|
New England Biolabs
paqci digested 8 mer fragments Paqci Digested 8 Mer Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mers/bio_rxiv__64898__2026__05__07__722278-341-16-53?v=New+England+Biolabs Average 96 stars, based on 1 article reviews
paqci digested 8 mer fragments - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Sino Biological
mers cov pseudovirus Mers Cov Pseudovirus, supplied by Sino Biological, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mers/pm42034896-58-25-31?v=Sino+Biological Average 95 stars, based on 1 article reviews
mers cov pseudovirus - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
|
Micromedex Inc
merative micromedex red book Merative Micromedex Red Book, supplied by Micromedex Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mers/pm42301711-82-16-17?v=Micromedex+Inc Average 86 stars, based on 1 article reviews
merative micromedex red book - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Pfizer Inc
type i axl mer inhibitor macrocyclic compound 1 ![]() Type I Axl Mer Inhibitor Macrocyclic Compound 1, supplied by Pfizer Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mers/pmc13280880-66-20-4?v=Pfizer+Inc Average 86 stars, based on 1 article reviews
type i axl mer inhibitor macrocyclic compound 1 - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Mimotopes
biotinylated 15 mer peptides to p67c ![]() Biotinylated 15 Mer Peptides To P67c, supplied by Mimotopes, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mers/pmc13211421-118-13-18?v=Mimotopes Average 86 stars, based on 1 article reviews
biotinylated 15 mer peptides to p67c - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
synthetic peptides 34 mer ![]() Synthetic Peptides 34 Mer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mers/pmc13164576-79-1-36?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
synthetic peptides 34 mer - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Sino Biological
mers cov s1 protein ![]() Mers Cov S1 Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mers/us12600988-57-79-82?v=Sino+Biological Average 95 stars, based on 1 article reviews
mers cov s1 protein - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
|
New England Biolabs
35 mer oligonucleotide tet cccagtcacgacgttgtaaaacgacggccagtgcc ![]() 35 Mer Oligonucleotide Tet Cccagtcacgacgttgtaaaacgacggccagtgcc, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mers/pmc13036494-47-16-12?v=New+England+Biolabs Average 96 stars, based on 1 article reviews
35 mer oligonucleotide tet cccagtcacgacgttgtaaaacgacggccagtgcc - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Quantum Detectors Ltd
scan engine ![]() Scan Engine, supplied by Quantum Detectors Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mers/pm41949033-33-8-10?v=Quantum+Detectors+Ltd Average 94 stars, based on 1 article reviews
scan engine - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
Journal: ACS Omega
Article Title: Structure-Based Drug Discovery of Triazine Derivatives as Potent and Orally Bioavailable AXL Inhibitors for Cancer Therapy
doi: 10.1021/acsomega.6c04179
Figure Lengend Snippet: Molecular docking results of three compounds with the kinase domains of MER and AXL. (A) Molecular docking of merestinib with MER kinase domain (PDB: 7AAY ). (B) Binding mode analysis of compound 1 to the AXL kinase domain (PDB: 5U6B ). (C) Molecular docking of merestinib with AXL DFG-out homologous modeling. (D) Molecular docking of compound w4 with AXL DFG-out homologous modeling.
Article Snippet: In 2017, researchers from
Techniques: Binding Assay
Journal: Vaccines
Article Title: Immunogenicity of Theileria parva p67C Antigen Delivered via Adjuvanted CoPoP Liposomes in Cattle and Mice
doi: 10.3390/vaccines14050459
Figure Lengend Snippet: p67C-CoPoP liposome nanoparticle characterisation. ( A ) Schematic representation of the generation of CoPoP liposomes with p67C antigen, including the schematic illustrations of the chemical structures of the key adjuvanting molecules. ( B ) Binding capacity of the p67C antigen to CoPoP liposomes after 3 h incubation in the dark, analysed using HisPur™ Ni-NTA Magnetic Beads and assessed by SDS-PAGE. Formulations included: CA (CoPoP only), CQ (CoPoP/QS-21), CP (CoPoP/PHAD), and CPQ (CoPoP/PHAD/QS-21), compared to soluble p67C (PBS). Non-liposome-bound antigen is shown in lanes “B”, while liposome-bound is shown in lanes “S”. The uncropped blots are shown in . ( C ) Binding capacity of fluorophore-labelled p67C-DY490 to CoPoP liposomes (CA, CQ, CP, and CPQ) was measured and compared with p67C bound to AS01, and ( D ) size and ( E ) zeta potential of p67C bound to CoPoP liposomes were measured by DLS.
