Review





Similar Products

99
ATCC s epidermidis strain llp 16 16s ribosomal rna gene
Distribution of nucleotide probabilities and two 20-bp motifs in <t>16S</t> <t>rRNA</t> genes of various S. epidermidis isolates. The probability (0.0–1.0) of each nucleotide in 16S rRNA genes of 2,507 S. epidermidis isolates available in a database ( www.arb-silva.de ) was calculated and plotted as a sequence pLogo ( a ). The x-axis represents the position of nucleotides in a 16S rRNA gene (1,562 bp). The y-axis represents the probability of each nucleotide proportional to the height of their representative letters, A, C, G and T. b Two feature 20-bp motifs with a high similarity appearing in 2,507 S. epidermidis isolates were identified at nucleotide positions from 1 to 400 (a red rectangle) and 401 to 800 (a purple rectangle), respectively. The similarity of each nucleotide at position 1–800 among 2,507 16S rRNA genes was scaled from a low (light green) to high (dark green) level
S Epidermidis Strain Llp 16 16s Ribosomal Rna Gene, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/s epidermidis strain llp 16 16s ribosomal rna gene/product/ATCC
Average 99 stars, based on 1 article reviews
s epidermidis strain llp 16 16s ribosomal rna gene - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

94
MedChemExpress llps
Distribution of nucleotide probabilities and two 20-bp motifs in <t>16S</t> <t>rRNA</t> genes of various S. epidermidis isolates. The probability (0.0–1.0) of each nucleotide in 16S rRNA genes of 2,507 S. epidermidis isolates available in a database ( www.arb-silva.de ) was calculated and plotted as a sequence pLogo ( a ). The x-axis represents the position of nucleotides in a 16S rRNA gene (1,562 bp). The y-axis represents the probability of each nucleotide proportional to the height of their representative letters, A, C, G and T. b Two feature 20-bp motifs with a high similarity appearing in 2,507 S. epidermidis isolates were identified at nucleotide positions from 1 to 400 (a red rectangle) and 401 to 800 (a purple rectangle), respectively. The similarity of each nucleotide at position 1–800 among 2,507 16S rRNA genes was scaled from a low (light green) to high (dark green) level
Llps, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/llps/product/MedChemExpress
Average 94 stars, based on 1 article reviews
llps - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

99
ATCC hek 293t llp icasp9 blast
Distribution of nucleotide probabilities and two 20-bp motifs in <t>16S</t> <t>rRNA</t> genes of various S. epidermidis isolates. The probability (0.0–1.0) of each nucleotide in 16S rRNA genes of 2,507 S. epidermidis isolates available in a database ( www.arb-silva.de ) was calculated and plotted as a sequence pLogo ( a ). The x-axis represents the position of nucleotides in a 16S rRNA gene (1,562 bp). The y-axis represents the probability of each nucleotide proportional to the height of their representative letters, A, C, G and T. b Two feature 20-bp motifs with a high similarity appearing in 2,507 S. epidermidis isolates were identified at nucleotide positions from 1 to 400 (a red rectangle) and 401 to 800 (a purple rectangle), respectively. The similarity of each nucleotide at position 1–800 among 2,507 16S rRNA genes was scaled from a low (light green) to high (dark green) level
Hek 293t Llp Icasp9 Blast, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hek 293t llp icasp9 blast/product/ATCC
Average 99 stars, based on 1 article reviews
hek 293t llp icasp9 blast - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

