG method. b) qRT-PCR analysis of relative fold expression of NCoR1, AGAP3, GLTPD3, EXOSC6 and KLF16 genes upon transient knockdown of NCoR1 with respect to control HT29 MTX cells. GAPDH used for normalization. c) qRT-PCR analysis of relative fold expression of NCoR1, AGAP3, GLTPD3, EXOSC6 and KLF16 genes upon transient overexpression of NCoR1 with respect to control HT29 MTX cells. GAPDH used for normalization. d) Immunoblot of NCoR1 and KLF16 in Nuclear and cytoplasmic fractions of HT29 MTX scr and HT29 MTX NCoR1kd cells. Graph on the right represents densitometric analysis showing fold intensity of NCoR1 and KLF16 expression in the nuclear fraction, calculated by normalizing to loading control (H3 for nuclear fraction). All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant.

Journal: bioRxiv

Article Title: Corepressor NCoR1-mediated regulation of mucin dynamics governs gut inflammation

doi: 10.64898/2026.05.02.722388

Figure Lengend Snippet: a) Graph showing binding of AGAP3, KLF16, GLTPD2 and EXOSC6 in chromatin immunoprecipitation (ChIP) using anti- NCoR1 and anti-IgG antibodies in HT29 Undiff , HT29 Diff cells. quantification done using fold over IgG method. b) qRT-PCR analysis of relative fold expression of NCoR1, AGAP3, GLTPD3, EXOSC6 and KLF16 genes upon transient knockdown of NCoR1 with respect to control HT29 MTX cells. GAPDH used for normalization. c) qRT-PCR analysis of relative fold expression of NCoR1, AGAP3, GLTPD3, EXOSC6 and KLF16 genes upon transient overexpression of NCoR1 with respect to control HT29 MTX cells. GAPDH used for normalization. d) Immunoblot of NCoR1 and KLF16 in Nuclear and cytoplasmic fractions of HT29 MTX scr and HT29 MTX NCoR1kd cells. Graph on the right represents densitometric analysis showing fold intensity of NCoR1 and KLF16 expression in the nuclear fraction, calculated by normalizing to loading control (H3 for nuclear fraction). All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant.

Article Snippet: A customised, morpholino based NCoR1 specific knockdown model was developed (Gene Tools LLC, USA).

Techniques: Binding Assay, Chromatin Immunoprecipitation, Quantitative RT-PCR, Expressing, Knockdown, Control, Over Expression, Western Blot

a) Immunoblotting of NCoR1 and KLF16 in HT29 MTX cells upon transient knockdown of KLF16 (siCTL and siKLF16). The graph on the right represents densitometric analysis showing fold intensity of NCoR1 and KLF16 expression calculated by normalising to loading control (Actin). b) qRT-PCR analysis of relative fold expression of NCoR1, KLF16 and MUC2 genes upon transient knockdown of KLF16 (siKLF16) relative to siCTL in HT29 MTX cells. GAPDH was used for normalisation. c) Representative confocal imaging of MUC2 (green) stained using anti-MUC2 antibody in siCTL and siKLF16 in HT29MTX cells (n=90). Scale bar=2 um. The graph shows MUC2 fluorescence intensity measured. d) JASPAR predicted sequence for KLF16 binding. Image on the right indicates pSCAN predicted site for KLF16 binding on MUC2 promoter. Image Created with BioRender.com . e) Immunoblot of KLF16 in J774, HT29 Undiff ,HT29 Diff , HCT8 and HT29-MTX cell lines. The on the right graph represents NCoR1 expression calculated by normalising to loading control (Actin) specific to each cell type. Each dot represents (a,b and e) individual experiment. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant.

Journal: bioRxiv

Article Title: Corepressor NCoR1-mediated regulation of mucin dynamics governs gut inflammation

doi: 10.64898/2026.05.02.722388

Figure Lengend Snippet: a) Immunoblotting of NCoR1 and KLF16 in HT29 MTX cells upon transient knockdown of KLF16 (siCTL and siKLF16). The graph on the right represents densitometric analysis showing fold intensity of NCoR1 and KLF16 expression calculated by normalising to loading control (Actin). b) qRT-PCR analysis of relative fold expression of NCoR1, KLF16 and MUC2 genes upon transient knockdown of KLF16 (siKLF16) relative to siCTL in HT29 MTX cells. GAPDH was used for normalisation. c) Representative confocal imaging of MUC2 (green) stained using anti-MUC2 antibody in siCTL and siKLF16 in HT29MTX cells (n=90). Scale bar=2 um. The graph shows MUC2 fluorescence intensity measured. d) JASPAR predicted sequence for KLF16 binding. Image on the right indicates pSCAN predicted site for KLF16 binding on MUC2 promoter. Image Created with BioRender.com . e) Immunoblot of KLF16 in J774, HT29 Undiff ,HT29 Diff , HCT8 and HT29-MTX cell lines. The on the right graph represents NCoR1 expression calculated by normalising to loading control (Actin) specific to each cell type. Each dot represents (a,b and e) individual experiment. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant.

Article Snippet: A customised, morpholino based NCoR1 specific knockdown model was developed (Gene Tools LLC, USA).

Techniques: Western Blot, Knockdown, Expressing, Control, Quantitative RT-PCR, Imaging, Staining, Fluorescence, Sequencing, Binding Assay

a) Representative Immunoblot of KLF16 protein in human ulcerative colitis (UC) (n = 8) and control (n = 6) biopsy samples. Graph on the right represents densitometric analysis showing fold intensity of KLF16 expression calculated by normalising to loading control (Tubulin). b) qRT-PCR analysis of relative fold expression of KLF16 gene in human UC patient colonic biopsies (n = 24) relative to average control values (n = 23). 18s was used for normalisation. c) Immunoblot of KLF16 protein in crypt lysate of DSS dynamics Control, DSS1, DSS3 and DSS5 mice. The graph on right represents densitometric analysis showing fold intensity of KLF16 expression calculated by normalising to loading control (Actin). d) Immunoblot of KLF16 protein in whole tissue lysate of NCoR1 knockdown mice i.e. Ctrl, Ctrl NCoR1kd ,DSS and DSS NCoR1kd mice. The graph on right represents densitometric analysis showing fold intensity of KLF16 expression calculated by normalising to loading control (Tubulin). e) Immunoblot of KLF16 protein in whole tissue lysate from the colon of vitamin D-mediated rescue in mice i.e. Ctrl, DSS, Ctrl VD or DSS VD . The graph on right represents densitometric analysis showing fold intensity of KLF16 expression calculated by normalising to loading control (Tubulin). f) Immunoblot of KLF16 protein in crypt lysate from colon of vitamin D mediated rescue in mice i.e. Ctrl, DSS, Ctrl VD or DSS VD . The graph on right represents densitometric analysis showing fold intensity of KLF16 expression calculated by normalising to loading control (Tubulin). Each dot represents (a and b) individual human and (c,d,e and f) individual mice. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant.

