Review





Similar Products

96
New England Biolabs paqci digested 8 mer fragments
Paqci Digested 8 Mer Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mers/bio_rxiv__64898__2026__05__07__722278-341-16-53?v=New+England+Biolabs
Average 96 stars, based on 1 article reviews
paqci digested 8 mer fragments - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

95
Sino Biological mers cov pseudovirus
Mers Cov Pseudovirus, supplied by Sino Biological, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mers/pm42034896-58-25-31?v=Sino+Biological
Average 95 stars, based on 1 article reviews
mers cov pseudovirus - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

86
Micromedex Inc merative micromedex red book
Merative Micromedex Red Book, supplied by Micromedex Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mers/pm42301711-82-16-17?v=Micromedex+Inc
Average 86 stars, based on 1 article reviews
merative micromedex red book - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Pfizer Inc type i axl mer inhibitor macrocyclic compound 1
Molecular docking results of three compounds with the kinase domains of MER and AXL. (A) Molecular docking of merestinib with MER kinase domain (PDB: 7AAY ). (B) Binding mode analysis of <t>compound</t> <t>1</t> to the AXL kinase domain (PDB: 5U6B ). (C) Molecular docking of merestinib with AXL DFG-out homologous modeling. (D) Molecular docking of compound w4 with AXL DFG-out homologous modeling.
Type I Axl Mer Inhibitor Macrocyclic Compound 1, supplied by Pfizer Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mers/pmc13280880-66-20-4?v=Pfizer+Inc
Average 86 stars, based on 1 article reviews
type i axl mer inhibitor macrocyclic compound 1 - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Mimotopes biotinylated 15 mer peptides to p67c
<t>p67C-CoPoP</t> liposome nanoparticle characterisation. ( A ) Schematic representation of the generation of CoPoP liposomes with p67C antigen, including the schematic illustrations of the chemical structures of the key adjuvanting molecules. ( B ) Binding capacity of the p67C antigen to CoPoP liposomes after 3 h incubation in the dark, analysed using HisPur™ Ni-NTA Magnetic Beads and assessed by SDS-PAGE. Formulations included: CA (CoPoP only), CQ (CoPoP/QS-21), CP (CoPoP/PHAD), and CPQ (CoPoP/PHAD/QS-21), compared to soluble p67C (PBS). Non-liposome-bound antigen is shown in lanes “B”, while liposome-bound is shown in lanes “S”. The uncropped blots are shown in . ( C ) Binding capacity of fluorophore-labelled p67C-DY490 to CoPoP liposomes (CA, CQ, CP, and CPQ) was measured and compared with p67C bound to AS01, and ( D ) size and ( E ) zeta potential of p67C bound to CoPoP liposomes were measured by DLS.
Biotinylated 15 Mer Peptides To P67c, supplied by Mimotopes, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mers/pmc13211421-118-13-18?v=Mimotopes
Average 86 stars, based on 1 article reviews
biotinylated 15 mer peptides to p67c - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Sangon Biotech synthetic peptides 34 mer
<t>p67C-CoPoP</t> liposome nanoparticle characterisation. ( A ) Schematic representation of the generation of CoPoP liposomes with p67C antigen, including the schematic illustrations of the chemical structures of the key adjuvanting molecules. ( B ) Binding capacity of the p67C antigen to CoPoP liposomes after 3 h incubation in the dark, analysed using HisPur™ Ni-NTA Magnetic Beads and assessed by SDS-PAGE. Formulations included: CA (CoPoP only), CQ (CoPoP/QS-21), CP (CoPoP/PHAD), and CPQ (CoPoP/PHAD/QS-21), compared to soluble p67C (PBS). Non-liposome-bound antigen is shown in lanes “B”, while liposome-bound is shown in lanes “S”. The uncropped blots are shown in . ( C ) Binding capacity of fluorophore-labelled p67C-DY490 to CoPoP liposomes (CA, CQ, CP, and CPQ) was measured and compared with p67C bound to AS01, and ( D ) size and ( E ) zeta potential of p67C bound to CoPoP liposomes were measured by DLS.
Synthetic Peptides 34 Mer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mers/pmc13164576-79-1-36?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
synthetic peptides 34 mer - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

