Review



columns  (Miltenyi Biotec)


Bioz Verified Symbol Miltenyi Biotec is a verified supplier
Bioz Manufacturer Symbol Miltenyi Biotec manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    Miltenyi Biotec columns
    Columns, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 2449 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ms/MS+Columns/pm42885103-111-58-61
    Average 97 stars, based on 2449 article reviews
    columns - by Bioz Stars, 2026-10
    97/100 stars

    Images

    Related Articles

    other:

    Article Title: T and B cell responses against Epstein-Barr virus in primary sclerosing cholangitis.
    Article Snippet: Pooled samples were sequenced with Illumina Novaseq 6000 paired read sequencing with 75 bp (read 1) and 25 bp (read 2).

    Article Title: T and B cell responses against Epstein–Barr virus in primary sclerosing cholangitis
    Article Snippet: Sequencing was done on an Illumina NovaSeq machine (custom primers for R1: ttactcgagtgcggccgcaagctttca; for R2: tgtgtataagagacagatgctcggggatccgaattct; R1/R2 44/31 nt).

    Flow Cytometry:

    Article Title: Stable nanomagnetic particle dispersions
    Article Snippet: The final hydrodynamic size of these antibody-conjugated nanomagnetic particles was measured to be 83 nm. .. Although not thoroughly optimized, when this conjugated particle was used for targeting mouse CD4+ cells from splenocyte cell suspensions in conjunction with ‘MS’-type HGMS columns (Catalogue #130-042-201; Miltenyi Biotec Inc., Auburn, CA), purities and yields in excess of 90% were obtained as measured by flow cytometry with appropriate fluorescently labeled antibodies (FACSCalibur with CellQuest software; BD Biosciences, San Diego, CA). ..

    Labeling:

    Article Title: Stable nanomagnetic particle dispersions
    Article Snippet: The final hydrodynamic size of these antibody-conjugated nanomagnetic particles was measured to be 83 nm. .. Although not thoroughly optimized, when this conjugated particle was used for targeting mouse CD4+ cells from splenocyte cell suspensions in conjunction with ‘MS’-type HGMS columns (Catalogue #130-042-201; Miltenyi Biotec Inc., Auburn, CA), purities and yields in excess of 90% were obtained as measured by flow cytometry with appropriate fluorescently labeled antibodies (FACSCalibur with CellQuest software; BD Biosciences, San Diego, CA). ..

    Software:

    Article Title: Stable nanomagnetic particle dispersions
    Article Snippet: The final hydrodynamic size of these antibody-conjugated nanomagnetic particles was measured to be 83 nm. .. Although not thoroughly optimized, when this conjugated particle was used for targeting mouse CD4+ cells from splenocyte cell suspensions in conjunction with ‘MS’-type HGMS columns (Catalogue #130-042-201; Miltenyi Biotec Inc., Auburn, CA), purities and yields in excess of 90% were obtained as measured by flow cytometry with appropriate fluorescently labeled antibodies (FACSCalibur with CellQuest software; BD Biosciences, San Diego, CA). ..