Journal: bioRxiv

Article Title: Corepressor NCoR1-mediated regulation of mucin dynamics governs gut inflammation

doi: 10.64898/2026.05.02.722388

Figure Lengend Snippet: a) Representative Immunoblot of KLF16 protein in human ulcerative colitis (UC) (n = 8) and control (n = 6) biopsy samples. Graph on the right represents densitometric analysis showing fold intensity of KLF16 expression calculated by normalising to loading control (Tubulin). b) qRT-PCR analysis of relative fold expression of KLF16 gene in human UC patient colonic biopsies (n = 24) relative to average control values (n = 23). 18s was used for normalisation. c) Immunoblot of KLF16 protein in crypt lysate of DSS dynamics Control, DSS1, DSS3 and DSS5 mice. The graph on right represents densitometric analysis showing fold intensity of KLF16 expression calculated by normalising to loading control (Actin). d) Immunoblot of KLF16 protein in whole tissue lysate of NCoR1 knockdown mice i.e. Ctrl, Ctrl NCoR1kd ,DSS and DSS NCoR1kd mice. The graph on right represents densitometric analysis showing fold intensity of KLF16 expression calculated by normalising to loading control (Tubulin). e) Immunoblot of KLF16 protein in whole tissue lysate from the colon of vitamin D-mediated rescue in mice i.e. Ctrl, DSS, Ctrl VD or DSS VD . The graph on right represents densitometric analysis showing fold intensity of KLF16 expression calculated by normalising to loading control (Tubulin). f) Immunoblot of KLF16 protein in crypt lysate from colon of vitamin D mediated rescue in mice i.e. Ctrl, DSS, Ctrl VD or DSS VD . The graph on right represents densitometric analysis showing fold intensity of KLF16 expression calculated by normalising to loading control (Tubulin). Each dot represents (a and b) individual human and (c,d,e and f) individual mice. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant.

Article Snippet: A customised, morpholino based NCoR1 specific knockdown model was developed (Gene Tools LLC, USA).

Techniques: Western Blot, Control, Expressing, Quantitative RT-PCR, Knockdown

a) Immunoblot of NCoR1, KLF16 and mTOR pathway proteins pmTOR, mTOR, pS6, ppS6, p4EBP1, KLF16 and NCoR1 in the cell lysates of HT29 MTX NCoR1kd andHT29 MTX scr cells. Graph below represents densitometric analysis showing fold intensity of respective protein expression calculated by normalising to loading control (Actin). b) Immunoblot of NCoR1, KLF16 and mTOR pathway proteins ppS6 and p4EBP1in the cell lysates of siCTL and siKLF16 HT29 MTX cells. Graph represents densitometric analysis showing fold intensity of respective protein expression of NCoR1, KLF16, ppS6, mTOR, and p4EBP1, calculated by normalizing to loading control (Actin). Each dot represents (a and b) an individual experiment. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant.

Journal: bioRxiv

Article Title: Corepressor NCoR1-mediated regulation of mucin dynamics governs gut inflammation

doi: 10.64898/2026.05.02.722388

Figure Lengend Snippet: a) Immunoblot of NCoR1, KLF16 and mTOR pathway proteins pmTOR, mTOR, pS6, ppS6, p4EBP1, KLF16 and NCoR1 in the cell lysates of HT29 MTX NCoR1kd andHT29 MTX scr cells. Graph below represents densitometric analysis showing fold intensity of respective protein expression calculated by normalising to loading control (Actin). b) Immunoblot of NCoR1, KLF16 and mTOR pathway proteins ppS6 and p4EBP1in the cell lysates of siCTL and siKLF16 HT29 MTX cells. Graph represents densitometric analysis showing fold intensity of respective protein expression of NCoR1, KLF16, ppS6, mTOR, and p4EBP1, calculated by normalizing to loading control (Actin). Each dot represents (a and b) an individual experiment. All data were expressed as means ± SEM, unpaired Student t-test was used to calculate statistical significance * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, not significant.

Article Snippet: A customised, morpholino based NCoR1 specific knockdown model was developed (Gene Tools LLC, USA).

Techniques: Western Blot, Expressing, Control

(a) Flow cytometry analysis of splenocytes isolated from WT and NCOR1-cKO mice showing CD44 and CD62L expression in CD4 + FOXP3 + cells at steady-state. (b) Diagram showing percentage of CD44 hi CD62L − and CD44 lo CD62 + cells of all mice analyzed as described in (a). (c) Diagrams show total cell numbers of CD44 hi CD62L − and CD44 lo CD62 + cells of all mice analyzed as described in (a). (d) Experimental immunization strategy: mice were s.c. injected with NP-KLH and draining LNs were analyzed six days later. (e) Flow cytometry analysis of cells isolated from draining LN of NP-KLH-immunized WT and NCOR1-cKO mice showing the expression of PD-1, CXCR5 and FOXP3 on CD4 + CD44 hi cells. (f) Diagram showing percentage of Tfh cells (CD4 + CD44 hi PD1 + CXCR5 + ) and Tfr cells (CD4 + CD44 hi PD1 + CXCR5 + FOXP3 + ) of all mice analyzed as shown in (d,e). (g) Diagrams show total cell numbers of Tfh cells (CD4 + CD44 hi PD1 + CXCR5 + ) and Tfr cells (CD4 + CD44 hi PD1 + CXCR5 + FOXP3 + ) of all mice analyzed as shown in (d,e). (a,e) Numbers indicate the percentages of cells in the respective quadrants or gates. (a-c) Cells were pre-gated on CD4 and FOXP3. (b,c,f,g) Each symbol indicates one mouse. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 (unpaired 2-tailed Student’s t test). Data are representative (a,e) or show the summary (b,c,f,g) of at least 11 (b) or 12 (e) mice that were analyzed in at least 3 independent experiments.

Journal: bioRxiv

Article Title: Nuclear receptor corepressor 1 controls regulatory T cell subset differentiation and effector function

doi: 10.1101/2022.03.24.485609

Figure Lengend Snippet: (a) Flow cytometry analysis of splenocytes isolated from WT and NCOR1-cKO mice showing CD44 and CD62L expression in CD4 + FOXP3 + cells at steady-state. (b) Diagram showing percentage of CD44 hi CD62L − and CD44 lo CD62 + cells of all mice analyzed as described in (a). (c) Diagrams show total cell numbers of CD44 hi CD62L − and CD44 lo CD62 + cells of all mice analyzed as described in (a). (d) Experimental immunization strategy: mice were s.c. injected with NP-KLH and draining LNs were analyzed six days later. (e) Flow cytometry analysis of cells isolated from draining LN of NP-KLH-immunized WT and NCOR1-cKO mice showing the expression of PD-1, CXCR5 and FOXP3 on CD4 + CD44 hi cells. (f) Diagram showing percentage of Tfh cells (CD4 + CD44 hi PD1 + CXCR5 + ) and Tfr cells (CD4 + CD44 hi PD1 + CXCR5 + FOXP3 + ) of all mice analyzed as shown in (d,e). (g) Diagrams show total cell numbers of Tfh cells (CD4 + CD44 hi PD1 + CXCR5 + ) and Tfr cells (CD4 + CD44 hi PD1 + CXCR5 + FOXP3 + ) of all mice analyzed as shown in (d,e). (a,e) Numbers indicate the percentages of cells in the respective quadrants or gates. (a-c) Cells were pre-gated on CD4 and FOXP3. (b,c,f,g) Each symbol indicates one mouse. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 (unpaired 2-tailed Student’s t test). Data are representative (a,e) or show the summary (b,c,f,g) of at least 11 (b) or 12 (e) mice that were analyzed in at least 3 independent experiments.

