Review





Similar Products

93
Addgene inc ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc
Ttgaacctgatctccatcca N A N A Recombinant Dna Pca24n Nbrp Rrid Ncbitaxon 146876 Pcp20 Cgsc Cgsc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc/product/Addgene inc
Average 93 stars, based on 1 article reviews
ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

90
BioResource International Inc nbrp- paramecium
Nbrp Paramecium, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nbrp- paramecium/product/BioResource International Inc
Average 90 stars, based on 1 article reviews
nbrp- paramecium - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
BioResource International Inc nbrp-rat
Nbrp Rat, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nbrp-rat/product/BioResource International Inc
Average 90 stars, based on 1 article reviews
nbrp-rat - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
BioResource International Inc t. varians (nbrp strain)
T. Varians (Nbrp Strain), supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t. varians (nbrp strain)/product/BioResource International Inc
Average 90 stars, based on 1 article reviews
t. varians (nbrp strain) - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
BioResource International Inc nbrp strain
Nbrp Strain, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nbrp strain/product/BioResource International Inc
Average 90 stars, based on 1 article reviews
nbrp strain - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
BioResource International Inc nbrp-rice
Nbrp Rice, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nbrp-rice/product/BioResource International Inc
Average 90 stars, based on 1 article reviews
nbrp-rice - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
BioResource International Inc f344- lgi1 m1kyo rats nbrp rat no. 0656
Schematic overview and experimental flow chart of in vivo microdialysis techniques (A). Glutamate and GABA release in the hippocampus. Extracellular levels of glutamate (B) and GABA (C) were compared between wild-type (WT) rats and <t>Lgi1</t> -mutant rats. Depolarization stimulation involved applying high-concentration K + (50 mM)-containing artificial cerebrospinal fluid (aCSF) for 60 min through the dialysis probe. Each point represents the mean ± S.E.M. of 5 or 6 animals. * P < 0.05, ** P < 0.01, significantly different from WT group.
F344 Lgi1 M1kyo Rats Nbrp Rat No. 0656, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/f344- lgi1 m1kyo rats nbrp rat no. 0656/product/BioResource International Inc
Average 90 stars, based on 1 article reviews
f344- lgi1 m1kyo rats nbrp rat no. 0656 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
BioResource International Inc nbrp moring glory
Schematic overview and experimental flow chart of in vivo microdialysis techniques (A). Glutamate and GABA release in the hippocampus. Extracellular levels of glutamate (B) and GABA (C) were compared between wild-type (WT) rats and <t>Lgi1</t> -mutant rats. Depolarization stimulation involved applying high-concentration K + (50 mM)-containing artificial cerebrospinal fluid (aCSF) for 60 min through the dialysis probe. Each point represents the mean ± S.E.M. of 5 or 6 animals. * P < 0.05, ** P < 0.01, significantly different from WT group.
Nbrp Moring Glory, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nbrp moring glory/product/BioResource International Inc
Average 90 stars, based on 1 article reviews
nbrp moring glory - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


Schematic overview and experimental flow chart of in vivo microdialysis techniques (A). Glutamate and GABA release in the hippocampus. Extracellular levels of glutamate (B) and GABA (C) were compared between wild-type (WT) rats and Lgi1 -mutant rats. Depolarization stimulation involved applying high-concentration K + (50 mM)-containing artificial cerebrospinal fluid (aCSF) for 60 min through the dialysis probe. Each point represents the mean ± S.E.M. of 5 or 6 animals. * P < 0.05, ** P < 0.01, significantly different from WT group.

Journal: Heliyon

Article Title: Imbalance of glutamatergic and GABAergic neurotransmission in audiogenic seizure-susceptible L eucine-rich glioma-inactivated 1 ( Lgi1 )-mutant rats

doi: 10.1016/j.heliyon.2023.e17984

Figure Lengend Snippet: Schematic overview and experimental flow chart of in vivo microdialysis techniques (A). Glutamate and GABA release in the hippocampus. Extracellular levels of glutamate (B) and GABA (C) were compared between wild-type (WT) rats and Lgi1 -mutant rats. Depolarization stimulation involved applying high-concentration K + (50 mM)-containing artificial cerebrospinal fluid (aCSF) for 60 min through the dialysis probe. Each point represents the mean ± S.E.M. of 5 or 6 animals. * P < 0.05, ** P < 0.01, significantly different from WT group.

Article Snippet: F344- Lgi1 m1Kyo rats (NBRP Rat No. 0656) with a heterozygous missense mutation (L385R/+) by N -ethyl- N -nitrosourea (ENU) mutagenesis techniques were provided by the National BioResource Project-Rat (NBRP-Rat, http://www.anim.med.kyoto-u.ac.jp ) [ ].

Techniques: In Vivo, Mutagenesis, Concentration Assay

Glutamate release in the hippocampus. Extracellular levels of glutamate were compared between non-primed wild-type (WT) and primed WT rats (A), non-primed Lgi1 -mutant and primed Lgi1 -mutant rats (B), and primed WT and primed Lgi1 -mutant rats (C) (data from B redisplayed for comparisons between non-primed rats and primed rats). Depolarization stimulation involved applying high-concentration K + (50 mM)-containing artificial cerebrospinal fluid (High K + ) for 60 min through the dialysis probe. Each point represents the mean ± S.E.M. of 5–7 animals. * P < 0.05, ** P < 0.01, significantly different from each other group.