95
Sino Biological mers cov s1 protein
<t>p67C-CoPoP</t> liposome nanoparticle characterisation. ( A ) Schematic representation of the generation of CoPoP liposomes with p67C antigen, including the schematic illustrations of the chemical structures of the key adjuvanting molecules. ( B ) Binding capacity of the p67C antigen to CoPoP liposomes after 3 h incubation in the dark, analysed using HisPur™ Ni-NTA Magnetic Beads and assessed by SDS-PAGE. Formulations included: CA (CoPoP only), CQ (CoPoP/QS-21), CP (CoPoP/PHAD), and CPQ (CoPoP/PHAD/QS-21), compared to soluble p67C (PBS). Non-liposome-bound antigen is shown in lanes “B”, while liposome-bound is shown in lanes “S”. The uncropped blots are shown in . ( C ) Binding capacity of fluorophore-labelled p67C-DY490 to CoPoP liposomes (CA, CQ, CP, and CPQ) was measured and compared with p67C bound to AS01, and ( D ) size and ( E ) zeta potential of p67C bound to CoPoP liposomes were measured by DLS.
Mers Cov S1 Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mers/us12600988-57-79-82?v=Sino+Biological
Average 95 stars, based on 1 article reviews
mers cov s1 protein - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

96
New England Biolabs 35 mer oligonucleotide tet cccagtcacgacgttgtaaaacgacggccagtgcc
Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled <t>35–mer</t> oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.
35 Mer Oligonucleotide Tet Cccagtcacgacgttgtaaaacgacggccagtgcc, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mers/pmc13036494-47-16-12?v=New+England+Biolabs
Average 96 stars, based on 1 article reviews
35 mer oligonucleotide tet cccagtcacgacgttgtaaaacgacggccagtgcc - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

94
Quantum Detectors Ltd scan engine
Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled <t>35–mer</t> oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.
Scan Engine, supplied by Quantum Detectors Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mers/pm41949033-33-8-10?v=Quantum+Detectors+Ltd
Average 94 stars, based on 1 article reviews
scan engine - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

Image Search Results


Molecular docking results of three compounds with the kinase domains of MER and AXL. (A) Molecular docking of merestinib with MER kinase domain (PDB: 7AAY ). (B) Binding mode analysis of compound 1 to the AXL kinase domain (PDB: 5U6B ). (C) Molecular docking of merestinib with AXL DFG-out homologous modeling. (D) Molecular docking of compound w4 with AXL DFG-out homologous modeling.

Journal: ACS Omega

Article Title: Structure-Based Drug Discovery of Triazine Derivatives as Potent and Orally Bioavailable AXL Inhibitors for Cancer Therapy

doi: 10.1021/acsomega.6c04179

Figure Lengend Snippet: Molecular docking results of three compounds with the kinase domains of MER and AXL. (A) Molecular docking of merestinib with MER kinase domain (PDB: 7AAY ). (B) Binding mode analysis of compound 1 to the AXL kinase domain (PDB: 5U6B ). (C) Molecular docking of merestinib with AXL DFG-out homologous modeling. (D) Molecular docking of compound w4 with AXL DFG-out homologous modeling.

Article Snippet: In 2017, researchers from Pfizer reported the X-ray cocrystal structures of AXL and MER kinase domains in complex with a type I AXL/MER inhibitor macrocyclic compound 1 , and elucidated the differences between the kinase ATP binding sites.