Article Snippet: In detail, 1μL of a mixture of three NCOR1 specific crRNAs (Alt-R® CRISPR-Cas9 crRNA; total concentration 320μM; sequences: GGAATCGAAGCGACCACGTC TGG, TAACCAGCCATCAGATACCA AGG, CG GTGTTTCTGCTCCACAGG AGG; underlined is PAM sequence) were mixed with 1μL tracr RNA (320μM; all Integrated DNA Technologies, Newark, NJ, USA) and hybridized for 10 min at room temperature.

Techniques: Flow Cytometry, Isolation, Expressing, Injection

(a) Diagrams showing summary of the percentage of CD44 hi CD62L − and CD44 lo CD62L + cells isolated from pLNs of WT and NCOR1-cKO mice. (b) Diagrams showing summary of the percentage of CD44 hi CD62L − and CD44 lo CD62L + cells isolated from mLNs of WT and NCOR1-cKO mice. (a,b) Cells were pregated on CD4. (c) Histograms displaying expression of CD25, CD103, KLRG1, ICOS, CD69 and GITR in WT and NCOR1-cKO Tregs isolated from spleen, pLNs and mLNs. (d) Diagrams showing the summary of all analysis performed as shown in (c). For GITR gMFI levels, WT expression levels were set as 1 and relative gMFI on NCOR1-cKO Tregs was calculated. (a,b,d) Each symbol indicates one mouse. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 (unpaired 2-tailed Student’s t test). Data are representative (c) or show a summary (a) (b) (d) of at least 6 mice analysed in at least 2 independent experiments

Journal: bioRxiv

Article Title: Nuclear receptor corepressor 1 controls regulatory T cell subset differentiation and effector function

doi: 10.1101/2022.03.24.485609

Figure Lengend Snippet: (a) Diagrams showing summary of the percentage of CD44 hi CD62L − and CD44 lo CD62L + cells isolated from pLNs of WT and NCOR1-cKO mice. (b) Diagrams showing summary of the percentage of CD44 hi CD62L − and CD44 lo CD62L + cells isolated from mLNs of WT and NCOR1-cKO mice. (a,b) Cells were pregated on CD4. (c) Histograms displaying expression of CD25, CD103, KLRG1, ICOS, CD69 and GITR in WT and NCOR1-cKO Tregs isolated from spleen, pLNs and mLNs. (d) Diagrams showing the summary of all analysis performed as shown in (c). For GITR gMFI levels, WT expression levels were set as 1 and relative gMFI on NCOR1-cKO Tregs was calculated. (a,b,d) Each symbol indicates one mouse. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 (unpaired 2-tailed Student’s t test). Data are representative (c) or show a summary (a) (b) (d) of at least 6 mice analysed in at least 2 independent experiments

Article Snippet: In detail, 1μL of a mixture of three NCOR1 specific crRNAs (Alt-R® CRISPR-Cas9 crRNA; total concentration 320μM; sequences: GGAATCGAAGCGACCACGTC TGG, TAACCAGCCATCAGATACCA AGG, CG GTGTTTCTGCTCCACAGG AGG; underlined is PAM sequence) were mixed with 1μL tracr RNA (320μM; all Integrated DNA Technologies, Newark, NJ, USA) and hybridized for 10 min at room temperature.

Techniques: Isolation, Expressing

(a) Diagrams showing summary of the percentages of CD44 hi CD62L − and CD44 lo CD62L + Tconv (CD4 + FOXP3 − ) cells isolated from the spleen of WT and NCOR1-cKO mice. (b) Flow cytometry analysis showing FOXP3 and CD25 expression of thymocytes isolated from WT and NCOR1-cKO mice. (c) Diagram showing percentage of FOXP3 − CD25 + , FOXP3 + CD25 − and FOXP3 + CD25 + thymocytes of all mice analyzed as described in (b). (d) Diagrams showing summary of thymic FOXP3 + CD25 − CD44 hi CD62L − and FOXP3 + CD25 + CD44 hi CD62L − cells isolated from WT and NCOR1-cKO mice . (b-d) Thymocytes were pregated on CD4 + .

Journal: bioRxiv

Article Title: Nuclear receptor corepressor 1 controls regulatory T cell subset differentiation and effector function

doi: 10.1101/2022.03.24.485609

Figure Lengend Snippet: (a) Diagrams showing summary of the percentages of CD44 hi CD62L − and CD44 lo CD62L + Tconv (CD4 + FOXP3 − ) cells isolated from the spleen of WT and NCOR1-cKO mice. (b) Flow cytometry analysis showing FOXP3 and CD25 expression of thymocytes isolated from WT and NCOR1-cKO mice. (c) Diagram showing percentage of FOXP3 − CD25 + , FOXP3 + CD25 − and FOXP3 + CD25 + thymocytes of all mice analyzed as described in (b). (d) Diagrams showing summary of thymic FOXP3 + CD25 − CD44 hi CD62L − and FOXP3 + CD25 + CD44 hi CD62L − cells isolated from WT and NCOR1-cKO mice . (b-d) Thymocytes were pregated on CD4 + .

Article Snippet: In detail, 1μL of a mixture of three NCOR1 specific crRNAs (Alt-R® CRISPR-Cas9 crRNA; total concentration 320μM; sequences: GGAATCGAAGCGACCACGTC TGG, TAACCAGCCATCAGATACCA AGG, CG GTGTTTCTGCTCCACAGG AGG; underlined is PAM sequence) were mixed with 1μL tracr RNA (320μM; all Integrated DNA Technologies, Newark, NJ, USA) and hybridized for 10 min at room temperature.

Techniques: Isolation, Flow Cytometry, Expressing

(a) Experimental strategy for generating bone marrow chimeric mice. (b) Flow cytometry analysis showing the distribution of CD45.1 + and CD45.2 + cells as well as the expression of FOXP3, CD44 and CD62L in recipient mice injected with either WT:WT or WT:NCOR1-cKO BM mixtures. (c-f) Summary of all experiments as described in (a,b) showing the percentages of FOXP3 + cells (c,e) and CD44 hi CD62L − and CD44 lo CD62L + expressing cells (d,f) within the (c,d) CD45.2 + population and the (e,f) CD45.1 + population isolated from the spleen of recipient Rag2 −/– mice injected with either WT:WT or WT:NCOR1-cKO BM cell mixtures. (b) Numbers indicate the percentages of cells in the respective quadrants or gates. (c-f) Cells were pre-gated on CD4. Each symbol indicates one mouse. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 (unpaired 2-tailed Student’s t test). Data are representative (b) or show a summary (c-f) of 10 mice that were analyzed in 2 independent experiments.

