Review



mitochondria complex iv  (Proteintech)


Bioz Verified Symbol Proteintech is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Proteintech mitochondria complex iv
    Mitochondria Complex Iv, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 214 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mitochondria+complex+iv/MTCO2+Polyclonal+antibody/pm41733415-74-47-70
    Average 96 stars, based on 214 article reviews
    mitochondria complex iv - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    other:

    Article Title: AMPK Deficiency Induces Corneal Epithelial Barrier Dysfunction by Modulating Energy Homeostasis.
    Article Snippet: AMPKα1 TTGAAACCTGAAAATGTCCTGCT GGTGAGCCACAACTTGTTCTT Homo AMPKα2 CTGTAAGCATGGACGGGTTGA AAATCGGCTATCTTGGCATTCA Homo PFKFB3 CTCGCATCAACAGCTTTGAGG TCAGTGTTTCCTGGAGGAGTC Homo IL-1β CTGTCCTGCGTGTTGAAAGA TTGGGTAATTTTTGGGATCTACA Homo TNFα CTCTTCTGCCTGCTGCACTTTG ATGGGCTACAGGCTTGTCACTC Homo β-actin AGAAAATCTGGCACCACACC TAGCACAGCCTGGATAGCAA Homo IL1β GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT Mouse TNFα CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG Mouse β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT Mouse Downloaded from iovs.arvojournals.org on 02/26/2026 1β (16806-1-AP, 1:1000), IL-10 (60269-1-lg, 1:1000), Mitochondria Complex IV (MTCO2, 55070-1-AP, 1:1000), β-actin (HRP-60008, 1:10,000), and secondary antibodies (HRPconjugated goat anti-rabbit IgG or goat anti-mouse IgG), all purchased from Proteintech (Wuhan, China).

    Article Title: AMPK Deficiency Induces Corneal Epithelial Barrier Dysfunction by Modulating Energy Homeostasis
    Article Snippet: Primary antibodies used in this study were as follows: p-AMPKα (2535, 1:1000), AMPKα (5831, 1:1000), phosphorylated acetyl-CoA carboxylase (p-ACC, 11818, 1:1000), ACC (3676, 1:1000), and Dynamin-related protein 1 (DRP1; 5391, 1:1000) from Cell Signaling Technology (Danvers, MA, USA); ZO-1 (21773-1-AP, 1:1000), Occludin (66378-1-lg, 1:1000), E-cadherin (CDH, 20874-1-AP, 1:1000), Mitofusion 2 (MFN2, 12186-1-AP, 1:1000), Optic atrophy 1 (OPA1, 27733-1-AP, 1:1000), MFF (17090-1-AP, 1:1000), IL-1β (16806-1-AP, 1:1000), IL-10 (60269-1-lg, 1:1000), Mitochondria Complex IV (MTCO2, 55070-1-AP, 1:1000), β-actin (HRP-60008, 1:10,000), and secondary antibodies (HRP-conjugated goat anti-rabbit IgG or goat anti-mouse IgG), all purchased from Proteintech (Wuhan, China).