94
Proteintech llps caprin1 proteintech 15112 1 ap
Distribution of nucleotide probabilities and two 20-bp motifs in <t>16S</t> <t>rRNA</t> genes of various S. epidermidis isolates. The probability (0.0–1.0) of each nucleotide in 16S rRNA genes of 2,507 S. epidermidis isolates available in a database ( www.arb-silva.de ) was calculated and plotted as a sequence pLogo ( a ). The x-axis represents the position of nucleotides in a 16S rRNA gene (1,562 bp). The y-axis represents the probability of each nucleotide proportional to the height of their representative letters, A, C, G and T. b Two feature 20-bp motifs with a high similarity appearing in 2,507 S. epidermidis isolates were identified at nucleotide positions from 1 to 400 (a red rectangle) and 401 to 800 (a purple rectangle), respectively. The similarity of each nucleotide at position 1–800 among 2,507 16S rRNA genes was scaled from a low (light green) to high (dark green) level
Llps Caprin1 Proteintech 15112 1 Ap, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/llps caprin1 proteintech 15112 1 ap/product/Proteintech
Average 94 stars, based on 1 article reviews
llps caprin1 proteintech 15112 1 ap - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

90
Thermo Fisher doxycycline-inducible lentivirus vectors for llps-deficient fus mutants
Distribution of nucleotide probabilities and two 20-bp motifs in <t>16S</t> <t>rRNA</t> genes of various S. epidermidis isolates. The probability (0.0–1.0) of each nucleotide in 16S rRNA genes of 2,507 S. epidermidis isolates available in a database ( www.arb-silva.de ) was calculated and plotted as a sequence pLogo ( a ). The x-axis represents the position of nucleotides in a 16S rRNA gene (1,562 bp). The y-axis represents the probability of each nucleotide proportional to the height of their representative letters, A, C, G and T. b Two feature 20-bp motifs with a high similarity appearing in 2,507 S. epidermidis isolates were identified at nucleotide positions from 1 to 400 (a red rectangle) and 401 to 800 (a purple rectangle), respectively. The similarity of each nucleotide at position 1–800 among 2,507 16S rRNA genes was scaled from a low (light green) to high (dark green) level
Doxycycline Inducible Lentivirus Vectors For Llps Deficient Fus Mutants, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/doxycycline-inducible lentivirus vectors for llps-deficient fus mutants/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
doxycycline-inducible lentivirus vectors for llps-deficient fus mutants - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Porous Materials Inc llp-1200a
Distribution of nucleotide probabilities and two 20-bp motifs in <t>16S</t> <t>rRNA</t> genes of various S. epidermidis isolates. The probability (0.0–1.0) of each nucleotide in 16S rRNA genes of 2,507 S. epidermidis isolates available in a database ( www.arb-silva.de ) was calculated and plotted as a sequence pLogo ( a ). The x-axis represents the position of nucleotides in a 16S rRNA gene (1,562 bp). The y-axis represents the probability of each nucleotide proportional to the height of their representative letters, A, C, G and T. b Two feature 20-bp motifs with a high similarity appearing in 2,507 S. epidermidis isolates were identified at nucleotide positions from 1 to 400 (a red rectangle) and 401 to 800 (a purple rectangle), respectively. The similarity of each nucleotide at position 1–800 among 2,507 16S rRNA genes was scaled from a low (light green) to high (dark green) level
Llp 1200a, supplied by Porous Materials Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/llp-1200a/product/Porous Materials Inc
Average 90 stars, based on 1 article reviews
llp-1200a - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
CH Instruments llp-dox
Distribution of nucleotide probabilities and two 20-bp motifs in <t>16S</t> <t>rRNA</t> genes of various S. epidermidis isolates. The probability (0.0–1.0) of each nucleotide in 16S rRNA genes of 2,507 S. epidermidis isolates available in a database ( www.arb-silva.de ) was calculated and plotted as a sequence pLogo ( a ). The x-axis represents the position of nucleotides in a 16S rRNA gene (1,562 bp). The y-axis represents the probability of each nucleotide proportional to the height of their representative letters, A, C, G and T. b Two feature 20-bp motifs with a high similarity appearing in 2,507 S. epidermidis isolates were identified at nucleotide positions from 1 to 400 (a red rectangle) and 401 to 800 (a purple rectangle), respectively. The similarity of each nucleotide at position 1–800 among 2,507 16S rRNA genes was scaled from a low (light green) to high (dark green) level
Llp Dox, supplied by CH Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/llp-dox/product/CH Instruments
Average 90 stars, based on 1 article reviews
llp-dox - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
CH Instruments chi/ha/pei/llp-dox
Distribution of nucleotide probabilities and two 20-bp motifs in <t>16S</t> <t>rRNA</t> genes of various S. epidermidis isolates. The probability (0.0–1.0) of each nucleotide in 16S rRNA genes of 2,507 S. epidermidis isolates available in a database ( www.arb-silva.de ) was calculated and plotted as a sequence pLogo ( a ). The x-axis represents the position of nucleotides in a 16S rRNA gene (1,562 bp). The y-axis represents the probability of each nucleotide proportional to the height of their representative letters, A, C, G and T. b Two feature 20-bp motifs with a high similarity appearing in 2,507 S. epidermidis isolates were identified at nucleotide positions from 1 to 400 (a red rectangle) and 401 to 800 (a purple rectangle), respectively. The similarity of each nucleotide at position 1–800 among 2,507 16S rRNA genes was scaled from a low (light green) to high (dark green) level
Chi/Ha/Pei/Llp Dox, supplied by CH Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chi/ha/pei/llp-dox/product/CH Instruments
Average 90 stars, based on 1 article reviews
chi/ha/pei/llp-dox - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