Techniques: Binding Assay

p67C-CoPoP liposome nanoparticle characterisation. ( A ) Schematic representation of the generation of CoPoP liposomes with p67C antigen, including the schematic illustrations of the chemical structures of the key adjuvanting molecules. ( B ) Binding capacity of the p67C antigen to CoPoP liposomes after 3 h incubation in the dark, analysed using HisPur™ Ni-NTA Magnetic Beads and assessed by SDS-PAGE. Formulations included: CA (CoPoP only), CQ (CoPoP/QS-21), CP (CoPoP/PHAD), and CPQ (CoPoP/PHAD/QS-21), compared to soluble p67C (PBS). Non-liposome-bound antigen is shown in lanes “B”, while liposome-bound is shown in lanes “S”. The uncropped blots are shown in . ( C ) Binding capacity of fluorophore-labelled p67C-DY490 to CoPoP liposomes (CA, CQ, CP, and CPQ) was measured and compared with p67C bound to AS01, and ( D ) size and ( E ) zeta potential of p67C bound to CoPoP liposomes were measured by DLS.

Journal: Vaccines

Article Title: Immunogenicity of Theileria parva p67C Antigen Delivered via Adjuvanted CoPoP Liposomes in Cattle and Mice

doi: 10.3390/vaccines14050459

Figure Lengend Snippet: p67C-CoPoP liposome nanoparticle characterisation. ( A ) Schematic representation of the generation of CoPoP liposomes with p67C antigen, including the schematic illustrations of the chemical structures of the key adjuvanting molecules. ( B ) Binding capacity of the p67C antigen to CoPoP liposomes after 3 h incubation in the dark, analysed using HisPur™ Ni-NTA Magnetic Beads and assessed by SDS-PAGE. Formulations included: CA (CoPoP only), CQ (CoPoP/QS-21), CP (CoPoP/PHAD), and CPQ (CoPoP/PHAD/QS-21), compared to soluble p67C (PBS). Non-liposome-bound antigen is shown in lanes “B”, while liposome-bound is shown in lanes “S”. The uncropped blots are shown in . ( C ) Binding capacity of fluorophore-labelled p67C-DY490 to CoPoP liposomes (CA, CQ, CP, and CPQ) was measured and compared with p67C bound to AS01, and ( D ) size and ( E ) zeta potential of p67C bound to CoPoP liposomes were measured by DLS.

Article Snippet: Peptide epitope specificity of the immunised bovine sera was evaluated using ten overlapping biotinylated 15-mer peptides to p67C (Mimotopes Pty, Victoria, Australia [ ]), as previously described [ ].

Techniques: Liposomes, Binding Assay, Incubation, Magnetic Beads, SDS Page, Zeta Potential Analyzer

IgG responses in both cattle and mice immunised with p67C using different CoPoP liposomes. Serum samples from cattle immunised with ( A ) p67C-CA, ( B ) p67C-CP, ( C ) p67C-CQ and ( D ) p67C-CPQ were evaluated using a p67C quantitative ELISA. Kinetics of individual animals are presented in panels ( A – D ), and the mean and standard error of the groups are presented in panel ( E ). Antigen inoculation times are indicated with black arrows in the x-axis. ( F ) Semi-quantification of antibody titres at day 42 in mice immunised with p67C-CPQ or p67C-Alum is presented as the mean of the last positive dilution and standard error per group. Significance is represented by a “*” for p < 0.05.

Journal: Vaccines

Article Title: Immunogenicity of Theileria parva p67C Antigen Delivered via Adjuvanted CoPoP Liposomes in Cattle and Mice

doi: 10.3390/vaccines14050459

Figure Lengend Snippet: IgG responses in both cattle and mice immunised with p67C using different CoPoP liposomes. Serum samples from cattle immunised with ( A ) p67C-CA, ( B ) p67C-CP, ( C ) p67C-CQ and ( D ) p67C-CPQ were evaluated using a p67C quantitative ELISA. Kinetics of individual animals are presented in panels ( A – D ), and the mean and standard error of the groups are presented in panel ( E ). Antigen inoculation times are indicated with black arrows in the x-axis. ( F ) Semi-quantification of antibody titres at day 42 in mice immunised with p67C-CPQ or p67C-Alum is presented as the mean of the last positive dilution and standard error per group. Significance is represented by a “*” for p < 0.05.