    Similar Products

    columns  (Miltenyi Biotec)
    97
    Miltenyi Biotec columns
    Columns, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ms/MS+Columns/pm42885103-111-58-61
    Average 97 stars, based on 1 article reviews
    columns - by Bioz Stars, 2026-10
    97/100 stars
    		  Buy from Supplier
    liquid chromatography-tandem mass-spectrometry (lc-ms/ms  (Thermo Fisher)
    90
    Thermo Fisher liquid chromatography-tandem mass-spectrometry (lc-ms/ms
    Liquid Chromatography Tandem Mass Spectrometry (Lc Ms/Ms, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ms/nct06380387-31-10-23
    Average 90 stars, based on 1 article reviews
    liquid chromatography-tandem mass-spectrometry (lc-ms/ms - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    liquid chromatography mass spectrometry lc ms  (YMC America)
    99
    YMC America liquid chromatography mass spectrometry lc ms
    Reaction schemes <t>and</t> <t>LC-MS</t> analysis of Pp UGTs reactions with diosgenin and pennogenin . ( a ) Biosynthesis of trillin mediated by UGT91BP2 and UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of diosgenin. ( b ) Extracted ion chromatograms (EICs) of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and diosgenin showing the formation of trillin, as compared to the authentic trillin standard. Control is the empty expression vector. ( c ) MS spectra of the enzymatic reaction products in hydrogen and sodium ion adducts compared to the fragmentation pattern of the trillin standard. The product molecular ions [M + H] + and [M +Na] + and the feature fragment ion [M + H − Glc] + with m / z 415.32 are marked. Of note, additional peaks observed in the diosgenin EIC ( m / z 415.32) for UGT703R1–3 might correspond to substrate isomeric impurities, in-source adducts, or minor non-enzymatic by-products; these peaks, which arose from the extracted ion flow of the substrate m / z , did not co-elute with the product, trillin , and therefore did not affect the interpretation of the product formation. ( d ) Biosynthesis of pennogenin 3- O -glucoside mediated by the UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of pennogenin. ( e ) EICs of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and pennogenin showing the formation of pennogenin 3- O -glucoside, compared to the control empty expression vector. ( f ) MS/MS spectra ([M + H – Glc] + and [M + H – Glc − H 2 O] + ) of the enzymatic reaction products.
    Liquid Chromatography Mass Spectrometry Lc Ms, supplied by YMC America, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ms/YMC-Triart+C18/pmc13123502-92-0-8
    Average 99 stars, based on 1 article reviews
    liquid chromatography mass spectrometry lc ms - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    compact ptr-ms  (IONICON Inc)
    90
    IONICON Inc compact ptr-ms
    Reaction schemes <t>and</t> <t>LC-MS</t> analysis of Pp UGTs reactions with diosgenin and pennogenin . ( a ) Biosynthesis of trillin mediated by UGT91BP2 and UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of diosgenin. ( b ) Extracted ion chromatograms (EICs) of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and diosgenin showing the formation of trillin, as compared to the authentic trillin standard. Control is the empty expression vector. ( c ) MS spectra of the enzymatic reaction products in hydrogen and sodium ion adducts compared to the fragmentation pattern of the trillin standard. The product molecular ions [M + H] + and [M +Na] + and the feature fragment ion [M + H − Glc] + with m / z 415.32 are marked. Of note, additional peaks observed in the diosgenin EIC ( m / z 415.32) for UGT703R1–3 might correspond to substrate isomeric impurities, in-source adducts, or minor non-enzymatic by-products; these peaks, which arose from the extracted ion flow of the substrate m / z , did not co-elute with the product, trillin , and therefore did not affect the interpretation of the product formation. ( d ) Biosynthesis of pennogenin 3- O -glucoside mediated by the UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of pennogenin. ( e ) EICs of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and pennogenin showing the formation of pennogenin 3- O -glucoside, compared to the control empty expression vector. ( f ) MS/MS spectra ([M + H – Glc] + and [M + H – Glc − H 2 O] + ) of the enzymatic reaction products.
    Compact Ptr Ms, supplied by IONICON Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ms/compact+ptr+ms/nct05727852-2-9-15
    Average 90 stars, based on 1 article reviews
    compact ptr-ms - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    miseq reagent kit v3  (Illumina Inc)
    99
    Illumina Inc miseq reagent kit v3