Distribution of nucleotide probabilities and two 20-bp motifs in 16S rRNA genes of various S. epidermidis isolates. The probability (0.0–1.0) of each nucleotide in 16S rRNA genes of 2,507 S. epidermidis isolates available in a database ( www.arb-silva.de ) was calculated and plotted as a sequence pLogo ( a ). The x-axis represents the position of nucleotides in a 16S rRNA gene (1,562 bp). The y-axis represents the probability of each nucleotide proportional to the height of their representative letters, A, C, G and T. b Two feature 20-bp motifs with a high similarity appearing in 2,507 S. epidermidis isolates were identified at nucleotide positions from 1 to 400 (a red rectangle) and 401 to 800 (a purple rectangle), respectively. The similarity of each nucleotide at position 1–800 among 2,507 16S rRNA genes was scaled from a low (light green) to high (dark green) level

Journal: Current Microbiology

Article Title: Ribotyping Staphylococcus epidermidis Using Probabilistic Sequence Analysis and Levenshtein Distance Algorithm

doi: 10.1007/s00284-024-04057-1

Figure Lengend Snippet: Distribution of nucleotide probabilities and two 20-bp motifs in 16S rRNA genes of various S. epidermidis isolates. The probability (0.0–1.0) of each nucleotide in 16S rRNA genes of 2,507 S. epidermidis isolates available in a database ( www.arb-silva.de ) was calculated and plotted as a sequence pLogo ( a ). The x-axis represents the position of nucleotides in a 16S rRNA gene (1,562 bp). The y-axis represents the probability of each nucleotide proportional to the height of their representative letters, A, C, G and T. b Two feature 20-bp motifs with a high similarity appearing in 2,507 S. epidermidis isolates were identified at nucleotide positions from 1 to 400 (a red rectangle) and 401 to 800 (a purple rectangle), respectively. The similarity of each nucleotide at position 1–800 among 2,507 16S rRNA genes was scaled from a low (light green) to high (dark green) level

Article Snippet: A10 , GGCTGCGCTGCTATACATGCAGTCGAGCGAACAGACGAGGAGCTTGCTCCTCTGACGTTAGCGGCGGACGGGTGAGTAACACGTGGATAACCTACCTATAAGACTGGGATAACTTCGGGAAACCGGAGCTAATACCGGATAATATATTGAACCGCATGGTTCAATAGTGAAAGACGGTTTTGCTGTCACTTATAGATGGATCCGCGCCGCATTAGCTAGTTGGTAAGGTAACGGCTTACCAAGGCAACGATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACAAATGTGTAAGTAACTATGCACGTCTTGACGGTACCTAATCAGAAAGCCACGGCTAACTACGTGCCAGCAGGGCGGGGGTAATTGA , 100%; S. epidermidis strain LLP-16 16S ribosomal RNA gene, partial sequence; KU821700.1 99.21%; S. epidermidis ATCC 12228.