Journal: bioRxiv

Article Title: Nuclear receptor corepressor 1 controls regulatory T cell subset differentiation and effector function

doi: 10.1101/2022.03.24.485609

Figure Lengend Snippet: (a) Experimental strategy for generating bone marrow chimeric mice. (b) Flow cytometry analysis showing the distribution of CD45.1 + and CD45.2 + cells as well as the expression of FOXP3, CD44 and CD62L in recipient mice injected with either WT:WT or WT:NCOR1-cKO BM mixtures. (c-f) Summary of all experiments as described in (a,b) showing the percentages of FOXP3 + cells (c,e) and CD44 hi CD62L − and CD44 lo CD62L + expressing cells (d,f) within the (c,d) CD45.2 + population and the (e,f) CD45.1 + population isolated from the spleen of recipient Rag2 −/– mice injected with either WT:WT or WT:NCOR1-cKO BM cell mixtures. (b) Numbers indicate the percentages of cells in the respective quadrants or gates. (c-f) Cells were pre-gated on CD4. Each symbol indicates one mouse. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 (unpaired 2-tailed Student’s t test). Data are representative (b) or show a summary (c-f) of 10 mice that were analyzed in 2 independent experiments.

Article Snippet: In detail, 1μL of a mixture of three NCOR1 specific crRNAs (Alt-R® CRISPR-Cas9 crRNA; total concentration 320μM; sequences: GGAATCGAAGCGACCACGTC TGG, TAACCAGCCATCAGATACCA AGG, CG GTGTTTCTGCTCCACAGG AGG; underlined is PAM sequence) were mixed with 1μL tracr RNA (320μM; all Integrated DNA Technologies, Newark, NJ, USA) and hybridized for 10 min at room temperature.

Techniques: Flow Cytometry, Expressing, Injection, Isolation

(a) Representative agarose gel picture showing Ncor1 deletion PCR in WT tail samples and FACS-sorted WT CD4 + splenocytes (left panel), TCRß + , CD8 + , CD4 + YFP − and CD4 + YFP + cells isolated from the spleen of NCOR1-cKO Foxp3 mice (middle panel) and CD4 + YFP − and CD4 + YFP + cells isolated from the thymus (right panel) of NCOR1-cKO Foxp3 mice. Two mice were pooled for sorting. Size floxed band: 346bp. Size Δ band: 246bp. (b) Flow cytometry analysis showing FOXP3, CD44 and CD62L expression on splenic CD4 + T cells isolated from WT Foxp3 and NCOR1-cKO Foxp3 mice. (c) Diagrams show summary of the percentage of splenic CD44 hi CD62L − and CD44 lo CD62L + cells isolated from WT Foxp3 and NCOR1-cKO Foxp3 mice. (d) Diagrams show summary of total cell numbers of splenic CD44 hi CD62L − and CD44 lo CD62L + cells isolated from WT Foxp3 and NCOR1-cKO Foxp3 mice. (e) Diagrams show summary of the percentage of splenic CD4 + FOXP3 + cells isolated from WT Foxp3 and NCOR1-cKO Foxp3 mice. (f) Diagrams show summary of total cell numbers of splenic CD4 + FOXP3 + cells isolated from WT Foxp3 and NCOR1-cKO Foxp3 mice.

Journal: bioRxiv

Article Title: Nuclear receptor corepressor 1 controls regulatory T cell subset differentiation and effector function

doi: 10.1101/2022.03.24.485609

Figure Lengend Snippet: (a) Representative agarose gel picture showing Ncor1 deletion PCR in WT tail samples and FACS-sorted WT CD4 + splenocytes (left panel), TCRß + , CD8 + , CD4 + YFP − and CD4 + YFP + cells isolated from the spleen of NCOR1-cKO Foxp3 mice (middle panel) and CD4 + YFP − and CD4 + YFP + cells isolated from the thymus (right panel) of NCOR1-cKO Foxp3 mice. Two mice were pooled for sorting. Size floxed band: 346bp. Size Δ band: 246bp. (b) Flow cytometry analysis showing FOXP3, CD44 and CD62L expression on splenic CD4 + T cells isolated from WT Foxp3 and NCOR1-cKO Foxp3 mice. (c) Diagrams show summary of the percentage of splenic CD44 hi CD62L − and CD44 lo CD62L + cells isolated from WT Foxp3 and NCOR1-cKO Foxp3 mice. (d) Diagrams show summary of total cell numbers of splenic CD44 hi CD62L − and CD44 lo CD62L + cells isolated from WT Foxp3 and NCOR1-cKO Foxp3 mice. (e) Diagrams show summary of the percentage of splenic CD4 + FOXP3 + cells isolated from WT Foxp3 and NCOR1-cKO Foxp3 mice. (f) Diagrams show summary of total cell numbers of splenic CD4 + FOXP3 + cells isolated from WT Foxp3 and NCOR1-cKO Foxp3 mice.

Article Snippet: In detail, 1μL of a mixture of three NCOR1 specific crRNAs (Alt-R® CRISPR-Cas9 crRNA; total concentration 320μM; sequences: GGAATCGAAGCGACCACGTC TGG, TAACCAGCCATCAGATACCA AGG, CG GTGTTTCTGCTCCACAGG AGG; underlined is PAM sequence) were mixed with 1μL tracr RNA (320μM; all Integrated DNA Technologies, Newark, NJ, USA) and hybridized for 10 min at room temperature.

Techniques: Agarose Gel Electrophoresis, Isolation, Flow Cytometry, Expressing

(a) Strategy for RNA-sequencing: cells from spleen and LNs were isolated and FOXP3 + CD44 hi CD62L − and FOXP3 + CD44 lo CD62L + cells were FACS-sorted and sequenced using the Illumina HiSeq 3000 platform. (b) Volcano plots depict a comparison of global gene expression profiles between naïve (CD44 lo CD62L + ) WT and NCOR1-cKO Tregs (left plot) and effector (CD44 hi CD62L − ) WT and NCOR1-cKO Tregs (right plot). On the x-axis log2-fold change is plotted (FDR ≤ 0.05) while the y-axis indicates p-values (-log10). 1641 genes were downregulated and 1103 genes were upregulated in naïve NCOR1-cKO Tregs. 621 and 704 genes were down- and upregulated, respectively, in effector NCOR1-cKO Tregs. (c) Venn diagrams showing a comparison of up- and downregulated genes in naïve versus effector NCOR1-cKO Tregs compared to the corresponding WT Treg subsets. (d) Gene set enrichment analysis (GSEA) plots of an “effector Treg gene set” (containing a list of 100 genes) in naïve NCOR1-cKO Tregs compared to naïve WT Tregs. (e) Gene set enrichment analysis (GSEA) plots of a “naïve Treg gene set” (containing a list of 100 genes) in effector NCOR1-cKO Tregs compared to effector WT Tregs. (d,e) Barcodes indicate the location of the members of the gene set in the ranked list of all genes. NES, normalized enrichment score in WT Tregs compared to NCOR1-cKO Tregs. A list of the “naïve Treg gene set” and the “effector Treg gene set” is provided in Supplementary Table 1.