    Similar Products

    mitochondria complex iv  (Proteintech)
    96
    Proteintech mitochondria complex iv
    Mitochondria Complex Iv, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mitochondria+complex+iv/MTCO2+Polyclonal+antibody/pm41733415-74-47-70
    Average 96 stars, based on 1 article reviews
    mitochondria complex iv - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    mitochondria respiratory chain complex i, ii, iii, and iv assay kit  (Nanjing Jiancheng Bioengineering Research Institute Co Ltd)
    90
    Nanjing Jiancheng Bioengineering Research Institute Co Ltd mitochondria respiratory chain complex i, ii, iii, and iv assay kit
    Mitochondria Respiratory Chain Complex I, Ii, Iii, And Iv Assay Kit, supplied by Nanjing Jiancheng Bioengineering Research Institute Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mitochondria+complex+iv/mitochondrial+respiratory+chain+complex+assay+kit/pm40188484-130-8-13
    Average 90 stars, based on 1 article reviews
    mitochondria respiratory chain complex i, ii, iii, and iv assay kit - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    mitochondria respiratory chain complex (i, ii, iii and iv) activities  (Beijing Solarbio Science)
    90
    Beijing Solarbio Science mitochondria respiratory chain complex (i, ii, iii and iv) activities
    Mitochondria Respiratory Chain Complex (I, Ii, Iii And Iv) Activities, supplied by Beijing Solarbio Science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mitochondria+complex+iv/mitochondria+respiratory+chain+complex+i+activity/pm38039759-94-22-37
    Average 90 stars, based on 1 article reviews
    mitochondria respiratory chain complex (i, ii, iii and iv) activities - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    mitochondria respiratory chain complex iv assay kit  (Nanjing Jiancheng Bioengineering Research Institute Co Ltd)
    90
    Nanjing Jiancheng Bioengineering Research Institute Co Ltd mitochondria respiratory chain complex iv assay kit
    Impairment of mitochondrial dynamics and disruption of energy metabolism occur as a consequence of CORT exposure (A) Morphology of <t>mitochondria</t> of heart of chicken embryos, heart of 4-week-old mice, and H9c2 cells was detected by transmission electron microscopy (TEM). Scale bar: 500 nm. The yellow arrows represent impaired mitochondria. The quantitative analysis of area and aspect ratio of mitochondria was performed by ImageJ software. Center line, median; box, interquartile range; whiskers, range; bars, maximum and minimum. (B) The mitochondria of H9c2 cells were labeled with Mito-Red probe and examined by confocal microscopy. Scale bar: 10 μm. (C and D) The content of ATP in H9c2 cells (n = 3) or heart of chicken embryos (n = 4). In (D), center line, median; box, interquartile range; whiskers, range; bars, maximum and minimum. (E) Seahorse analysis of OXPHOS in H9c2 cells (n = 4). (F) Seahorse analysis of OXPHOS of separated heart mitochondria in 4-week-old mice (n = 5). (G and H) Activities of mitochondrial <t>respiratory</t> chain complex in H9c2 cells (n = 3) or hearts of EDD14 chicken embryo were measured by commercial kits (n = 3–4). Data are expressed as the mean ± SD (unless otherwise indicated) and subjected to statistical analysis using unpaired Student’s t test or one-way ANOVA followed by Dunnett’s multiple comparison test; ns (not significant); ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 vs. the indicated group.
    Mitochondria Respiratory Chain Complex Iv Assay Kit, supplied by Nanjing Jiancheng Bioengineering Research Institute Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mitochondria+complex+iv/mitochondrial+respiratory+chain+complex+assay+kit/pmc10792244-60-0-8
    Average 90 stars, based on 1 article reviews
    mitochondria respiratory chain complex iv assay kit - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    mitochondria complexes i, ii, iv and v testing kits  (Beijing Solarbio Science)
    90
    Beijing Solarbio Science mitochondria complexes i, ii, iv and v testing kits
    Impairment of mitochondrial dynamics and disruption of energy metabolism occur as a consequence of CORT exposure (A) Morphology of <t>mitochondria</t> of heart of chicken embryos, heart of 4-week-old mice, and H9c2 cells was detected by transmission electron microscopy (TEM). Scale bar: 500 nm. The yellow arrows represent impaired mitochondria. The quantitative analysis of area and aspect ratio of mitochondria was performed by ImageJ software. Center line, median; box, interquartile range; whiskers, range; bars, maximum and minimum. (B) The mitochondria of H9c2 cells were labeled with Mito-Red probe and examined by confocal microscopy. Scale bar: 10 μm. (C and D) The content of ATP in H9c2 cells (n = 3) or heart of chicken embryos (n = 4). In (D), center line, median; box, interquartile range; whiskers, range; bars, maximum and minimum. (E) Seahorse analysis of OXPHOS in H9c2 cells (n = 4). (F) Seahorse analysis of OXPHOS of separated heart mitochondria in 4-week-old mice (n = 5). (G and H) Activities of mitochondrial <t>respiratory</t> chain complex in H9c2 cells (n = 3) or hearts of EDD14 chicken embryo were measured by commercial kits (n = 3–4). Data are expressed as the mean ± SD (unless otherwise indicated) and subjected to statistical analysis using unpaired Student’s t test or one-way ANOVA followed by Dunnett’s multiple comparison test; ns (not significant); ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 vs. the indicated group.
    Mitochondria Complexes I, Ii, Iv And V Testing Kits, supplied by Beijing Solarbio Science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mitochondria+complex+iv/mitochondria+complexes+i++ii++iv+and+v+testing+kits/pm37807765-335-19-25
    Average 90 stars, based on 1 article reviews
    mitochondria complexes i, ii, iv and v testing kits - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    mitochondria complex iv reagent gms500010  (Genmed Inc)
    90
    Genmed Inc mitochondria complex iv reagent gms500010
