Review





Similar Products

laminin gamma 1 antibody / lamc1 / lamb2  (NSJ Bioreagents)
99
NSJ Bioreagents laminin gamma 1 antibody / lamc1 / lamb2
Laminin Gamma 1 Antibody / Lamc1 / Lamb2, supplied by NSJ Bioreagents, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lamc1/Laminin+gamma+1+Antibody+%2F+LAMC1+%2F+LAMB2/custom%40v2682%4042449160
Average 99 stars, based on 1 article reviews
laminin gamma 1 antibody / lamc1 / lamb2 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
laminin gamma 1 antibody / lamc1  (NSJ Bioreagents)
99
NSJ Bioreagents laminin gamma 1 antibody / lamc1
Laminin Gamma 1 Antibody / Lamc1, supplied by NSJ Bioreagents, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lamc1/Laminin+gamma+1+Antibody+%2F+LAMC1/custom%40v2682%4042093027
Average 99 stars, based on 1 article reviews
laminin gamma 1 antibody / lamc1 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
lamc1 fw tagccctgtgctgcaggaat rv acactcgcttgcgtgtccat  (Merck & Co)
86
Merck & Co lamc1 fw tagccctgtgctgcaggaat rv acactcgcttgcgtgtccat
Validation of coding and non-coding DEGs (A) Expression of some modified coding DEGs ( RPLP1, SPTAN1, ARPC2, COL4A1, and <t>LAMC1</t> ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. One-way ANOVA using Sidak’s post-test. (B) Expression of 2 modified non-coding RNAs ( VIM-AS1 and CYTOR ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05. One-way ANOVA using Sidak’s post.
Lamc1 Fw Tagccctgtgctgcaggaat Rv Acactcgcttgcgtgtccat, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lamc1/actagtacacccccgacgtgtt+as1+atgtgaggcccaggcattga+fw+rv+vim/pmc12996707-56-0-4
Average 86 stars, based on 1 article reviews
lamc1 fw tagccctgtgctgcaggaat rv acactcgcttgcgtgtccat - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
mouse lamc1 overexpression sequence  (Genechem)
86
Genechem mouse lamc1 overexpression sequence
Validation of coding and non-coding DEGs (A) Expression of some modified coding DEGs ( RPLP1, SPTAN1, ARPC2, COL4A1, and <t>LAMC1</t> ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. One-way ANOVA using Sidak’s post-test. (B) Expression of 2 modified non-coding RNAs ( VIM-AS1 and CYTOR ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05. One-way ANOVA using Sidak’s post.
Mouse Lamc1 Overexpression Sequence, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lamc1/bag2+cdna+human+mrna/pm41534552-136-13-27
Average 86 stars, based on 1 article reviews
mouse lamc1 overexpression sequence - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
lamc1  (Genechem)
86
Genechem lamc1
Validation of coding and non-coding DEGs (A) Expression of some modified coding DEGs ( RPLP1, SPTAN1, ARPC2, COL4A1, and <t>LAMC1</t> ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. One-way ANOVA using Sidak’s post-test. (B) Expression of 2 modified non-coding RNAs ( VIM-AS1 and CYTOR ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05. One-way ANOVA using Sidak’s post.
Lamc1, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lamc1/bag2+cdna+human+mrna/pm41534552-136-8-27
Average 86 stars, based on 1 article reviews
lamc1 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results


Validation of coding and non-coding DEGs (A) Expression of some modified coding DEGs ( RPLP1, SPTAN1, ARPC2, COL4A1, and LAMC1 ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. One-way ANOVA using Sidak’s post-test. (B) Expression of 2 modified non-coding RNAs ( VIM-AS1 and CYTOR ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05. One-way ANOVA using Sidak’s post.

Journal: iScience

Article Title: Electromagnetic exposure changes human Schwann cell motility and transcriptomic profile of hearing-loss-related genes

doi: 10.1016/j.isci.2026.115130

Figure Lengend Snippet: Validation of coding and non-coding DEGs (A) Expression of some modified coding DEGs ( RPLP1, SPTAN1, ARPC2, COL4A1, and LAMC1 ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. One-way ANOVA using Sidak’s post-test. (B) Expression of 2 modified non-coding RNAs ( VIM-AS1 and CYTOR ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05. One-way ANOVA using Sidak’s post.

Article Snippet: LAMC1 FW:TAGCCCTGTGCTGCAGGAAT Rv:ACACTCGCTTGCGTGTCCAT , Merck Life Science, Milan, Italy , –.

Techniques: Biomarker Discovery, Expressing, Modification, Quantitative RT-PCR, Control