Review





Similar Products

gene exp oxtr rn00563503 m1  (Thermo Fisher)
87
Thermo Fisher gene exp oxtr rn00563503 m1
Gene Exp Oxtr Rn00563503 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp oxtr rn00563503 m1/product/Thermo Fisher
Average 87 stars, based on 1 article reviews
gene exp oxtr rn00563503 m1 - by Bioz Stars, 2026-05
87/100 stars
  Buy from Supplier
gene exp oxtr hs00168573 m1  (Thermo Fisher)
91
Thermo Fisher gene exp oxtr hs00168573 m1
Gene Exp Oxtr Hs00168573 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp oxtr hs00168573 m1/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
gene exp oxtr hs00168573 m1 - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier
oxtr cre mice  (Jackson Laboratory)
86
Jackson Laboratory oxtr cre mice
Oxtr Cre Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oxtr cre mice/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
oxtr cre mice - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier
mtr exon 4 6 r f ccagccacaaacctcttgac acacttggcctaccggatg  (Kaneka Corp)
86
Kaneka Corp mtr exon 4 6 r f ccagccacaaacctcttgac acacttggcctaccggatg
Mtr Exon 4 6 R F Ccagccacaaacctcttgac Acacttggcctaccggatg, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mtr exon 4 6 r f ccagccacaaacctcttgac acacttggcctaccggatg/product/Kaneka Corp
Average 86 stars, based on 1 article reviews
mtr exon 4 6 r f ccagccacaaacctcttgac acacttggcctaccggatg - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier
anti mtr polyclonal antibody  (Proteintech)
93
Proteintech anti mtr polyclonal antibody
Anti Mtr Polyclonal Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti mtr polyclonal antibody/product/Proteintech
Average 93 stars, based on 1 article reviews
anti mtr polyclonal antibody - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier
gene exp oxtr mm01182684 m1  (Thermo Fisher)
93
Thermo Fisher gene exp oxtr mm01182684 m1
Gene Exp Oxtr Mm01182684 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp oxtr mm01182684 m1/product/Thermo Fisher
Average 93 stars, based on 1 article reviews
gene exp oxtr mm01182684 m1 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier
gonadotropin  (Proteintech)
93
Proteintech gonadotropin
NGZT and SMX restore sex hormone balance and modulate the HPO axis. (A) Serum levels of progesterone in rats. (B) Serum levels of estradiol in rats. (C) Representative western blots of progesterone receptor (PR), estrogen receptor (ER), and oxytocin receptor (OTR) in the uterus. (D) Quantification of protein expression of PR, ER, and OTR in the uterus. (E) Quantification of mRNA expression of PR, ER, and OTR in the uterus. (F) Representative western blots of <t>gonadotropin-releasing</t> hormone receptor (GnRH-R) and GnRH in the ovaries. (G) Quantification of protein expression of GnRH-R and GnRH in the ovaries. (H) Quantification of mRNA expression of GnRH-R and GnRH in the ovaries. (I) Representative western blots of GnRH-R and GnRH in the hypothalami. (J) Quantification of protein expression of GnRH-R and GnRH in the hypothalami. (K) Quantification of mRNA expression of GnRH-R and GnRH in the hypothalami. Statistical significance was determined using one-way analysis of variance (ANOVA) followed by Tukey's multiple comparisons test.
Gonadotropin, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gonadotropin/product/Proteintech
Average 93 stars, based on 1 article reviews
gonadotropin - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier
transgenic oxt receptor oxtr cre mouse line b6 cg oxtrtm1 1 cre hze j  (Jackson Laboratory)
86
Jackson Laboratory transgenic oxt receptor oxtr cre mouse line b6 cg oxtrtm1 1 cre hze j
NGZT and SMX restore sex hormone balance and modulate the HPO axis. (A) Serum levels of progesterone in rats. (B) Serum levels of estradiol in rats. (C) Representative western blots of progesterone receptor (PR), estrogen receptor (ER), and oxytocin receptor (OTR) in the uterus. (D) Quantification of protein expression of PR, ER, and OTR in the uterus. (E) Quantification of mRNA expression of PR, ER, and OTR in the uterus. (F) Representative western blots of <t>gonadotropin-releasing</t> hormone receptor (GnRH-R) and GnRH in the ovaries. (G) Quantification of protein expression of GnRH-R and GnRH in the ovaries. (H) Quantification of mRNA expression of GnRH-R and GnRH in the ovaries. (I) Representative western blots of GnRH-R and GnRH in the hypothalami. (J) Quantification of protein expression of GnRH-R and GnRH in the hypothalami. (K) Quantification of mRNA expression of GnRH-R and GnRH in the hypothalami. Statistical significance was determined using one-way analysis of variance (ANOVA) followed by Tukey's multiple comparisons test.
Transgenic Oxt Receptor Oxtr Cre Mouse Line B6 Cg Oxtrtm1 1 Cre Hze J, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/transgenic oxt receptor oxtr cre mouse line b6 cg oxtrtm1 1 cre hze j/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
transgenic oxt receptor oxtr cre mouse line b6 cg oxtrtm1 1 cre hze j - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

