Review



multi grna mix  (Synthego Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Synthego Inc multi grna mix
    Multi Grna Mix, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/multi-grna/grna+mix+multi/10__1158_slash_1078___0432__ccr___24___1977-94-15-17
    Average 86 stars, based on 1 article reviews
    multi grna mix - by Bioz Stars, 2026-10
    86/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Single-cell analysis defines a pancreatic fibroblast lineage that supports anti-tumor immunity
    Article Snippet: Ribonucleoprotein (RNP) complexes were formed by diluting 2 μL of 100 μM of multi-gRNA (Synthego) in Tris-EDTA (TE) (Synthego) and 1 μL of 20 μM recombinant Cas-9 (Integrated DNA Technologies (IDT), 1081059) in RNase-free PBS in 12 μL Primary Cell P3 Nucleofector solution (Lonza, V4XP-3032) and incubating at RT for 20 min. To 2.5x10 5 cells in 5 μL Nucelofector solution, 0.8 μL of Electroporation Enhancer Solution (IDT, Alt-R Cas9 Electroporation Enhancer, 2 nmol) was added, followed by 15 μL of the RNP solution and mixed by pipetting.

    Article Title: Single-cell analysis defines a pancreatic fibroblast lineage that supports anti-tumor immunity.
    Article Snippet: During optimization, KPC PDA cells on a B6 background were injected in 100 mL PBS (Thermo Fisher, 10010056) but this fails to retain fibroblasts within the growing tumor (see manuscript Figure S6).

    Article Title: SOX2 drives fetal reprogramming and reversible dormancy in colorectal cancer
    Article Snippet: Ribonucleoprotein (RNP) complexes were formed by diluting 2μl of 100 μM of multi-gRNA (Synthego) in Tris-EDTA (TE) (Synthego) and 1μl of 20μM recombinant Cas-9 (Integrated DNA Technologies (IDT), 1081059) in RNase-free PBS in 12μl Primary Cell P3 Nucleofector solution (Lonza, V4XP- 3032) and incubating at RT for 20 min. To 2.5×10 5 cells in 5μl Nucleofector solution, 0.8μl of Electroporation Enhancer Solution (IDT, Alt-R Cas9 Electroporation Enhancer, 2 nmol) was added, followed by 15μl of the RNP solution and mixed by pipetting.

    Electroporation:

    Article Title: Single-cell analysis defines a pancreatic fibroblast lineage that supports anti-tumor immunity
    Article Snippet: Ribonucleoprotein (RNP) complexes were formed by diluting 2 μL of 100 μM of multi-gRNA (Synthego) in Tris-EDTA (TE) (Synthego) and 1 μL of 20 μM recombinant Cas-9 (Integrated DNA Technologies (IDT), 1081059) in RNase-free PBS in 12 μL Primary Cell P3 Nucleofector solution (Lonza, V4XP-3032) and incubating at RT for 20 min. To 2.5x10 5 cells in 5 μL Nucelofector solution, 0.8 μL of Electroporation Enhancer Solution (IDT, Alt-R Cas9 Electroporation Enhancer, 2 nmol) was added, followed by 15 μL of the RNP solution and mixed by pipetting.

    Article Title: Single-cell analysis defines a pancreatic fibroblast lineage that supports anti-tumor immunity.
    Article Snippet: During optimization, KPC PDA cells on a B6 background were injected in 100 mL PBS (Thermo Fisher, 10010056) but this fails to retain fibroblasts within the growing tumor (see manuscript Figure S6).

    Article Title: SOX2 drives fetal reprogramming and reversible dormancy in colorectal cancer
    Article Snippet: Ribonucleoprotein (RNP) complexes were formed by diluting 2μl of 100 μM of multi-gRNA (Synthego) in Tris-EDTA (TE) (Synthego) and 1μl of 20μM recombinant Cas-9 (Integrated DNA Technologies (IDT), 1081059) in RNase-free PBS in 12μl Primary Cell P3 Nucleofector solution (Lonza, V4XP- 3032) and incubating at RT for 20 min. To 2.5×10 5 cells in 5μl Nucleofector solution, 0.8μl of Electroporation Enhancer Solution (IDT, Alt-R Cas9 Electroporation Enhancer, 2 nmol) was added, followed by 15μl of the RNP solution and mixed by pipetting.