Article Snippet: Peptide epitope specificity of the immunised bovine sera was evaluated using ten overlapping biotinylated 15-mer peptides to p67C (Mimotopes Pty, Victoria, Australia [ ]), as previously described [ ].

Techniques: Liposomes, Enzyme-linked Immunosorbent Assay

Cellular response specific to p67C by means of the INFγ-ELISpot assay. ( A ) CD4 + T-cell, ( B ) CD8 + T-cell and ( C ) PBMC responses to 15-mer and 25-mer based on the p67C sequence and p67C protein used as stimuli. Irrelevant peptides and proteins based on the sequence of p67N (N-terminal portion of p67) were used as negative controls. Cells were stimulated for 20 h at 37 °C. Results are presented as the group mean ± standard deviation (SD) of the fold change in the number of spot-forming units compared to the cells stimulated with media only (background). Dotted red lines indicate the cut-off from which the response can be considered different from the background (fold change of 2).

Journal: Vaccines

Article Title: Immunogenicity of Theileria parva p67C Antigen Delivered via Adjuvanted CoPoP Liposomes in Cattle and Mice

doi: 10.3390/vaccines14050459

Figure Lengend Snippet: Cellular response specific to p67C by means of the INFγ-ELISpot assay. ( A ) CD4 + T-cell, ( B ) CD8 + T-cell and ( C ) PBMC responses to 15-mer and 25-mer based on the p67C sequence and p67C protein used as stimuli. Irrelevant peptides and proteins based on the sequence of p67N (N-terminal portion of p67) were used as negative controls. Cells were stimulated for 20 h at 37 °C. Results are presented as the group mean ± standard deviation (SD) of the fold change in the number of spot-forming units compared to the cells stimulated with media only (background). Dotted red lines indicate the cut-off from which the response can be considered different from the background (fold change of 2).

Article Snippet: Peptide epitope specificity of the immunised bovine sera was evaluated using ten overlapping biotinylated 15-mer peptides to p67C (Mimotopes Pty, Victoria, Australia [ ]), as previously described [ ].

Techniques: Enzyme-linked Immunospot, Sequencing, Standard Deviation

IgG reactivity to p67C 15-mer overlapping peptides. Day 42 sera from cattle immunised with p67C-CoPoP liposomes: Group 3 (p67C-CQ) and Group 4 (p67C-CPQ) were analysed by means of an ELISA assay. Results are presented as a heat map of the relative reactivity compared to the sum of responses against all peptides for each animal.

Journal: Vaccines

Article Title: Immunogenicity of Theileria parva p67C Antigen Delivered via Adjuvanted CoPoP Liposomes in Cattle and Mice

doi: 10.3390/vaccines14050459

Figure Lengend Snippet: IgG reactivity to p67C 15-mer overlapping peptides. Day 42 sera from cattle immunised with p67C-CoPoP liposomes: Group 3 (p67C-CQ) and Group 4 (p67C-CPQ) were analysed by means of an ELISA assay. Results are presented as a heat map of the relative reactivity compared to the sum of responses against all peptides for each animal.

Article Snippet: Peptide epitope specificity of the immunised bovine sera was evaluated using ten overlapping biotinylated 15-mer peptides to p67C (Mimotopes Pty, Victoria, Australia [ ]), as previously described [ ].

Techniques: Liposomes, Enzyme-linked Immunosorbent Assay

Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled 35–mer oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.

Journal: Nucleic Acids Research

Article Title: A thumb-domain insertion balances processivity and fidelity in DNA polymerase ε

doi: 10.1093/nar/gkag282

Figure Lengend Snippet: Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled 35–mer oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.

Article Snippet: The substrate for processivity assays was prepared by annealing M13mp18 single-stranded DNA (NEB) with a 5′-TET–labeled 35-mer oligonucleotide (TET-CCCAGTCACGACGTTGTAAAACGACGGCCAGTGCC) in equimolar amounts in 125 mM NaAc (pH 7.8).

Techniques: Labeling