Image Search Results


NGZT and SMX restore sex hormone balance and modulate the HPO axis. (A) Serum levels of progesterone in rats. (B) Serum levels of estradiol in rats. (C) Representative western blots of progesterone receptor (PR), estrogen receptor (ER), and oxytocin receptor (OTR) in the uterus. (D) Quantification of protein expression of PR, ER, and OTR in the uterus. (E) Quantification of mRNA expression of PR, ER, and OTR in the uterus. (F) Representative western blots of gonadotropin-releasing hormone receptor (GnRH-R) and GnRH in the ovaries. (G) Quantification of protein expression of GnRH-R and GnRH in the ovaries. (H) Quantification of mRNA expression of GnRH-R and GnRH in the ovaries. (I) Representative western blots of GnRH-R and GnRH in the hypothalami. (J) Quantification of protein expression of GnRH-R and GnRH in the hypothalami. (K) Quantification of mRNA expression of GnRH-R and GnRH in the hypothalami. Statistical significance was determined using one-way analysis of variance (ANOVA) followed by Tukey's multiple comparisons test.

Journal: Frontiers in Pain Research

Article Title: Integrated multi-omics elucidates the dual anti-inflammatory and neuroendocrine mechanisms of novel TCM plasters against primary dysmenorrhea

doi: 10.3389/fpain.2026.1727963

Figure Lengend Snippet: NGZT and SMX restore sex hormone balance and modulate the HPO axis. (A) Serum levels of progesterone in rats. (B) Serum levels of estradiol in rats. (C) Representative western blots of progesterone receptor (PR), estrogen receptor (ER), and oxytocin receptor (OTR) in the uterus. (D) Quantification of protein expression of PR, ER, and OTR in the uterus. (E) Quantification of mRNA expression of PR, ER, and OTR in the uterus. (F) Representative western blots of gonadotropin-releasing hormone receptor (GnRH-R) and GnRH in the ovaries. (G) Quantification of protein expression of GnRH-R and GnRH in the ovaries. (H) Quantification of mRNA expression of GnRH-R and GnRH in the ovaries. (I) Representative western blots of GnRH-R and GnRH in the hypothalami. (J) Quantification of protein expression of GnRH-R and GnRH in the hypothalami. (K) Quantification of mRNA expression of GnRH-R and GnRH in the hypothalami. Statistical significance was determined using one-way analysis of variance (ANOVA) followed by Tukey's multiple comparisons test.

Article Snippet: After blocking with 5% non-fat milk, the membranes were incubated overnight at 4 °C with primary antibodies against interleukin-6 (IL-6, 1:1000, Wanlei, WL02841), interleukin-1β (IL-1β, 1:1000, Affinity, AF5103), progesterone receptor (PR, 1:1000, Bioss, bs-23376R), cyclooxygenase-2 (COX-2, 1:2000, Proteintech, 66351-1-Ig), estrogen receptor (ER, 1:2000, Proteintech, 21244-1-AP), oxytocin receptor (OTR, 1:1500, Proteintech, 23045-1-AP), gonadotropin-releasing hormone receptor (GnRH-R, 1:1500, Proteintech, 22462-1-AP), and gonadotropin-releasing hormone (GnRH, 1:1000, Abclonal, A5625). β-actin (1:5000, TransGen, Q10410 ) or GAPDH (1:5000, TransGen, Q10614 ) served as the loading control.

Techniques: Western Blot, Expressing