Techniques: Sequencing

 16S   rRNA  gene sequences of 32 S. epidermidis isolates

Journal: Current Microbiology

Article Title: Ribotyping Staphylococcus epidermidis Using Probabilistic Sequence Analysis and Levenshtein Distance Algorithm

doi: 10.1007/s00284-024-04057-1

Figure Lengend Snippet: 16S rRNA gene sequences of 32 S. epidermidis isolates

Article Snippet: A10 , GGCTGCGCTGCTATACATGCAGTCGAGCGAACAGACGAGGAGCTTGCTCCTCTGACGTTAGCGGCGGACGGGTGAGTAACACGTGGATAACCTACCTATAAGACTGGGATAACTTCGGGAAACCGGAGCTAATACCGGATAATATATTGAACCGCATGGTTCAATAGTGAAAGACGGTTTTGCTGTCACTTATAGATGGATCCGCGCCGCATTAGCTAGTTGGTAAGGTAACGGCTTACCAAGGCAACGATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACAAATGTGTAAGTAACTATGCACGTCTTGACGGTACCTAATCAGAAAGCCACGGCTAACTACGTGCCAGCAGGGCGGGGGTAATTGA , 100%; S. epidermidis strain LLP-16 16S ribosomal RNA gene, partial sequence; KU821700.1 99.21%; S. epidermidis ATCC 12228.

Techniques: Sequencing

Phylogenetic tree constructed using the ClustalW software with a PhyML model based on the 16S rRNA gene. The phylogenetic tress displayed the relationships of three S. epidermidis isolates (S1-S3) (red squares) on the human scalp to various S. epidermidis isolates at different human body locations (Table ). S. epidermidis strains were collected from ATCC 12228 (ATCC), acne lesions (Ac1-Ac5), human fingertips (A1-A11), human vagina (V1-V6), human breast milk (B1-B4) and yogurt (Y1-Y2). Genetic distance from 0 to 1.8 was shown

Journal: Current Microbiology

Article Title: Ribotyping Staphylococcus epidermidis Using Probabilistic Sequence Analysis and Levenshtein Distance Algorithm

doi: 10.1007/s00284-024-04057-1

Figure Lengend Snippet: Phylogenetic tree constructed using the ClustalW software with a PhyML model based on the 16S rRNA gene. The phylogenetic tress displayed the relationships of three S. epidermidis isolates (S1-S3) (red squares) on the human scalp to various S. epidermidis isolates at different human body locations (Table ). S. epidermidis strains were collected from ATCC 12228 (ATCC), acne lesions (Ac1-Ac5), human fingertips (A1-A11), human vagina (V1-V6), human breast milk (B1-B4) and yogurt (Y1-Y2). Genetic distance from 0 to 1.8 was shown

Article Snippet: A10 , GGCTGCGCTGCTATACATGCAGTCGAGCGAACAGACGAGGAGCTTGCTCCTCTGACGTTAGCGGCGGACGGGTGAGTAACACGTGGATAACCTACCTATAAGACTGGGATAACTTCGGGAAACCGGAGCTAATACCGGATAATATATTGAACCGCATGGTTCAATAGTGAAAGACGGTTTTGCTGTCACTTATAGATGGATCCGCGCCGCATTAGCTAGTTGGTAAGGTAACGGCTTACCAAGGCAACGATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACAAATGTGTAAGTAACTATGCACGTCTTGACGGTACCTAATCAGAAAGCCACGGCTAACTACGTGCCAGCAGGGCGGGGGTAATTGA , 100%; S. epidermidis strain LLP-16 16S ribosomal RNA gene, partial sequence; KU821700.1 99.21%; S. epidermidis ATCC 12228.