    Similar Products

    multi grna mix  (Synthego Inc)
    86
    Synthego Inc multi grna mix
    Multi Grna Mix, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/multi-grna/grna+mix+multi/10__1158_slash_1078___0432__ccr___24___1977-94-15-17
    Average 86 stars, based on 1 article reviews
    multi grna mix - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    multi-grna  (Synthego Inc)
    90
    Synthego Inc multi-grna
    Multi Grna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/multi-grna/multi+grna/bio_rxiv__2024__09__11__612412-360-12-13
    Average 90 stars, based on 1 article reviews
    multi-grna - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    multi targeting grnas plasmid phage to dcas9 3xgfp expressing dcas9 3xgfp  (Addgene inc)
    93
    Addgene inc multi targeting grnas plasmid phage to dcas9 3xgfp expressing dcas9 3xgfp
    Multi Targeting Grnas Plasmid Phage To Dcas9 3xgfp Expressing Dcas9 3xgfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/multi-grna/pHAGE-TO-dCas9-3XGFP+(Plasmid+%2364107)/pm37953351-235-3-19
    Average 93 stars, based on 1 article reviews
    multi targeting grnas plasmid phage to dcas9 3xgfp expressing dcas9 3xgfp - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    fbxw7 multi-grna sequences  (Synthego Inc)
    90
    Synthego Inc fbxw7 multi-grna sequences
    Western blot validation (A) Western blot of <t>FBXW7</t> protein showing knockout. (B) FBXW7 protein expression relative to GAPDH (n = 3) ( p = 0.0015).
    Fbxw7 Multi Grna Sequences, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/multi-grna/fbxw7+multi+grna+sequences/pmc09826973-42-0-7
    Average 90 stars, based on 1 article reviews
    fbxw7 multi-grna sequences - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    multi-grna mix synthego  (Synthego Inc)
    90
    Synthego Inc multi-grna mix synthego
    Western blot validation (A) Western blot of <t>FBXW7</t> protein showing knockout. (B) FBXW7 protein expression relative to GAPDH (n = 3) ( p = 0.0015).
    Multi Grna Mix Synthego, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/multi-grna/multi+grna+mix+synthego/pmc08683436-357-15-17
    Average 90 stars, based on 1 article reviews
    multi-grna mix synthego - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    multi-grna approach  (Synthego Inc)
    90
    Synthego Inc multi-grna approach
    Western blot validation (A) Western blot of <t>FBXW7</t> protein showing knockout. (B) FBXW7 protein expression relative to GAPDH (n = 3) ( p = 0.0015).
    Multi Grna Approach, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/multi-grna/multi+grna+approach/pmc08683436-354-9-11
    Average 90 stars, based on 1 article reviews
    multi-grna approach - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Western blot validation (A) Western blot of FBXW7 protein showing knockout. (B) FBXW7 protein expression relative to GAPDH (n = 3) ( p = 0.0015).

    Journal: STAR Protocols

    Article Title: Generation and immunofluorescent validation of gene knockouts in adult human colonic organoids using multi-guide RNA CRISPR-Cas9

    doi: 10.1016/j.xpro.2022.101978

    Figure Lengend Snippet: Western blot validation (A) Western blot of FBXW7 protein showing knockout. (B) FBXW7 protein expression relative to GAPDH (n = 3) ( p = 0.0015).

    Article Snippet: FBXW7 multi-gRNA sequences: GCAAGGAATGGTGAAGTTGT GATGAATCGTGTGGTAGAGG AGCAAAAGACGACGAACTGG , Synthego , .

    Techniques: Western Blot, Biomarker Discovery, Knock-Out, Expressing

    Immunofluorescent validation Immunofluorescent validation of FBXW7 wild-type and knockout with DAPI (blue), F-actin (red) and FBXW7 (green). Scale bar equals 50 μm.

    Journal: STAR Protocols

    Article Title: Generation and immunofluorescent validation of gene knockouts in adult human colonic organoids using multi-guide RNA CRISPR-Cas9

    doi: 10.1016/j.xpro.2022.101978

    Figure Lengend Snippet: Immunofluorescent validation Immunofluorescent validation of FBXW7 wild-type and knockout with DAPI (blue), F-actin (red) and FBXW7 (green). Scale bar equals 50 μm.

    Article Snippet: FBXW7 multi-gRNA sequences: GCAAGGAATGGTGAAGTTGT GATGAATCGTGTGGTAGAGG AGCAAAAGACGACGAACTGG , Synthego , .

    Techniques: Biomarker Discovery, Knock-Out

    Journal: STAR Protocols

    Article Title: Generation and immunofluorescent validation of gene knockouts in adult human colonic organoids using multi-guide RNA CRISPR-Cas9

    doi: 10.1016/j.xpro.2022.101978

    Figure Lengend Snippet:

    Article Snippet: FBXW7 multi-gRNA sequences: GCAAGGAATGGTGAAGTTGT GATGAATCGTGTGGTAGAGG AGCAAAAGACGACGAACTGG , Synthego , .

    Techniques: Recombinant, Software, Cell Culture, Transferring, Membrane, Microscopy, Transfection