    Reaction schemes <t>and</t> <t>LC-MS</t> analysis of Pp UGTs reactions with diosgenin and pennogenin . ( a ) Biosynthesis of trillin mediated by UGT91BP2 and UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of diosgenin. ( b ) Extracted ion chromatograms (EICs) of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and diosgenin showing the formation of trillin, as compared to the authentic trillin standard. Control is the empty expression vector. ( c ) MS spectra of the enzymatic reaction products in hydrogen and sodium ion adducts compared to the fragmentation pattern of the trillin standard. The product molecular ions [M + H] + and [M +Na] + and the feature fragment ion [M + H − Glc] + with m / z 415.32 are marked. Of note, additional peaks observed in the diosgenin EIC ( m / z 415.32) for UGT703R1–3 might correspond to substrate isomeric impurities, in-source adducts, or minor non-enzymatic by-products; these peaks, which arose from the extracted ion flow of the substrate m / z , did not co-elute with the product, trillin , and therefore did not affect the interpretation of the product formation. ( d ) Biosynthesis of pennogenin 3- O -glucoside mediated by the UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of pennogenin. ( e ) EICs of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and pennogenin showing the formation of pennogenin 3- O -glucoside, compared to the control empty expression vector. ( f ) MS/MS spectra ([M + H – Glc] + and [M + H – Glc − H 2 O] + ) of the enzymatic reaction products.
    Miseq Reagent Kit V3, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ms/MiSeq+Reagent+Kit+v3/pmc13673178-57-18-18
    Average 99 stars, based on 1 article reviews
    miseq reagent kit v3 - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    miseq reagent kit  (Illumina Inc)
    99
    Illumina Inc miseq reagent kit
    Reaction schemes <t>and</t> <t>LC-MS</t> analysis of Pp UGTs reactions with diosgenin and pennogenin . ( a ) Biosynthesis of trillin mediated by UGT91BP2 and UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of diosgenin. ( b ) Extracted ion chromatograms (EICs) of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and diosgenin showing the formation of trillin, as compared to the authentic trillin standard. Control is the empty expression vector. ( c ) MS spectra of the enzymatic reaction products in hydrogen and sodium ion adducts compared to the fragmentation pattern of the trillin standard. The product molecular ions [M + H] + and [M +Na] + and the feature fragment ion [M + H − Glc] + with m / z 415.32 are marked. Of note, additional peaks observed in the diosgenin EIC ( m / z 415.32) for UGT703R1–3 might correspond to substrate isomeric impurities, in-source adducts, or minor non-enzymatic by-products; these peaks, which arose from the extracted ion flow of the substrate m / z , did not co-elute with the product, trillin , and therefore did not affect the interpretation of the product formation. ( d ) Biosynthesis of pennogenin 3- O -glucoside mediated by the UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of pennogenin. ( e ) EICs of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and pennogenin showing the formation of pennogenin 3- O -glucoside, compared to the control empty expression vector. ( f ) MS/MS spectra ([M + H – Glc] + and [M + H – Glc − H 2 O] + ) of the enzymatic reaction products.
    Miseq Reagent Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ms/MiSeq+Reagent+Kit+v2/pm42837098-82-11-8
    Average 99 stars, based on 1 article reviews
    miseq reagent kit - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    lc ms ms system  (Shimadzu Corporation)
    99
    Shimadzu Corporation lc ms ms system
    Reaction schemes <t>and</t> <t>LC-MS</t> analysis of Pp UGTs reactions with diosgenin and pennogenin . ( a ) Biosynthesis of trillin mediated by UGT91BP2 and UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of diosgenin. ( b ) Extracted ion chromatograms (EICs) of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and diosgenin showing the formation of trillin, as compared to the authentic trillin standard. Control is the empty expression vector. ( c ) MS spectra of the enzymatic reaction products in hydrogen and sodium ion adducts compared to the fragmentation pattern of the trillin standard. The product molecular ions [M + H] + and [M +Na] + and the feature fragment ion [M + H − Glc] + with m / z 415.32 are marked. Of note, additional peaks observed in the diosgenin EIC ( m / z 415.32) for UGT703R1–3 might correspond to substrate isomeric impurities, in-source adducts, or minor non-enzymatic by-products; these peaks, which arose from the extracted ion flow of the substrate m / z , did not co-elute with the product, trillin , and therefore did not affect the interpretation of the product formation. ( d ) Biosynthesis of pennogenin 3- O -glucoside mediated by the UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of pennogenin. ( e ) EICs of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and pennogenin showing the formation of pennogenin 3- O -glucoside, compared to the control empty expression vector. ( f ) MS/MS spectra ([M + H – Glc] + and [M + H – Glc − H 2 O] + ) of the enzymatic reaction products.
    Lc Ms Ms System, supplied by Shimadzu Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ms/Nexera+Series/pm42892514-82-6-11
    Average 99 stars, based on 1 article reviews
    lc ms ms system - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    600 cycle v3 reagent kit  (Illumina Inc)
    99
    Illumina Inc 600 cycle v3 reagent kit