Journal: bioRxiv

Article Title: Nuclear receptor corepressor 1 controls regulatory T cell subset differentiation and effector function

doi: 10.1101/2022.03.24.485609

Figure Lengend Snippet: (a) Strategy for RNA-sequencing: cells from spleen and LNs were isolated and FOXP3 + CD44 hi CD62L − and FOXP3 + CD44 lo CD62L + cells were FACS-sorted and sequenced using the Illumina HiSeq 3000 platform. (b) Volcano plots depict a comparison of global gene expression profiles between naïve (CD44 lo CD62L + ) WT and NCOR1-cKO Tregs (left plot) and effector (CD44 hi CD62L − ) WT and NCOR1-cKO Tregs (right plot). On the x-axis log2-fold change is plotted (FDR ≤ 0.05) while the y-axis indicates p-values (-log10). 1641 genes were downregulated and 1103 genes were upregulated in naïve NCOR1-cKO Tregs. 621 and 704 genes were down- and upregulated, respectively, in effector NCOR1-cKO Tregs. (c) Venn diagrams showing a comparison of up- and downregulated genes in naïve versus effector NCOR1-cKO Tregs compared to the corresponding WT Treg subsets. (d) Gene set enrichment analysis (GSEA) plots of an “effector Treg gene set” (containing a list of 100 genes) in naïve NCOR1-cKO Tregs compared to naïve WT Tregs. (e) Gene set enrichment analysis (GSEA) plots of a “naïve Treg gene set” (containing a list of 100 genes) in effector NCOR1-cKO Tregs compared to effector WT Tregs. (d,e) Barcodes indicate the location of the members of the gene set in the ranked list of all genes. NES, normalized enrichment score in WT Tregs compared to NCOR1-cKO Tregs. A list of the “naïve Treg gene set” and the “effector Treg gene set” is provided in Supplementary Table 1.

Article Snippet: In detail, 1μL of a mixture of three NCOR1 specific crRNAs (Alt-R® CRISPR-Cas9 crRNA; total concentration 320μM; sequences: GGAATCGAAGCGACCACGTC TGG, TAACCAGCCATCAGATACCA AGG, CG GTGTTTCTGCTCCACAGG AGG; underlined is PAM sequence) were mixed with 1μL tracr RNA (320μM; all Integrated DNA Technologies, Newark, NJ, USA) and hybridized for 10 min at room temperature.

Techniques: RNA Sequencing, Isolation, Comparison, Gene Expression

(a) Heatmap of gene expression values of an “effector Treg” gene set in naïve NCOR1-cKO Tregs compared to naïve WT Tregs. (b) Heatmap of gene expression values of a “naïve Treg” gene set in effector NCOR1-cKO Tregs compared to effector WT Tregs. (a,b) Log2FC of NCOR1-cKO Tregs compared to WT Tregs is shown. WT levels were set as 1 for each gene. A list of the “naïve Treg” gene set and the “effector Treg” gene set is provided in Supplementary Table 1.

Journal: bioRxiv

Article Title: Nuclear receptor corepressor 1 controls regulatory T cell subset differentiation and effector function

doi: 10.1101/2022.03.24.485609

Figure Lengend Snippet: (a) Heatmap of gene expression values of an “effector Treg” gene set in naïve NCOR1-cKO Tregs compared to naïve WT Tregs. (b) Heatmap of gene expression values of a “naïve Treg” gene set in effector NCOR1-cKO Tregs compared to effector WT Tregs. (a,b) Log2FC of NCOR1-cKO Tregs compared to WT Tregs is shown. WT levels were set as 1 for each gene. A list of the “naïve Treg” gene set and the “effector Treg” gene set is provided in Supplementary Table 1.

Article Snippet: In detail, 1μL of a mixture of three NCOR1 specific crRNAs (Alt-R® CRISPR-Cas9 crRNA; total concentration 320μM; sequences: GGAATCGAAGCGACCACGTC TGG, TAACCAGCCATCAGATACCA AGG, CG GTGTTTCTGCTCCACAGG AGG; underlined is PAM sequence) were mixed with 1μL tracr RNA (320μM; all Integrated DNA Technologies, Newark, NJ, USA) and hybridized for 10 min at room temperature.

Techniques: Gene Expression

(a) Gene set enrichment analysis (GSEA) plots of “MYC target genes v. 2” (containing 54 genes) in effector NCOR1-cKO Tregs compared to effector WT Tregs. (b) Gene set enrichment analysis (GSEA) plots of “MYC target genes v. 2” in naive NCOR1-cKO Tregs compared to naive WT Tregs. (a,b) Barcodes indicate the location of the members of the gene set in the ranked list of all genes. NES, normalized enrichment score in WT Tregs compared to NCOR1-cKO Tregs. A list of all “MYC target genes v. 2” is provided in Supplementary Figure 5. (c) Summary showing Myc gene expression levels (values shown as fragments per kilobase of transcript per million mapped reads; FPKM) in naïve and effector WT and NCOR1-cKO Tregs as determined by RNA-seq. (d) Histograms showing MYC expression as determined by flow cytometry in splenic naïve and effector WT and NCOR1-cKO Tregs. (e) Summary of (d) showing MYC expression in splenic naïve and effector WT and NCOR1-cKO Tregs. Summary graph depicts MYC expression levels as geometric mean fluorescence intensity (rel. gMFI). For each experiment, naïve WT levels were set as 1 and relative gMFI of MYC is shown. (c,e) Each symbol indicates one mouse. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 (ordinary 1-way ANOVA analysis followed by Tukey’s multiple-comparisons test; for simplicity, significant differences are shown only between WT and NCOR1-cKO Tregs). Data are representative (d) or show a summary (c,e) of 6 mice that were analyzed in 2 independent experiments.

Journal: bioRxiv

Article Title: Nuclear receptor corepressor 1 controls regulatory T cell subset differentiation and effector function

doi: 10.1101/2022.03.24.485609

Figure Lengend Snippet: (a) Gene set enrichment analysis (GSEA) plots of “MYC target genes v. 2” (containing 54 genes) in effector NCOR1-cKO Tregs compared to effector WT Tregs. (b) Gene set enrichment analysis (GSEA) plots of “MYC target genes v. 2” in naive NCOR1-cKO Tregs compared to naive WT Tregs. (a,b) Barcodes indicate the location of the members of the gene set in the ranked list of all genes. NES, normalized enrichment score in WT Tregs compared to NCOR1-cKO Tregs. A list of all “MYC target genes v. 2” is provided in Supplementary Figure 5. (c) Summary showing Myc gene expression levels (values shown as fragments per kilobase of transcript per million mapped reads; FPKM) in naïve and effector WT and NCOR1-cKO Tregs as determined by RNA-seq. (d) Histograms showing MYC expression as determined by flow cytometry in splenic naïve and effector WT and NCOR1-cKO Tregs. (e) Summary of (d) showing MYC expression in splenic naïve and effector WT and NCOR1-cKO Tregs. Summary graph depicts MYC expression levels as geometric mean fluorescence intensity (rel. gMFI). For each experiment, naïve WT levels were set as 1 and relative gMFI of MYC is shown. (c,e) Each symbol indicates one mouse. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 (ordinary 1-way ANOVA analysis followed by Tukey’s multiple-comparisons test; for simplicity, significant differences are shown only between WT and NCOR1-cKO Tregs). Data are representative (d) or show a summary (c,e) of 6 mice that were analyzed in 2 independent experiments.

Article Snippet: In detail, 1μL of a mixture of three NCOR1 specific crRNAs (Alt-R® CRISPR-Cas9 crRNA; total concentration 320μM; sequences: GGAATCGAAGCGACCACGTC TGG, TAACCAGCCATCAGATACCA AGG, CG GTGTTTCTGCTCCACAGG AGG; underlined is PAM sequence) were mixed with 1μL tracr RNA (320μM; all Integrated DNA Technologies, Newark, NJ, USA) and hybridized for 10 min at room temperature.