Journal: Heliyon

Article Title: Imbalance of glutamatergic and GABAergic neurotransmission in audiogenic seizure-susceptible L eucine-rich glioma-inactivated 1 ( Lgi1 )-mutant rats

doi: 10.1016/j.heliyon.2023.e17984

Figure Lengend Snippet: Glutamate release in the hippocampus. Extracellular levels of glutamate were compared between non-primed wild-type (WT) and primed WT rats (A), non-primed Lgi1 -mutant and primed Lgi1 -mutant rats (B), and primed WT and primed Lgi1 -mutant rats (C) (data from B redisplayed for comparisons between non-primed rats and primed rats). Depolarization stimulation involved applying high-concentration K + (50 mM)-containing artificial cerebrospinal fluid (High K + ) for 60 min through the dialysis probe. Each point represents the mean ± S.E.M. of 5–7 animals. * P < 0.05, ** P < 0.01, significantly different from each other group.

Article Snippet: F344- Lgi1 m1Kyo rats (NBRP Rat No. 0656) with a heterozygous missense mutation (L385R/+) by N -ethyl- N -nitrosourea (ENU) mutagenesis techniques were provided by the National BioResource Project-Rat (NBRP-Rat, http://www.anim.med.kyoto-u.ac.jp ) [ ].

Techniques: Mutagenesis, Concentration Assay

GABA release in the hippocampus. Extracellular levels of GABA were compared between non-primed wild-type (WT) and primed WT rats (A), non-primed Lgi1 -mutant and primed Lgi1 -mutant rats (B), and primed WT and primed Lgi1 -mutant rats (C) (data from C redisplayed for comparisons between non-primed rats and primed rats). Depolarization stimulation involved applying high-concentration K + (50 mM)-containing artificial cerebrospinal fluid (High K + ) for 60 min. Each point represents the mean ± S.E.M. of 5–7 animals. ** P < 0.01, significantly different from each other group.

Journal: Heliyon

Article Title: Imbalance of glutamatergic and GABAergic neurotransmission in audiogenic seizure-susceptible L eucine-rich glioma-inactivated 1 ( Lgi1 )-mutant rats

doi: 10.1016/j.heliyon.2023.e17984

Figure Lengend Snippet: GABA release in the hippocampus. Extracellular levels of GABA were compared between non-primed wild-type (WT) and primed WT rats (A), non-primed Lgi1 -mutant and primed Lgi1 -mutant rats (B), and primed WT and primed Lgi1 -mutant rats (C) (data from C redisplayed for comparisons between non-primed rats and primed rats). Depolarization stimulation involved applying high-concentration K + (50 mM)-containing artificial cerebrospinal fluid (High K + ) for 60 min. Each point represents the mean ± S.E.M. of 5–7 animals. ** P < 0.01, significantly different from each other group.

Article Snippet: F344- Lgi1 m1Kyo rats (NBRP Rat No. 0656) with a heterozygous missense mutation (L385R/+) by N -ethyl- N -nitrosourea (ENU) mutagenesis techniques were provided by the National BioResource Project-Rat (NBRP-Rat, http://www.anim.med.kyoto-u.ac.jp ) [ ].

Techniques: Mutagenesis, Concentration Assay

Summarized results on hippocampal glutamate and GABA release in Lgi1 -mutant rats (A) and schematic drawing on the imbalance of glutamatergic and GABAergic neurotransmission potentially linked to audiogenic seizure-susceptibility in Lgi1 -mutant rats (B). Under naïve (non-primed) conditions, the Lgi1 -mutation potentiated high K + depolarization-evoked glutamate and GABA release. On the other hand, acoustic priming (AP) stimulation (at P16) increased the basal glutamate level both in Lgi1 -mutant and WT rats. It should be noted that, under primed condition, the Lgi1 -mutation caused enhanced glutamate release and diminished GABA release during high K + depolarization (shown in yellow). This imbalance of glutamatergic and GABAergic neurotransmission in primed Lgi1 -mutant rats may be involved in generation of audiogenic seizures associated with Lgi1 -mutation. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Journal: Heliyon

Article Title: Imbalance of glutamatergic and GABAergic neurotransmission in audiogenic seizure-susceptible L eucine-rich glioma-inactivated 1 ( Lgi1 )-mutant rats

doi: 10.1016/j.heliyon.2023.e17984

Figure Lengend Snippet: Summarized results on hippocampal glutamate and GABA release in Lgi1 -mutant rats (A) and schematic drawing on the imbalance of glutamatergic and GABAergic neurotransmission potentially linked to audiogenic seizure-susceptibility in Lgi1 -mutant rats (B). Under naïve (non-primed) conditions, the Lgi1 -mutation potentiated high K + depolarization-evoked glutamate and GABA release. On the other hand, acoustic priming (AP) stimulation (at P16) increased the basal glutamate level both in Lgi1 -mutant and WT rats. It should be noted that, under primed condition, the Lgi1 -mutation caused enhanced glutamate release and diminished GABA release during high K + depolarization (shown in yellow). This imbalance of glutamatergic and GABAergic neurotransmission in primed Lgi1 -mutant rats may be involved in generation of audiogenic seizures associated with Lgi1 -mutation. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Article Snippet: F344- Lgi1 m1Kyo rats (NBRP Rat No. 0656) with a heterozygous missense mutation (L385R/+) by N -ethyl- N -nitrosourea (ENU) mutagenesis techniques were provided by the National BioResource Project-Rat (NBRP-Rat, http://www.anim.med.kyoto-u.ac.jp ) [ ].

Techniques: Mutagenesis