Article Snippet: Peptide epitope specificity of the immunised bovine sera was evaluated using ten overlapping
Techniques: Liposomes, Binding Assay, Incubation, Magnetic Beads, SDS Page, Zeta Potential Analyzer
Journal: Vaccines
Article Title: Immunogenicity of Theileria parva p67C Antigen Delivered via Adjuvanted CoPoP Liposomes in Cattle and Mice
doi: 10.3390/vaccines14050459
Figure Lengend Snippet: IgG responses in both cattle and mice immunised with p67C using different CoPoP liposomes. Serum samples from cattle immunised with ( A ) p67C-CA, ( B ) p67C-CP, ( C ) p67C-CQ and ( D ) p67C-CPQ were evaluated using a p67C quantitative ELISA. Kinetics of individual animals are presented in panels ( A – D ), and the mean and standard error of the groups are presented in panel ( E ). Antigen inoculation times are indicated with black arrows in the x-axis. ( F ) Semi-quantification of antibody titres at day 42 in mice immunised with p67C-CPQ or p67C-Alum is presented as the mean of the last positive dilution and standard error per group. Significance is represented by a “*” for p < 0.05.
Article Snippet: Peptide epitope specificity of the immunised bovine sera was evaluated using ten overlapping
Techniques: Liposomes, Enzyme-linked Immunosorbent Assay
Journal: Vaccines
Article Title: Immunogenicity of Theileria parva p67C Antigen Delivered via Adjuvanted CoPoP Liposomes in Cattle and Mice
doi: 10.3390/vaccines14050459
Figure Lengend Snippet: Cellular response specific to p67C by means of the INFγ-ELISpot assay. ( A ) CD4 + T-cell, ( B ) CD8 + T-cell and ( C ) PBMC responses to 15-mer and 25-mer based on the p67C sequence and p67C protein used as stimuli. Irrelevant peptides and proteins based on the sequence of p67N (N-terminal portion of p67) were used as negative controls. Cells were stimulated for 20 h at 37 °C. Results are presented as the group mean ± standard deviation (SD) of the fold change in the number of spot-forming units compared to the cells stimulated with media only (background). Dotted red lines indicate the cut-off from which the response can be considered different from the background (fold change of 2).
Article Snippet: Peptide epitope specificity of the immunised bovine sera was evaluated using ten overlapping
Techniques: Enzyme-linked Immunospot, Sequencing, Standard Deviation
Journal: Vaccines
Article Title: Immunogenicity of Theileria parva p67C Antigen Delivered via Adjuvanted CoPoP Liposomes in Cattle and Mice
doi: 10.3390/vaccines14050459
Figure Lengend Snippet: IgG reactivity to p67C 15-mer overlapping peptides. Day 42 sera from cattle immunised with p67C-CoPoP liposomes: Group 3 (p67C-CQ) and Group 4 (p67C-CPQ) were analysed by means of an ELISA assay. Results are presented as a heat map of the relative reactivity compared to the sum of responses against all peptides for each animal.
Article Snippet: Peptide epitope specificity of the immunised bovine sera was evaluated using ten overlapping
Techniques: Liposomes, Enzyme-linked Immunosorbent Assay
Journal: Nucleic Acids Research
Article Title: A thumb-domain insertion balances processivity and fidelity in DNA polymerase ε
doi: 10.1093/nar/gkag282
Figure Lengend Snippet: Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled 35–mer oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.
Article Snippet: The substrate for processivity assays was prepared by annealing M13mp18 single-stranded DNA (
Techniques: Labeling