Techniques: Gene Expression, RNA Sequencing, Expressing, Flow Cytometry, Fluorescence

(a,b) Heatmap of gene expression values of “MYC target genes v. 2” in (a) effector and (b) naïve NCOR1-cKO Tregs compared to WT Tregs. (c) Summary showing MYC protein expression (rel. gMFI) expression in naïve and effector WT and NCOR1-cKO Tregs isolated from pLNs and mLNs. (d) Summary showing MYC expression (rel. gMFI) in naïve and effector WT and NCOR1-cKO iTregs. For gMFI calculations, naïve WT levels were set as 1 and relative gMFI of MYC is shown. (c,d) Each symbol indicates one mouse. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 (ordinary 1-way ANOVA analysis followed by Tukey’s multiple-comparisons test; for simplicity, significant difference is shown only between WT and NCOR1-cKO Tregs). Data are summary of at least 4 mice that were analyzed in at least 2 independent experiments.

Journal: bioRxiv

Article Title: Nuclear receptor corepressor 1 controls regulatory T cell subset differentiation and effector function

doi: 10.1101/2022.03.24.485609

Figure Lengend Snippet: (a,b) Heatmap of gene expression values of “MYC target genes v. 2” in (a) effector and (b) naïve NCOR1-cKO Tregs compared to WT Tregs. (c) Summary showing MYC protein expression (rel. gMFI) expression in naïve and effector WT and NCOR1-cKO Tregs isolated from pLNs and mLNs. (d) Summary showing MYC expression (rel. gMFI) in naïve and effector WT and NCOR1-cKO iTregs. For gMFI calculations, naïve WT levels were set as 1 and relative gMFI of MYC is shown. (c,d) Each symbol indicates one mouse. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 (ordinary 1-way ANOVA analysis followed by Tukey’s multiple-comparisons test; for simplicity, significant difference is shown only between WT and NCOR1-cKO Tregs). Data are summary of at least 4 mice that were analyzed in at least 2 independent experiments.

Article Snippet: In detail, 1μL of a mixture of three NCOR1 specific crRNAs (Alt-R® CRISPR-Cas9 crRNA; total concentration 320μM; sequences: GGAATCGAAGCGACCACGTC TGG, TAACCAGCCATCAGATACCA AGG, CG GTGTTTCTGCTCCACAGG AGG; underlined is PAM sequence) were mixed with 1μL tracr RNA (320μM; all Integrated DNA Technologies, Newark, NJ, USA) and hybridized for 10 min at room temperature.

Techniques: Gene Expression, Expressing, Isolation

(a) Diagram showing top 5 pathways which are up- or downregulated in naïve (left) and effector (right) NCOR1-cKO Tregs, as revealed by Ingenuity Pathway Analysis (QIAGEN Inc.). The lower x-axis indicates the p-value. The upper x-axis indicates percentage of genes dysregulated in this particular pathway. The number next to the bar indicates the number of genes in this pathway. A list of all pathways identified by Ingenuity Pathway Analysis is provided in Supplementary Table 4 and 5. (b) Summary showing the expression levels (values showing as fragments per kilobase of transcript per million mapped reads; FPKM) of genes controlling cholesterol biosynthesis in naïve and effector WT and NCOR1-cKO Tregs as determined by RNA-seq. (c) Summary showing Filipin III staining (rel. gMFI) in WT and NCOR1-cKO Tregs pregated on cells expressing CD4 and CD25. For gMFI calculation, WT levels were set as 1 and relative gMFI of Filipin III is shown. (d) Summary showing FPKM values of Abca1 and Abcg1 in naïve and effector WT and NCOR1-cKO WT Tregs as determined by RNA-seq. (e) Summary of experiments performed as described in , showing percentage of FOXP3 + CD44 hi cells, FOXP3 + CD62L − cells, FOXP3 + cells and viable cells. The right diagram indicates the percentage of FOXP3 + cells which underwent ≥ 1 cell division that have been treated with GW3965 or DMSO (as mock control). (b) Each bar represents 3 mice per group. (c,d,e) Each symbol indicates one mouse (c,d) or one sample (e). (b-d) Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 (b,d) ordinary 1-way ANOVA analysis followed by Tukey’s multiple-comparisons test; for simplicity, significant differences are shown only between WT and NCOR1-cKO Tregs. (c) unpaired 2-tailed Student’s t test. (e) unpaired 2-tailed Student’s t tests comparing respective GW3965-treated sample with mock (DMSO)-treated control. (c) Data show a summary of at least 6 mice that were analyzed in 2 independent experiments. (d) Data show a summary of at least 8 independent samples that were analyzed in at least 3 independent experiments (except analysis of proliferating cells which shows 3 independent samples from one experiment).

Journal: bioRxiv

Article Title: Nuclear receptor corepressor 1 controls regulatory T cell subset differentiation and effector function

doi: 10.1101/2022.03.24.485609

Figure Lengend Snippet: (a) Diagram showing top 5 pathways which are up- or downregulated in naïve (left) and effector (right) NCOR1-cKO Tregs, as revealed by Ingenuity Pathway Analysis (QIAGEN Inc.). The lower x-axis indicates the p-value. The upper x-axis indicates percentage of genes dysregulated in this particular pathway. The number next to the bar indicates the number of genes in this pathway. A list of all pathways identified by Ingenuity Pathway Analysis is provided in Supplementary Table 4 and 5. (b) Summary showing the expression levels (values showing as fragments per kilobase of transcript per million mapped reads; FPKM) of genes controlling cholesterol biosynthesis in naïve and effector WT and NCOR1-cKO Tregs as determined by RNA-seq. (c) Summary showing Filipin III staining (rel. gMFI) in WT and NCOR1-cKO Tregs pregated on cells expressing CD4 and CD25. For gMFI calculation, WT levels were set as 1 and relative gMFI of Filipin III is shown. (d) Summary showing FPKM values of Abca1 and Abcg1 in naïve and effector WT and NCOR1-cKO WT Tregs as determined by RNA-seq. (e) Summary of experiments performed as described in , showing percentage of FOXP3 + CD44 hi cells, FOXP3 + CD62L − cells, FOXP3 + cells and viable cells. The right diagram indicates the percentage of FOXP3 + cells which underwent ≥ 1 cell division that have been treated with GW3965 or DMSO (as mock control). (b) Each bar represents 3 mice per group. (c,d,e) Each symbol indicates one mouse (c,d) or one sample (e). (b-d) Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 (b,d) ordinary 1-way ANOVA analysis followed by Tukey’s multiple-comparisons test; for simplicity, significant differences are shown only between WT and NCOR1-cKO Tregs. (c) unpaired 2-tailed Student’s t test. (e) unpaired 2-tailed Student’s t tests comparing respective GW3965-treated sample with mock (DMSO)-treated control. (c) Data show a summary of at least 6 mice that were analyzed in 2 independent experiments. (d) Data show a summary of at least 8 independent samples that were analyzed in at least 3 independent experiments (except analysis of proliferating cells which shows 3 independent samples from one experiment).