    Impairment of mitochondrial dynamics and disruption of energy metabolism occur as a consequence of CORT exposure (A) Morphology of <t>mitochondria</t> of heart of chicken embryos, heart of 4-week-old mice, and H9c2 cells was detected by transmission electron microscopy (TEM). Scale bar: 500 nm. The yellow arrows represent impaired mitochondria. The quantitative analysis of area and aspect ratio of mitochondria was performed by ImageJ software. Center line, median; box, interquartile range; whiskers, range; bars, maximum and minimum. (B) The mitochondria of H9c2 cells were labeled with Mito-Red probe and examined by confocal microscopy. Scale bar: 10 μm. (C and D) The content of ATP in H9c2 cells (n = 3) or heart of chicken embryos (n = 4). In (D), center line, median; box, interquartile range; whiskers, range; bars, maximum and minimum. (E) Seahorse analysis of OXPHOS in H9c2 cells (n = 4). (F) Seahorse analysis of OXPHOS of separated heart mitochondria in 4-week-old mice (n = 5). (G and H) Activities of mitochondrial <t>respiratory</t> chain complex in H9c2 cells (n = 3) or hearts of EDD14 chicken embryo were measured by commercial kits (n = 3–4). Data are expressed as the mean ± SD (unless otherwise indicated) and subjected to statistical analysis using unpaired Student’s t test or one-way ANOVA followed by Dunnett’s multiple comparison test; ns (not significant); ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 vs. the indicated group.
    Mitochondria Complex Iv Reagent Gms500010, supplied by Genmed Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mitochondria+complex+iv/mitochondria+complex+iv+reagent+gms500010/pm27156064-40-12-21
    Average 90 stars, based on 1 article reviews
    mitochondria complex iv reagent gms500010 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    mitochondria complex iv subunit(17 ca  (Becton Dickinson)
    90
    Becton Dickinson mitochondria complex iv subunit(17 ca
    Impairment of mitochondrial dynamics and disruption of energy metabolism occur as a consequence of CORT exposure (A) Morphology of <t>mitochondria</t> of heart of chicken embryos, heart of 4-week-old mice, and H9c2 cells was detected by transmission electron microscopy (TEM). Scale bar: 500 nm. The yellow arrows represent impaired mitochondria. The quantitative analysis of area and aspect ratio of mitochondria was performed by ImageJ software. Center line, median; box, interquartile range; whiskers, range; bars, maximum and minimum. (B) The mitochondria of H9c2 cells were labeled with Mito-Red probe and examined by confocal microscopy. Scale bar: 10 μm. (C and D) The content of ATP in H9c2 cells (n = 3) or heart of chicken embryos (n = 4). In (D), center line, median; box, interquartile range; whiskers, range; bars, maximum and minimum. (E) Seahorse analysis of OXPHOS in H9c2 cells (n = 4). (F) Seahorse analysis of OXPHOS of separated heart mitochondria in 4-week-old mice (n = 5). (G and H) Activities of mitochondrial <t>respiratory</t> chain complex in H9c2 cells (n = 3) or hearts of EDD14 chicken embryo were measured by commercial kits (n = 3–4). Data are expressed as the mean ± SD (unless otherwise indicated) and subjected to statistical analysis using unpaired Student’s t test or one-way ANOVA followed by Dunnett’s multiple comparison test; ns (not significant); ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 vs. the indicated group.
    Mitochondria Complex Iv Subunit(17 Ca, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mitochondria+complex+iv/mitochondria+complex+iv+subunit+17+ca+antibody/pmc04167490-70-20-27
    Average 90 stars, based on 1 article reviews
    mitochondria complex iv subunit(17 ca - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    mitochondria complex iv activity assay kit  (Genmed Inc)
    90
    Genmed Inc mitochondria complex iv activity assay kit
    Impairment of mitochondrial dynamics and disruption of energy metabolism occur as a consequence of CORT exposure (A) Morphology of <t>mitochondria</t> of heart of chicken embryos, heart of 4-week-old mice, and H9c2 cells was detected by transmission electron microscopy (TEM). Scale bar: 500 nm. The yellow arrows represent impaired mitochondria. The quantitative analysis of area and aspect ratio of mitochondria was performed by ImageJ software. Center line, median; box, interquartile range; whiskers, range; bars, maximum and minimum. (B) The mitochondria of H9c2 cells were labeled with Mito-Red probe and examined by confocal microscopy. Scale bar: 10 μm. (C and D) The content of ATP in H9c2 cells (n = 3) or heart of chicken embryos (n = 4). In (D), center line, median; box, interquartile range; whiskers, range; bars, maximum and minimum. (E) Seahorse analysis of OXPHOS in H9c2 cells (n = 4). (F) Seahorse analysis of OXPHOS of separated heart mitochondria in 4-week-old mice (n = 5). (G and H) Activities of mitochondrial <t>respiratory</t> chain complex in H9c2 cells (n = 3) or hearts of EDD14 chicken embryo were measured by commercial kits (n = 3–4). Data are expressed as the mean ± SD (unless otherwise indicated) and subjected to statistical analysis using unpaired Student’s t test or one-way ANOVA followed by Dunnett’s multiple comparison test; ns (not significant); ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 vs. the indicated group.
    Mitochondria Complex Iv Activity Assay Kit, supplied by Genmed Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mitochondria+complex+iv/mitochondrial+respiratory+chain+complexes+activity+assay+kits/pm24837196-102-24-30
    Average 90 stars, based on 1 article reviews
    mitochondria complex iv activity assay kit - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Impairment of mitochondrial dynamics and disruption of energy metabolism occur as a consequence of CORT exposure (A) Morphology of mitochondria of heart of chicken embryos, heart of 4-week-old mice, and H9c2 cells was detected by transmission electron microscopy (TEM). Scale bar: 500 nm. The yellow arrows represent impaired mitochondria. The quantitative analysis of area and aspect ratio of mitochondria was performed by ImageJ software. Center line, median; box, interquartile range; whiskers, range; bars, maximum and minimum. (B) The mitochondria of H9c2 cells were labeled with Mito-Red probe and examined by confocal microscopy. Scale bar: 10 μm. (C and D) The content of ATP in H9c2 cells (n = 3) or heart of chicken embryos (n = 4). In (D), center line, median; box, interquartile range; whiskers, range; bars, maximum and minimum. (E) Seahorse analysis of OXPHOS in H9c2 cells (n = 4). (F) Seahorse analysis of OXPHOS of separated heart mitochondria in 4-week-old mice (n = 5). (G and H) Activities of mitochondrial respiratory chain complex in H9c2 cells (n = 3) or hearts of EDD14 chicken embryo were measured by commercial kits (n = 3–4). Data are expressed as the mean ± SD (unless otherwise indicated) and subjected to statistical analysis using unpaired Student’s t test or one-way ANOVA followed by Dunnett’s multiple comparison test; ns (not significant); ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 vs. the indicated group.