    Reaction schemes <t>and</t> <t>LC-MS</t> analysis of Pp UGTs reactions with diosgenin and pennogenin . ( a ) Biosynthesis of trillin mediated by UGT91BP2 and UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of diosgenin. ( b ) Extracted ion chromatograms (EICs) of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and diosgenin showing the formation of trillin, as compared to the authentic trillin standard. Control is the empty expression vector. ( c ) MS spectra of the enzymatic reaction products in hydrogen and sodium ion adducts compared to the fragmentation pattern of the trillin standard. The product molecular ions [M + H] + and [M +Na] + and the feature fragment ion [M + H − Glc] + with m / z 415.32 are marked. Of note, additional peaks observed in the diosgenin EIC ( m / z 415.32) for UGT703R1–3 might correspond to substrate isomeric impurities, in-source adducts, or minor non-enzymatic by-products; these peaks, which arose from the extracted ion flow of the substrate m / z , did not co-elute with the product, trillin , and therefore did not affect the interpretation of the product formation. ( d ) Biosynthesis of pennogenin 3- O -glucoside mediated by the UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of pennogenin. ( e ) EICs of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and pennogenin showing the formation of pennogenin 3- O -glucoside, compared to the control empty expression vector. ( f ) MS/MS spectra ([M + H – Glc] + and [M + H – Glc − H 2 O] + ) of the enzymatic reaction products.
    600 Cycle V3 Reagent Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ms/MiSeq+Reagent+Kit+v3/pm42888864-49-11-6
    Average 99 stars, based on 1 article reviews
    600 cycle v3 reagent kit - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    c mag magnetic stirrer  (IKA-Works inc)
    96
    IKA-Works inc c mag magnetic stirrer
    Reaction schemes <t>and</t> <t>LC-MS</t> analysis of Pp UGTs reactions with diosgenin and pennogenin . ( a ) Biosynthesis of trillin mediated by UGT91BP2 and UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of diosgenin. ( b ) Extracted ion chromatograms (EICs) of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and diosgenin showing the formation of trillin, as compared to the authentic trillin standard. Control is the empty expression vector. ( c ) MS spectra of the enzymatic reaction products in hydrogen and sodium ion adducts compared to the fragmentation pattern of the trillin standard. The product molecular ions [M + H] + and [M +Na] + and the feature fragment ion [M + H − Glc] + with m / z 415.32 are marked. Of note, additional peaks observed in the diosgenin EIC ( m / z 415.32) for UGT703R1–3 might correspond to substrate isomeric impurities, in-source adducts, or minor non-enzymatic by-products; these peaks, which arose from the extracted ion flow of the substrate m / z , did not co-elute with the product, trillin , and therefore did not affect the interpretation of the product formation. ( d ) Biosynthesis of pennogenin 3- O -glucoside mediated by the UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of pennogenin. ( e ) EICs of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and pennogenin showing the formation of pennogenin 3- O -glucoside, compared to the control empty expression vector. ( f ) MS/MS spectra ([M + H – Glc] + and [M + H – Glc − H 2 O] + ) of the enzymatic reaction products.
    C Mag Magnetic Stirrer, supplied by IKA-Works inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ms/IKA+C-MAG+MS+10+Magnetic+Stirrer/pm42883245-311-40-43
    Average 96 stars, based on 1 article reviews
    c mag magnetic stirrer - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    Reaction schemes and LC-MS analysis of Pp UGTs reactions with diosgenin and pennogenin . ( a ) Biosynthesis of trillin mediated by UGT91BP2 and UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of diosgenin. ( b ) Extracted ion chromatograms (EICs) of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and diosgenin showing the formation of trillin, as compared to the authentic trillin standard. Control is the empty expression vector. ( c ) MS spectra of the enzymatic reaction products in hydrogen and sodium ion adducts compared to the fragmentation pattern of the trillin standard. The product molecular ions [M + H] + and [M +Na] + and the feature fragment ion [M + H − Glc] + with m / z 415.32 are marked. Of note, additional peaks observed in the diosgenin EIC ( m / z 415.32) for UGT703R1–3 might correspond to substrate isomeric impurities, in-source adducts, or minor non-enzymatic by-products; these peaks, which arose from the extracted ion flow of the substrate m / z , did not co-elute with the product, trillin , and therefore did not affect the interpretation of the product formation. ( d ) Biosynthesis of pennogenin 3- O -glucoside mediated by the UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of pennogenin. ( e ) EICs of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and pennogenin showing the formation of pennogenin 3- O -glucoside, compared to the control empty expression vector. ( f ) MS/MS spectra ([M + H – Glc] + and [M + H – Glc − H 2 O] + ) of the enzymatic reaction products.