Article Snippet: In detail, 1μL of a mixture of three NCOR1 specific crRNAs (Alt-R® CRISPR-Cas9 crRNA; total concentration 320μM; sequences: GGAATCGAAGCGACCACGTC TGG, TAACCAGCCATCAGATACCA AGG, CG GTGTTTCTGCTCCACAGG AGG; underlined is PAM sequence) were mixed with 1μL tracr RNA (320μM; all Integrated DNA Technologies, Newark, NJ, USA) and hybridized for 10 min at room temperature.

Techniques: Expressing, RNA Sequencing, Staining, Control

(a) Summary showing the expression levels (values shown as fragments per kilobase of transcript per million mapped reads; FPKM) of Nr1h3 (LXR α ) and Nr1h2 (LXR β ) in naïve and effector WT and NCOR1-cKO Tregs as determined by RNA-seq. (b) Flow cytometry analysis showing the expression of MYC in CD4 + FOXP3 + iTregs that have been generated in the presence of 8µM GW3965 compared to mock-treated (DMSO) iTregs. Cells were pregated on total viable (c) Diagram shows the summary of MYC expression in CD4 + FOXP3 + iTregs that have been generated in the presence of various concentrations of GW3965 compared to mock-treated (DMSO) iTregs. (a,c) Each symbol indicates one sample. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001. ( (a) ordinary 1-way ANOVA analysis followed by Tukey’s multiple-comparisons or (c) unpaired 2-tailed Student’s t tests comparing respective GW3965-treated sample with mock (DMSO)-treated control). Data are representative (b) or show a summary (c) of at least 8 independent samples that were analyzed in at least 3 independent experiments.

Journal: bioRxiv

Article Title: Nuclear receptor corepressor 1 controls regulatory T cell subset differentiation and effector function

doi: 10.1101/2022.03.24.485609

Figure Lengend Snippet: (a) Summary showing the expression levels (values shown as fragments per kilobase of transcript per million mapped reads; FPKM) of Nr1h3 (LXR α ) and Nr1h2 (LXR β ) in naïve and effector WT and NCOR1-cKO Tregs as determined by RNA-seq. (b) Flow cytometry analysis showing the expression of MYC in CD4 + FOXP3 + iTregs that have been generated in the presence of 8µM GW3965 compared to mock-treated (DMSO) iTregs. Cells were pregated on total viable (c) Diagram shows the summary of MYC expression in CD4 + FOXP3 + iTregs that have been generated in the presence of various concentrations of GW3965 compared to mock-treated (DMSO) iTregs. (a,c) Each symbol indicates one sample. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001. ( (a) ordinary 1-way ANOVA analysis followed by Tukey’s multiple-comparisons or (c) unpaired 2-tailed Student’s t tests comparing respective GW3965-treated sample with mock (DMSO)-treated control). Data are representative (b) or show a summary (c) of at least 8 independent samples that were analyzed in at least 3 independent experiments.

Article Snippet: In detail, 1μL of a mixture of three NCOR1 specific crRNAs (Alt-R® CRISPR-Cas9 crRNA; total concentration 320μM; sequences: GGAATCGAAGCGACCACGTC TGG, TAACCAGCCATCAGATACCA AGG, CG GTGTTTCTGCTCCACAGG AGG; underlined is PAM sequence) were mixed with 1μL tracr RNA (320μM; all Integrated DNA Technologies, Newark, NJ, USA) and hybridized for 10 min at room temperature.

Techniques: Expressing, RNA Sequencing, Flow Cytometry, Generated, Control

(a) Experimental protocol for adoptive transfer colitis. Control groups received CD4 + T conv cells only (as indicated) or no cells at all (not shown). (b) Weight scores in percentages of initial body weight during the course of colitis in Rag2 −/− recipient mice are shown. Data show the summary of at least 8 mice (except control groups with 6 mice) of 3 independent experiments. *P < 0.05, **P < 0.01, and ***P < 0.001 (2-way ANOVA analysis followed by Tukey’s multiple-comparisons test). For simplicity, significant differences are shown only between WT and NCOR1-cKO Tregs. Of note, uninjected control mice gained significantly more weight compared to all groups starting from week 5. (c) Summary showing lengths of colons isolated from Rag2 −/− recipient mice. (d) Colon swiss rolls were processed for H&E staining. The pictures in the bottom represent a 5x magnification of the black rectangle framed section in the top pictures. Magnification: 40x and 200x. Scale bar = 100µm. One representative picture is shown per condition.

Journal: bioRxiv

Article Title: Nuclear receptor corepressor 1 controls regulatory T cell subset differentiation and effector function

doi: 10.1101/2022.03.24.485609

Figure Lengend Snippet: (a) Experimental protocol for adoptive transfer colitis. Control groups received CD4 + T conv cells only (as indicated) or no cells at all (not shown). (b) Weight scores in percentages of initial body weight during the course of colitis in Rag2 −/− recipient mice are shown. Data show the summary of at least 8 mice (except control groups with 6 mice) of 3 independent experiments. *P < 0.05, **P < 0.01, and ***P < 0.001 (2-way ANOVA analysis followed by Tukey’s multiple-comparisons test). For simplicity, significant differences are shown only between WT and NCOR1-cKO Tregs. Of note, uninjected control mice gained significantly more weight compared to all groups starting from week 5. (c) Summary showing lengths of colons isolated from Rag2 −/− recipient mice. (d) Colon swiss rolls were processed for H&E staining. The pictures in the bottom represent a 5x magnification of the black rectangle framed section in the top pictures. Magnification: 40x and 200x. Scale bar = 100µm. One representative picture is shown per condition.

Article Snippet: In detail, 1μL of a mixture of three NCOR1 specific crRNAs (Alt-R® CRISPR-Cas9 crRNA; total concentration 320μM; sequences: GGAATCGAAGCGACCACGTC TGG, TAACCAGCCATCAGATACCA AGG, CG GTGTTTCTGCTCCACAGG AGG; underlined is PAM sequence) were mixed with 1μL tracr RNA (320μM; all Integrated DNA Technologies, Newark, NJ, USA) and hybridized for 10 min at room temperature.

Techniques: Adoptive Transfer Assay, Control, Isolation, Staining

(a) Flow cytometry analysis of SI-LP cells isolated from WT and NCOR1-cKO mice showing percentage of viable CD4 + , CD45.2 + FOXP3 − and CD45.1 − FOXP3 + cells. (b) Diagrams depicting the summary of the percentages (upper panel) and numbers (lower panel) of CD45.2 + FOXP3 + cells isolated from SI-IEL, SI-LP, spleen and mLNs of recipient Rag2 −/– mice injected with WT CD45.1 + CD4 + T cells together with either WT or NCOR1-cKO Tregs. (c) Diagrams showing summary of the percentage (upper panel) and numbers (lower panel) of CD4 + CD45.1 + cells isolated from SI-IEL, SI-LP, spleen and mLNs of Rag2 −/– mice injected with either WT Tregs, NCOR1-cKO Tregs or injected with CD4 + T conv cells only. (a) Numbers indicate the percentages of cells in the respective gate. (b,c) Each symbol indicates one mouse. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 ( (b) unpaired 2-tailed Student’s t test or (c) ordinary 1-way ANOVA analysis followed by Tukey’s multiple-comparisons test). Data are representative (a) or show a summary (b,c) of at least 8 mice (except control groups with 6 mice) that were analyzed in 3 independent experiments.