Techniques: Construct, Software

Similarities of the 20-bp motif in PCR-amplified reads of 16S rRNA genes among various S. epidermidis isolates. A feature 20-bp motif (orange line) including last 15 bp (blue line) in nucleotides at positions 367–386 was identified from 2,507 S. epidermidis isolates in a rRNA database ( www.arb-silva.de ) (Fig. b). Thirty-one PCR-amplified16S rRNA gene sequences were obtained from various S. epidermidis bacteria, which were not in the rRNA database, were isolated from human scalp (S1-S3), acne lesions (Ac1-Ac5), fingertips (A1-A11), vagina (V1-V6), breast milk (B1-B4) and yogurt (Y1 and Y2). Two 20-bp domains in PCR-amplified reads at nucleotide positions 1–400 and 401–800, respectively, for each S. epidermidis bacterium were identified by Levenshtein distance algorithm (Table ). The similarities (%) between the feature motif and the first 20-bp (including last 15 bp) domains at nucleotide positions 1–400 in 31 S. epidermidis isolates were calculated. The 16S rRNA gene sequence of S. epidermidis (ATCC 12228) was included for comparison. In contrast to S1 and Ac1 (green arrows), S3, Ac3 and Ac4 (red arrows) carried the first 20-bp domains with sequences which were highly similar to those in the 20-bp motif in a reference sequence

Journal: Current Microbiology

Article Title: Ribotyping Staphylococcus epidermidis Using Probabilistic Sequence Analysis and Levenshtein Distance Algorithm

doi: 10.1007/s00284-024-04057-1

Figure Lengend Snippet: Similarities of the 20-bp motif in PCR-amplified reads of 16S rRNA genes among various S. epidermidis isolates. A feature 20-bp motif (orange line) including last 15 bp (blue line) in nucleotides at positions 367–386 was identified from 2,507 S. epidermidis isolates in a rRNA database ( www.arb-silva.de ) (Fig. b). Thirty-one PCR-amplified16S rRNA gene sequences were obtained from various S. epidermidis bacteria, which were not in the rRNA database, were isolated from human scalp (S1-S3), acne lesions (Ac1-Ac5), fingertips (A1-A11), vagina (V1-V6), breast milk (B1-B4) and yogurt (Y1 and Y2). Two 20-bp domains in PCR-amplified reads at nucleotide positions 1–400 and 401–800, respectively, for each S. epidermidis bacterium were identified by Levenshtein distance algorithm (Table ). The similarities (%) between the feature motif and the first 20-bp (including last 15 bp) domains at nucleotide positions 1–400 in 31 S. epidermidis isolates were calculated. The 16S rRNA gene sequence of S. epidermidis (ATCC 12228) was included for comparison. In contrast to S1 and Ac1 (green arrows), S3, Ac3 and Ac4 (red arrows) carried the first 20-bp domains with sequences which were highly similar to those in the 20-bp motif in a reference sequence

Article Snippet: A10 , GGCTGCGCTGCTATACATGCAGTCGAGCGAACAGACGAGGAGCTTGCTCCTCTGACGTTAGCGGCGGACGGGTGAGTAACACGTGGATAACCTACCTATAAGACTGGGATAACTTCGGGAAACCGGAGCTAATACCGGATAATATATTGAACCGCATGGTTCAATAGTGAAAGACGGTTTTGCTGTCACTTATAGATGGATCCGCGCCGCATTAGCTAGTTGGTAAGGTAACGGCTTACCAAGGCAACGATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACAAATGTGTAAGTAACTATGCACGTCTTGACGGTACCTAATCAGAAAGCCACGGCTAACTACGTGCCAGCAGGGCGGGGGTAATTGA , 100%; S. epidermidis strain LLP-16 16S ribosomal RNA gene, partial sequence; KU821700.1 99.21%; S. epidermidis ATCC 12228.

Techniques: Amplification, Bacteria, Isolation, Sequencing, Comparison