    Journal: iScience

    Article Title: Prenatal hormone stress triggers embryonic cardiac hypertrophy outcome by ubiquitin-dependent degradation of mitochondrial mitofusin 2

    doi: 10.1016/j.isci.2023.108690

    Figure Lengend Snippet: Impairment of mitochondrial dynamics and disruption of energy metabolism occur as a consequence of CORT exposure (A) Morphology of mitochondria of heart of chicken embryos, heart of 4-week-old mice, and H9c2 cells was detected by transmission electron microscopy (TEM). Scale bar: 500 nm. The yellow arrows represent impaired mitochondria. The quantitative analysis of area and aspect ratio of mitochondria was performed by ImageJ software. Center line, median; box, interquartile range; whiskers, range; bars, maximum and minimum. (B) The mitochondria of H9c2 cells were labeled with Mito-Red probe and examined by confocal microscopy. Scale bar: 10 μm. (C and D) The content of ATP in H9c2 cells (n = 3) or heart of chicken embryos (n = 4). In (D), center line, median; box, interquartile range; whiskers, range; bars, maximum and minimum. (E) Seahorse analysis of OXPHOS in H9c2 cells (n = 4). (F) Seahorse analysis of OXPHOS of separated heart mitochondria in 4-week-old mice (n = 5). (G and H) Activities of mitochondrial respiratory chain complex in H9c2 cells (n = 3) or hearts of EDD14 chicken embryo were measured by commercial kits (n = 3–4). Data are expressed as the mean ± SD (unless otherwise indicated) and subjected to statistical analysis using unpaired Student’s t test or one-way ANOVA followed by Dunnett’s multiple comparison test; ns (not significant); ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 vs. the indicated group.

    Article Snippet: Mitochondria respiratory chain complex IV assay kit , Nanjing Jiancheng Bioengineering Institute , Cat#: A089-4-1.

    Techniques: Disruption, Transmission Assay, Electron Microscopy, Software, Labeling, Confocal Microscopy, Comparison

    Journal: iScience

    Article Title: Prenatal hormone stress triggers embryonic cardiac hypertrophy outcome by ubiquitin-dependent degradation of mitochondrial mitofusin 2

    doi: 10.1016/j.isci.2023.108690

    Figure Lengend Snippet:

    Article Snippet: Mitochondria respiratory chain complex IV assay kit , Nanjing Jiancheng Bioengineering Institute , Cat#: A089-4-1.

    Techniques: Ubiquitin Proteomics, Recombinant, Protease Inhibitor, Lysis, Western Blot, ATP Assay, Isolation, Staining, Modification, Bicinchoninic Acid Protein Assay, Sequencing, Plasmid Preparation, Software