    Journal: Synthetic and Systems Biotechnology

    Article Title: Functional characterization of four glycosyltransferases for biosynthesis of steroidal saponins in medicinal plant Paris polyphylla

    doi: 10.1016/j.synbio.2026.04.002

    Figure Lengend Snippet: Reaction schemes and LC-MS analysis of Pp UGTs reactions with diosgenin and pennogenin . ( a ) Biosynthesis of trillin mediated by UGT91BP2 and UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of diosgenin. ( b ) Extracted ion chromatograms (EICs) of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and diosgenin showing the formation of trillin, as compared to the authentic trillin standard. Control is the empty expression vector. ( c ) MS spectra of the enzymatic reaction products in hydrogen and sodium ion adducts compared to the fragmentation pattern of the trillin standard. The product molecular ions [M + H] + and [M +Na] + and the feature fragment ion [M + H − Glc] + with m / z 415.32 are marked. Of note, additional peaks observed in the diosgenin EIC ( m / z 415.32) for UGT703R1–3 might correspond to substrate isomeric impurities, in-source adducts, or minor non-enzymatic by-products; these peaks, which arose from the extracted ion flow of the substrate m / z , did not co-elute with the product, trillin , and therefore did not affect the interpretation of the product formation. ( d ) Biosynthesis of pennogenin 3- O -glucoside mediated by the UGT703R1–3 through transferring glucose from UDP-glucose to the C-3 OH position of pennogenin. ( e ) EICs of the in vitro enzyme activity assays of recombinant UGT91BP2 and UGT703R1–3 with UDP-glucose and pennogenin showing the formation of pennogenin 3- O -glucoside, compared to the control empty expression vector. ( f ) MS/MS spectra ([M + H – Glc] + and [M + H – Glc − H 2 O] + ) of the enzymatic reaction products.

    Article Snippet: Liquid chromatography-mass spectrometry (LC-MS) was equipped with a YMC-Triart C18 column (250 mm × 4.6 mm, 5 μm), and the column temperature was set to 30 °C.

    Techniques: Liquid Chromatography with Mass Spectroscopy, Transferring, In Vitro, Activity Assay, Recombinant, Control, Expressing, Plasmid Preparation, Tandem Mass Spectroscopy