Journal: bioRxiv

Article Title: Nuclear receptor corepressor 1 controls regulatory T cell subset differentiation and effector function

doi: 10.1101/2022.03.24.485609

Figure Lengend Snippet: (a) Flow cytometry analysis of SI-LP cells isolated from WT and NCOR1-cKO mice showing percentage of viable CD4 + , CD45.2 + FOXP3 − and CD45.1 − FOXP3 + cells. (b) Diagrams depicting the summary of the percentages (upper panel) and numbers (lower panel) of CD45.2 + FOXP3 + cells isolated from SI-IEL, SI-LP, spleen and mLNs of recipient Rag2 −/– mice injected with WT CD45.1 + CD4 + T cells together with either WT or NCOR1-cKO Tregs. (c) Diagrams showing summary of the percentage (upper panel) and numbers (lower panel) of CD4 + CD45.1 + cells isolated from SI-IEL, SI-LP, spleen and mLNs of Rag2 −/– mice injected with either WT Tregs, NCOR1-cKO Tregs or injected with CD4 + T conv cells only. (a) Numbers indicate the percentages of cells in the respective gate. (b,c) Each symbol indicates one mouse. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 ( (b) unpaired 2-tailed Student’s t test or (c) ordinary 1-way ANOVA analysis followed by Tukey’s multiple-comparisons test). Data are representative (a) or show a summary (b,c) of at least 8 mice (except control groups with 6 mice) that were analyzed in 3 independent experiments.

Article Snippet: In detail, 1μL of a mixture of three NCOR1 specific crRNAs (Alt-R® CRISPR-Cas9 crRNA; total concentration 320μM; sequences: GGAATCGAAGCGACCACGTC TGG, TAACCAGCCATCAGATACCA AGG, CG GTGTTTCTGCTCCACAGG AGG; underlined is PAM sequence) were mixed with 1μL tracr RNA (320μM; all Integrated DNA Technologies, Newark, NJ, USA) and hybridized for 10 min at room temperature.

Techniques: Flow Cytometry, Isolation, Injection, Control

(a) Flow cytometry analysis showing FOXP3 and MYC expression in human CD4 + T cells cultured under iTreg conditions after CRISPR-Cas9 mediated deletion of NCOR1 (NCOR1-sgRNA) or in non-targeting control samples (NT-sgRNA). (b) Diagrams show the summary of the experiments as described in (a). gMFI of MYC within MYC hi cells is shown. (c) Flow cytometry analysis showing CD45RA, CD45RO and CD27 expression in human iTregs after CRISPR-Cas9 mediated deletion as described in (a). (d) Diagrams show the summary of the experiments described in (c). (a,c,) Cells were pregated on total viable cell population. (b,d) Each symbol indicates one sample. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001; unpaired 2-tailed Student’s t test ( b,d ). Data are representative (a,c) or show the summary (b,d) of samples from 4 individual healthy donors which were analyzed in one experiment.

Journal: bioRxiv

Article Title: Nuclear receptor corepressor 1 controls regulatory T cell subset differentiation and effector function

doi: 10.1101/2022.03.24.485609

Figure Lengend Snippet: (a) Flow cytometry analysis showing FOXP3 and MYC expression in human CD4 + T cells cultured under iTreg conditions after CRISPR-Cas9 mediated deletion of NCOR1 (NCOR1-sgRNA) or in non-targeting control samples (NT-sgRNA). (b) Diagrams show the summary of the experiments as described in (a). gMFI of MYC within MYC hi cells is shown. (c) Flow cytometry analysis showing CD45RA, CD45RO and CD27 expression in human iTregs after CRISPR-Cas9 mediated deletion as described in (a). (d) Diagrams show the summary of the experiments described in (c). (a,c,) Cells were pregated on total viable cell population. (b,d) Each symbol indicates one sample. Horizontal bars indicate the mean. *P < 0.05, **P < 0.01, and ***P < 0.001; unpaired 2-tailed Student’s t test ( b,d ). Data are representative (a,c) or show the summary (b,d) of samples from 4 individual healthy donors which were analyzed in one experiment.

Article Snippet: In detail, 1μL of a mixture of three NCOR1 specific crRNAs (Alt-R® CRISPR-Cas9 crRNA; total concentration 320μM; sequences: GGAATCGAAGCGACCACGTC TGG, TAACCAGCCATCAGATACCA AGG, CG GTGTTTCTGCTCCACAGG AGG; underlined is PAM sequence) were mixed with 1μL tracr RNA (320μM; all Integrated DNA Technologies, Newark, NJ, USA) and hybridized for 10 min at room temperature.

Techniques: Flow Cytometry, Expressing, Cell Culture, CRISPR, Control

(A) Hepatic triglyceride and cholesterol levels were measured in the 1 st cohort mice 12th weeks after tamoxifen treatment. Images of control and UBC-SKO mice the livers are shown. (B) The mRNA expression of lipogenic and gluconeogenic-related genes in the liver, PGWAT, and muscle (1 st cohort of mice) (C) mRNA expression of NCoR1 in the liver, skeletal muscle, and PGWAT were quantified by qPCR. Protein expression of NCoR1 in the liver and heart were assessed by Western blot, using a NCoR1 specific antibody (n = 3–4 animals per group). Control samples are indicated by gray lanes and UBC-SKO mice are indicated by black lanes. For panel A and all qPCR analyses in panels B, and C, the data were analyzed using an unpaired t-test. These results are shown as the mean±SEM, and the p-values as; ****, p< 0.001; ***, p< 0.001; **, p< 0.01; *, p< 0.05 (1 st cohort of mice, n = 6–7 mice/group).

Journal: PLoS ONE

Article Title: Nuclear corepressor SMRT is a strong regulator of body weight independently of its ability to regulate thyroid hormone action

doi: 10.1371/journal.pone.0220717

Figure Lengend Snippet: (A) Hepatic triglyceride and cholesterol levels were measured in the 1 st cohort mice 12th weeks after tamoxifen treatment. Images of control and UBC-SKO mice the livers are shown. (B) The mRNA expression of lipogenic and gluconeogenic-related genes in the liver, PGWAT, and muscle (1 st cohort of mice) (C) mRNA expression of NCoR1 in the liver, skeletal muscle, and PGWAT were quantified by qPCR. Protein expression of NCoR1 in the liver and heart were assessed by Western blot, using a NCoR1 specific antibody (n = 3–4 animals per group). Control samples are indicated by gray lanes and UBC-SKO mice are indicated by black lanes. For panel A and all qPCR analyses in panels B, and C, the data were analyzed using an unpaired t-test. These results are shown as the mean±SEM, and the p-values as; ****, p< 0.001; ***, p< 0.001; **, p< 0.01; *, p< 0.05 (1 st cohort of mice, n = 6–7 mice/group).

Article Snippet: Briefly, blots of 50 μg protein lysate were probed for SMRT-specific antibody (rabbit polyclonal anti-SMRTe antibody, 06–891; Millipore) or NCoR1-specific (rabbit polyclonal anti-NCoR antibody, A301145A; Bethyl), and then appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies and visualized using ECL prime (GE Healthcare).

Techniques: Control, Expressing, Western Blot